case study questions on biotechnology

Global Dimensions of Intellectual Property Rights in Science and Technology (1993)

Chapter: 13 biotechnology case study, 13 biotechnology case study.

GEORGE B. RATHMANN

I want to describe a bit of the history of the biotechnology field to give you a strong sense of the importance of this field, not just in itself but as a prelude to a new technology as it develops over the next century. I then relate that history to some questions that have been raised and finally relate my conclusions with respect to biotechnology to the objectives of the conference.

As rocky as the road for biotechnology was in the United States, what we see coming up on the world scene is much more difficult, much more serious. We desperately need a legal system to solve the problems, and it is our hope that there are ways of dealing with these issues.

The biotech era really dawned when Watson and Crick defined the structure of deoxyribonucleic acid (DNA). As with many world-shattering discoveries, this was simple and concise—a publication of one page outlining the structure of DNA ( Nature, April 25, 1953, p. 737). They also had the vision to say it would affect not only how we looked at deoxyribonucleic acid, but how we looked at life itself and our ability to understand living systems. There would be products, there would be opportunities, and there would be new insights that would be most important. All that was recognized in a one-page article.

As important and earth shaking as that was, from the standpoint of the commercialization of biotechnology, something nearly as important occurred on June 17, 1980, when the Supreme Court ruled that live organisms could be patented. It was well recognized as important at the time, but I think few

people realized how important it was for launching the commercialization of biotechnology.

In that patent, Dr. Ananda Chakrabarty, who was at G.E. at the time, claimed an organism that would digest oil. The invention was never commercialized, but it told the world that this field was going to be important and there were going to be commercial opportunities. An investment in trying to understand the biochemistry of life would pay off in the sense that the intellectual property could be protected. Within four months (October 14, 1980), the biotechnology company Genentech went public and jolted Wall Street with a rise in its stock price from $35 to $71 1/4. So it is clear that as of that date, biotechnology assumed increasing commercial importance.

At that time, in October 1980, I was looking at the opportunity to start a biotech company called Amgen and we were putting out a document that we hoped would raise $15 million. Partly because of Genentech's success, we were able to raise $19 million—with only a scientific advisory board, one employee, and promises for two future hires. So it certainly had a profound effect on whether Amgen would ever be. As a matter of fact, within a year, Amgen, Genetics Institute, Immunex, Genetics Systems, Chiron, and many others companies were formed. Within two years, more than 100 companies were formed as this era was launched.

Now, the Chakrabarty decision made it look simple: life forms were patentable. Genentech, Cetus and many others afterwards launched public offerings, recognizing the commercial potential that biotechnology would lead to new discoveries of valuable intellectual property, which could be protected by patents. In reality, it was not quite that simple and the launchings were not that consistent.

Venture capital funds vacillated quite a bit, although after 1980 there was a very substantial influx of venture capital ( Figure 13-1 ). There were periods when it went down, and periods when it went up. Although these look like gigantic numbers, remember it takes about a quarter of a billion dollars to bring a pharmaceutical product to market. It probably takes more than that to commercialize something important in agriculture, food, or other areas. So this flow of venture capital was actually inadequate to keep it going. Of course, the public made the difference, but it can be seen that this was not exactly a consistent, reliable source of funds, either.

If we smooth everything out, the market value of biotechnology stocks moved dramatically from 1980, when it was literally zero, to 1991, when it was more than $35 billion ( Figure 13-2 ). Those of us in the industry saw some very serious bumps in that curve. In 1987 some biotech companies lost 30-40 percent of the value of the company in a matter of a few days. When you finally smooth everything out, it looks a lot simpler and surer than it felt.

FIGURE 13-1 Venture Capital Disbursements in Biotechnology

Source: Venture Economics and Ernst and Young

Figure 13-3 shows the amount of capital raised through public stock offerings. In 1991, more money was raised in six months than for many years, and as a matter of fact, when the total figures came in for the year they exceeded $4 billion—equal to all the money that had been raised in the previous years since the launching of commercial biotechnology. Of course, the big news is $550 million in initial public offerings. Those are new companies whose survival may mean wonderful improvements to our lives around the world. At the same time they will be facing some of the rocky roads that the earlier companies faced. So we can see that it is not a steady, easy trip.

Product sales in the industry today have reached about $8 billion and are expected to reach $20 billion by the year 2000. That may be a very conservative figure. The drug industry worldwide by that time will be well over $200 billion, and biotechnology is contributing roughly half of the most important products today. By the time the year 2000 comes around, biotechnology-derived products could be even more important. Of course there should be many other parts of the biotech industry that are commercially interesting by that time.

FIGURE 13-2 Market Value of Biotechnology Stocks

FIGURE 13-3 Amount of Capital Raised Through Initial Public Offerings and Other Public Offerings

Source: Paine Webber and Ernst and Young

So we are looking at something of great importance to the economy of the country and to international trade, which is discussed below.

I was asked by the National Research Council to address several questions. The first was, What adjustments in intellectual property rights have been made? Well, of course, the first is the allowance of claims to living organisms. The United States certainly led the way there. It was a very important opportunity that organisms that produced a pharmaceutical material could be claimed in patents. We had something tangible to claim even if the product being produced was already known or already had been defined.

One of the things that has been evolving over the last few years, and certainly in 1987 had a pretty dismal outlook, is referred to as In re Durden . This case implied that just because you have a novel starting material on which you carry out a process to produce another material, the process is not automatically patentable. That case was often interpreted much more severely to mean that unless the process is highly inventive, mere novelty because of novel starting materials does not make it patentable. So it was not possible in 1987 to get claims to the process that was going to produce, for example, in Amgen's case, erythropoietin by using a novel organism.

Because inventors could not claim the process, they had a very serious problem. They could not invoke any rights at all against companies who used their organism overseas, produced the product, and brought it in. They did not have a final product claim; they did not have a process claim; and there was no mechanism for protecting against the direct theft of the organism overseas—copying it, or following the teachings of the patent, and then just shipping the product to the United States.

However, an evolution has occurred since then. Certainly, a lot of process claims have now been granted. There is a bill authored by Congressman Boucher that would give guidance to the Patent Office to make sure it issues those claims. Without those claims, the organism patent is meaningless with respect to overseas competition. What if the overseas country does not issue the organism patent? The organism has only one purpose—to produce the protein, so the inventor is left with no protection against importation. Amazingly enough, the inventor is protected from infringement in the United States by U.S. companies but is unable to stop foreign infringement and U.S. importation. The trade implications are clear.

This has been a very serious problem that is now being addressed. Yet there are still concerns from people who wonder if it is really "fair" to keep foreign companies from bringing their products into the United States. They ask, "Isn't that protectionism?" This a very strange interpretation of fairness. I think these inventions are clearly being copied and misappropriated by foreign companies. Changes may or may not move smoothly, but these issues should be resolved in the next few years, and more and more compa-

nies are availing themselves of the process protection, though some opportunities have been abandoned after In re Durden objections.

There have been great differences in the interpretation of the scope of claims. My initial discussion is limited to the United States because global issues have really only come into play in the least five years. Even in the United States, the scope of claims has been quite a difficult issue with which to deal. The questions stated are, If the claims are too broad, doesn't it mean we are inhibiting the diffusion of technology? If the claims are too narrow, doesn't it mean that the inventor really is disadvantaged? I could say a lot about that, but in actual fact I will cite the record. A Boston court in the United States leaned toward a pretty narrow interpretation of the claims. In a Delaware court, a jury decided that the Genentech case should be very broadly interpreted and cover structures quite different from the ones that were defined in the patent simply because all the rest were straightforward once the patent teachings were available. So these are still issues, but I think we will move toward a pretty clear understanding over the next few years.

The effect on biotechnology advancement has not been smooth even in this country. Patent uncertainty has encouraged second entrants, who then plead that since they made such a significant investment, believing they were not going to be prevented from manufacturing the product, the terms of the claims of the patents should be relaxed. This has certainly been an expensive mistake in many cases.

Major delays in issuance of patents have prevented some innovators from pushing their products as rapidly as they could, because they feared that they might never have coverage and once they proved the success of the product, it could be duplicated relatively readily. I think many of us in the business got a lot of encouragement from the Orphan Drug Act, because that act suggested that we at least could get six years of protection if we were the first to have a product approved for an orphan indication. If we never received adequate patent protection, we still might be able to recoup our investments, which was very comforting. There has been a lot of controversy about the Orphan Drug Act and whether it should serve as a kind of substitute for the Patent Act. Nevertheless, it helped an embryonic biotechnology industry raise money and sustain its early critical momentum.

Finally, patents played a key role in attracting pharmaceutical companies' investments. These were very important for some companies in the early days. Even though the pharmaceutical companies were not the innovators, they certainly helped support many new biotechnology companies and they clearly needed the confidence of patent exclusivity.

As stated in congressional testimony by Dr. P. Roy Vagelos, Chairman of Merck & Co., "To sustain their ability to discover and develop products which form the basis of American competitiveness, U.S. pharmaceutical

companies count on renewed government support ... in strengthening international protection of intellectual property rights." We can illustrate that perhaps even more significantly in the biotech industry.

For example, in 1986 a pharmaceutical product would cost about $94 million and take somewhere between 10 and 20 years before entering the market. Some kind of protection is certainly required before that kind of investment is made. The figure today is $240 million. That number has been challenged by Congress and looked at many ways by the Office of Technology Assessment (OTA); the latest OTA study says that costs may often be that high, although sometimes they may be lower. However, it does not require a lot of arithmetic to figure this out. The pharmaceutical industry in this country alone spends about $10 billion on R&D per year, and about 30 new products—30 new molecular entities—are approved each year. That comes out to be more than $300 million invested for each success.

In fact, there are at most only four or five new therapeutic products approved each year that are important and if you divide by that, you arrive at astronomical figures for important new therapeutics. Also, all this investment is required years before you can enter the market and start to get a return. So this certainly fits the pattern of something that requires protection, and patents look like the way to do it.

In 1986 the average development time of a new pharmaceutical product was 10 years. The interesting thing is that biotechnology has compressed that time. Because of the rational design of these products, their remarkable efficiency and safety profile, and the understanding and cooperation of the U.S. Food and Drug Administration, the average development time is about four to seven years today for biotechnology products, which is a big help. However, it is still a long time and a large investment.

So let us review how biotechnology was commercialized. What happened is not particularly logical, not what anyone would have deduced sitting around a table trying to decide what was going to happen. When a biotech company decided it wanted to launch a product, it had to build a company to launch the product. All the different stages and structures had to be built—the vectors and expression systems, purifications, scale-up, manufacturing, clinical testing, regulatory submissions, and marketing. Surprisingly enough, almost all of these things were in place in major pharmaceutical companies, yet almost every single important invention was done by independent biotechnology companies. That is the fact; that is what we have to deal with. How were they able to do all this, why would they be the first to do it, and was it effective? Is it not terribly inefficient to have to create a company for each new product? That is what was done.

Small, start-up biotechnology companies were responsible for many miracle drugs. For example, Amgen developed erythropoietin, and we now know that 10 milligrams per year, one-fiftieth of an aspirin tablet, will

prevent 20 or more transfusions for people that are deficient in erythropoietin—and there are many more. Chiron produced the answer to hepatitis C, which is something that has plagued society and challenged scientists for more than 30 years—a well-defined disease about which nothing could be done. Cetus discovered ways of amplifying genes. Individual inventors, individual small companies, are pioneering and finding important new molecules and insights that are changing the way medicine is practiced today. This was done in a way that perhaps was hardly predictable—small, independent companies got started and did this all on their own—but this is exactly what happened. Sometimes it occurred with the support of large companies, but none of the key innovations and developments throughout the field were made by the large companies.

As I said, it was a fairly rocky road. I think that is important. The fragility of a new technology and the need for immediate action are more critical than making long-range plans to do wonderful things over long periods of time. These companies are fragile and their viability is always in question. Their survival is in jeopardy at all times. Take 1989 as an example. Headlines blared, "Clouds gather over the biotech field." Interestingly enough, firms were stumbling on regulation and patent problems. The patent situation looked very confused at that time. It was very difficult again to get financing, and the feeling was that many companies would go out of business and some did.

If we look at the number of financings, we see what has faced this emerging technology—and will probably apply to every new technology—big financing surges, dry spells, big surges. The dry spell in 1984 and 1985 seemed to last forever. We learned it can take eight quarters before you see another chance to raise money. When 1987 came along, the stock market wilted, and 1988, 1989, and 1990—one after another—were all very bad years. Of course, 1991 salvaged a lot of companies, but those were dangerous times for fragile, embryonic businesses.

So some protection is required. There is no question that patent protection fits the need in terms of the large investment required over a long period of time. The question is always asked, however, whether keeping the inventions secret would work. Well, it doesn't. Once the gene has been described, it is trivial to produce the product. Even if the gene is not described anywhere, once the structure is out, once the product is available even in clinical trials, the structure can be determined and often easily duplicated at a much lower cost. The cost is even lower because the copier only has to copy winners. He does not have to duplicate the losers. The copier avoids the major investments that the innovator had to make.

So international protection becomes the issue today. The problems in obtaining worldwide protection are difficult. There are many countries that do not honor the patent system. Surprisingly, countries that do not have

strong patent systems (e.g., China, India, Argentina, Brazil) are not troublesome to the biotech field, although the pharmaceutical industry has expressed concern. However, international trade competition with countries that purport to have a patent system is a very serious issue.

For example, Japan is a strong competitor. In Japan, patent flooding surrounds innovator's patents. The Japanese patent office grants narrow patents instead of broad ones. I think it is pretty obvious to those in this industry that small companies need broad patents. If you are going to try to compete in the marketplace with giants, you had better know that you have some reasonable protection against obvious duplication or partial duplication. The Japanese system has not produced many biotechnology innovations and has not produced biotechnology companies. Our problems with the Japanese system are narrow patents, sometimes taking 10 or more years to issue, and patent flooding, which surrounds the inventor's contribution and forces him to join up with a large, entrenched Japanese company to survive.

To summarize, developing countries have concerned some industries, but they have not been competitive in biotechnology. Europe has awarded strong patents that afford U.S. innovators reasonable protection. Japan has been a very serious issue. Today we see two companies in Japan enjoying the products of Amgen—two products approaching a billion dollars in sales, at prices two to four times that of the products in this country, guaranteeing high profits. It is very easy to see what is going to happen over the long term. Those companies are going to be able to invade other countries in the field of biotechnology and be very active participants in trade.

The question then is, Can the United States dictate or influence international patent practices? Well, somehow it has to. This sounds unfair to some, but it is equally unfair to have misappropriation of intellectual property.

We know the history of what happened: Japan behind, Japan even, Japan ahead. The outlook is very serious. If we think back about that 20year period around the 1960s when U.S. patents were not being upheld, that may have been why it was easy for the Japanese to move in and take over the territory.

Now, for future challenges: The federal government's patenting of the genome was a hypothetical question until a short time ago. Would this be serious? It has now become a very practical question. The U.S. Patent Office is currently examining the NIH's application for patents on certain gene sequences. In the meantime, the Industrial Biotechnology Association has held discussions with Reid Adler of the National Institutes of Health (NIH), biotech executives and administration officials who are examining this issue. What should the NIH do with respect to all of these gene patents? A good start is to provide a forum between industry, NIH and other inter-

ested parties to see if we can understand whether these patents should be applied for, whether they should be issued, and if issued, how they should be handled.

Finally, can patents be issued faster? The U.S. Patent and Trademark Office's numbers on the average time of application pendency are very strange and not helpful. The Patent Office has always figured out ways to say it is doing things in two years when, in fact, there has not been a useful biotech patent that has taken less than four years, and usually five. If we cannot get meaningful numbers, I don't think the problem can be solved. I think the Patent Office is misleading all of us.

In terms of the conference objectives, I would like to close with these thoughts concerning a few final issues: First, with respect to international perception of the importance of intellectual property rights, the world acknowledges that the United States was the pioneer in biotechnology, and that it was done by risk capital, as well as federal support of R&D, originally. The positive contribution to human welfare is acknowledged worldwide. That does not mean that all the countries in the world want to give strong patent protection for biotechnology, which is a very difficult issue.

Second, with respect to biotechnology patents, in the United States, the road has been rocky but reasonably satisfactory. Worldwide protection will ultimately be critical. It is sad that this did not occur long ago. Because of this lack, we are seeing companies in foreign countries appropriating U.S. technology to get started.

Finally, with respect to conflict resolution, the most precious resource of a budding new industry or budding new technology is time. The solutions have to be time sensitive. Grandiose solutions that involve 60 or 70 countries, and take years and years, will mean that a lot of the companies will fail before the solutions are in place. I think people should be aware of that.

I would remind you of one last thing. This is an industry of small companies. If you look at the profile of public biotechnology companies, only 13 percent have more than 300 employees, and none have more than 2,000 employees. If we look at all biotech companies (publicly and privately held), there are only 3 percent with more than 300 employees. We are dealing with a very, very broad-based, small-company business and my remarks apply as well to my firm, ICOS, which we started within the last year, as well as to the largest biotech companies, which are still relatively small. These are the companies seeking patent protection. Strong protection can hardly ''disadvantage small companies" as some critics suggest.

As technological developments multiply around the globe—even as the patenting of human genes comes under serious discussion—nations, companies, and researchers find themselves in conflict over intellectual property rights (IPRs). Now, an international group of experts presents the first multidisciplinary look at IPRs in an age of explosive growth in science and technology.

This thought-provoking volume offers an update on current international IPR negotiations and includes case studies on software, computer chips, optoelectronics, and biotechnology—areas characterized by high development cost and easy reproducibility. The volume covers these and other issues:

• Modern economic theory as a basis for approaching international IPRs.
• U.S. intellectual property practices versus those in Japan, India, the European Community, and the developing and newly industrializing countries.
• Trends in science and technology and how they affect IPRs.
• Pros and cons of a uniform international IPRs regime versus a system reflecting national differences.

Welcome to OpenBook!

You're looking at OpenBook, NAP.edu's online reading room since 1999. Based on feedback from you, our users, we've made some improvements that make it easier than ever to read thousands of publications on our website.

Do you want to take a quick tour of the OpenBook's features?

Show this book's table of contents , where you can jump to any chapter by name.

...or use these buttons to go back to the previous chapter or skip to the next one.

Jump up to the previous page or down to the next one. Also, you can type in a page number and press Enter to go directly to that page in the book.

Switch between the Original Pages , where you can read the report as it appeared in print, and Text Pages for the web version, where you can highlight and search the text.

To search the entire text of this book, type in your search term here and press Enter .

Share a link to this book page on your preferred social network or via email.

View our suggested citation for this chapter.

Ready to take your reading offline? Click here to buy this book in print or download it as a free PDF, if available.

Get Email Updates

Do you enjoy reading reports from the Academies online for free ? Sign up for email notifications and we'll let you know about new publications in your areas of interest when they're released.

Case Study Questions Class 12 Biology Biotechnology: Principles and Processes

Case study questions class 12 biology chapter 10 biotechnology: principles and processes.

CBSE Class 12 Case Study Questions Biology Biotechnology: Principles and Processes. Term 2 Important Case Study Questions for Class 12 Board Exam Students. Here we have arranged some Important Case Base Questions for students who are searching for Paragraph Based Questions Biotechnology: Principles and Processes.

At Case Study Questions there will given a Paragraph. In where some Important Questions will made on that respective Case Based Study. There will various types of marks will given 1 marks, 2 marks, 3 marks, 4 marks.

CBSE Case Study Questions Class 12 Biology Biotechnology: Principles and Processes

Case study 1.

Biotechnology deals with techniques of using live organisms or enzymes from organisms to produce products and processes useful to humans. In this sense, making curd, bread or wine, which are all microbe-mediated processes, could also be thought as a form of biotechnology. However, it is used in a restricted sense today, to refer to such of those processes which use genetically modified organisms to achieve the same on a larger scale. Further, many other processes/techniques are also included under biotechnology. For example, in vitro fertilisation leading to a ‘test-tube’ baby, synthesising a gene and using it, developing a DNA vaccine or correcting a defective gene, are all part of biotechnology.

The European Federation of Biotechnology (EFB) has given a definition of biotechnology that encompasses both traditional view and modern molecular biotechnology. The definition given by EFB is as follows: ‘The integration of natural science and organisms, cells, parts thereof, and molecular analogues for products and services’.

Que. 1) ……………………………………………………………………………………. is a technique where live enzymes or organisms are used to make products or methods which are useful to the humans.

(a) Bio-technology

(b) Info-technology

(c) Medical technology

(d) Business technology

Que. 2) In the biotechnology, produced products and processes are useful to the …………………………………………………………………………………… .

(a) Microbes

(b) Reptiles

(d) Cockroach

Que. 3) The definition of Biotechnology is given by ……………………………………………………………………………………. .

Que. 4) Which are the microbe-mediated processes in the biotechnology.

Que. 5) What are the different part of Biotechnology.

Que. 1)(a) Bio-technology.

Que. 2) (c) Humans.

Que. 3) (d) EFB.

Que. 4) Answer: The process of making wine, bread and curd are microbe-mediated processes in the Biotechnology.

Que. 5) Answer: Different parts of Biotechnology includes DNA vaccine development, correcting defective gene, and In-vitro fertilization.

Case study 2

The techniques of genetic engineering which include creation of recombinant DNA, use of gene cloning and gene transfer, overcome this limitation and allows us to isolate and introduce only one or a set of desirable genes without introducing undesirable genes into the target organism.

Most likely, this piece of DNA would not be able to multiply itself in the progeny cells of the organism. But, when it gets integrated into the genome of the recipient, it may multiply and be inherited along with the host DNA. This is because the alien piece of DNA has become part of a chromosome, which has the ability to replicate. In a chromosome there is a specific DNA sequence called the origin of replication, which is responsible for initiating replication. Therefore, for the multiplication of any alien piece of DNA in an organism it needs to be a part of a chromosome(s) which has a specific sequence known as ‘origin of replication’. Thus, an alien DNA is linked with the origin of replication, so that, this alien piece of DNA can replicate and multiply itself in the host organism. This can also be called as cloning or making multiple identical copies of any template DNA. The cutting of DNA at specific locations became possible with the discovery of the so- ‘molecular scissors’– restriction enzymes.

Que. 1) Which DNA sequence is responsible for initiating replication?

(a) Endonuclease

(b) Restriction DNA

(c) Gene clone

(d) Origin of replication

Que. 2) DNA sequence is mainly present in …………………………………………………………………………………………… .

(a) Mitochondria

(b) Chromosomes

(c)  Chloroplast

(d) Cytoplasm.

Que. 3) True or False

‘The piece of DNA don’t have ability to multiply itself in the progeny cell of an organism.’

Que. 4) Which creations are included in the genetic engineering?

Que. 5) Write name of molecular scissors which is useful in cutting DNA?

Que. 1)(d) Origin of replication.

Que. 2) (b) Chromosomes.

Que. 3) (a) True.

Que. 4) Answer: Creations of gene cloning, recombinant DNA and Gene transfer are included in the genetic engineering.

Que. 5) Answer: Restriction enzyme is a molecular scissor which is helpful in cutting DNA.

Case study 3

In the year 1963, the two enzymes responsible for restricting the growth of bacteriophage in Escherichia coli were isolated. One of these added methyl groups to DNA, while the other cut DNA. The later was called restriction endonuclease. The first restriction endonuclease–Hind II, whose functioning depended on a specific DNA nucleotide sequence was isolated and characterised five years later. It was found that Hind II always cut DNA molecules at a particular point by recognising a specific sequence of six base pairs. This specific base sequence is known as the recognition sequence for Hind II. Besides Hind II, today we know more than 900 restriction enzymes that have been isolated from over 230 strains of bacteria each of which recognise different recognition sequences. The convention for naming these enzymes is the first letter of the name comes from the genus and the second two letters come from the species of the prokaryotic cell from which they were isolated, e.g., EcoRI comes from Escherichia coli RY 13. In EcoRI, the letter ‘R’ is derived from the name of strain. Roman numbers following the names indicate the order in which the enzymes were isolated from that strain of bacteria

Restriction enzymes belong to a larger class of enzymes called nucleases. These are of two kinds; exonucleases and endonucleases. Exonucleases remove nucleotides from the ends of the DNA whereas, endonucleases make cuts at specific positions within the DNA. Each restriction endonuclease functions by ‘inspecting’ the length of a DNA sequence. Once it finds its specific recognition sequence, it will bind to the DNA and cut each of the two strands of the double helix at specific points in their sugar -phosphate backbones. Each restriction endonuclease recognises a specific palindromic nucleotide sequences in the DNA.

Que. 1) How many enzymes are there which can restrict growth of bacteriophage in E.coli?

Que. 2) The letter ‘R’ in the EcoRI is a name of ……………………………………………………………………………………. .

(b) Species

(d) Kingdom

Que. 3) In the naming of enzyme, first letter of name belongs to ……………………………………………………………………………………… .

(a) Species

Que. 4) Which enzyme belongs to nucleases class of enzymes?

Que. 5) Write names and role of restriction enzymes.

Que. 1)(b) Two.

Que. 2) (a) Strain.

Que. 3) (d) Genus.

Que. 4) Answer: Restriction enzyme mainly belongs to nucleases class of enzymes.

Que. 5) Answer: Two kinds of restriction enzymes are there. First is endonuclease which can cut the DNA at specific position. Second is exonuclease that remove nucleotides from the DNA (End of DNA).

Case study 4

When cut by the same restriction enzyme, the resultant DNA fragments have the same kind of ‘sticky-ends’ and, these can be joined together (end-to-end) using DNA ligases The cutting of DNA by restriction endonucleases results in the fragments of DNA. These fragments can be separated by a technique known as gel electrophoresis. Since DNA fragments are negatively charged molecules they can be separated by forcing them to move towards the anode under an electric field through a medium/matrix. Nowadays the most commonly used matrix is agarose which is a natural polymer extracted from sea weeds. The DNA fragments separate (resolve) according to their size through sieving effect provided by the agarose gel. Hence, the smaller the fragment size, the farther it moves. The separated DNA fragments can be visualised only after staining the DNA with a compound known as ethidium bromide followed by exposure to UV radiation (you cannot see pure DNA fragments in the visible light and without staining). You can see bright orange coloured bands of DNA in an ethidium bromide stained gel exposed to UV light.

The separated bands of DNA are cut out from the agarose gel and extracted from the gel piece. This step is known as elution. The DNA fragments purified in this way are used in constructing recombinant DNA by joining them with cloning vectors.

Que. 1) ………………………………………………………………………… is used to join sticky ends of DNA.

(a) DNA Ligase

(b) DNA Host

(c) DNA restriction

(d) None of them

Que. 2) On the basis of ……..………………………………………………………………. , fragments of DNA gets separated in the Gel electrophoresis.

(a) Nucleotide

Que. 3) After DNA fragment separation, DNA is stained by ……………………………………………………………………… for the visualization.

(a) Toluidine

(b) Ethidium bromide

(c) Sulphuric acid

(d) Phloroglucinol

Que. 4) Name the technique which useful in the separation of fragments of DNA.

Que. 5) Name the matrix which is extracted from sea weed and is a natural polymer.

Que. 1)(a) DNA Ligase.

Que. 2) (d) Size.

Que. 3) (b) Ethidium bromide.

Que. 4) Answer: Gel electrophoresis is the technique which useful in the separation of fragments of DNA.

Que. 5) Answer: Agarose is the matrix which is extracted from sea weed and is a natural polymer.

Case Study 5

Since DNA is a hydrophilic molecule, it cannot pass through cell membranes. Why? In order to force bacteria to take up the plasmid, the bacterial cells must first be made ‘competent’ to take up DNA. This is done by treating them with a specific concentration of a divalent cation, such as calcium, which increases the efficiency with which DNA enters the bacterium through pores in its cell wall. Recombinant DNA can then be forced into such cells by incubating the cells with recombinant DNA on ice, followed by placing them briefly at 420C (heat shock), and then putting them back on ice. This enables the bacteria to take up the recombinant DNA. This is not the only way to introduce alien DNA into host cells. In a method known as micro-injection, recombinant DNA is directly injected into the nucleus of an animal cell.

In another method, suitable for plants, cells are bombarded with high velocity micro-particles of gold or tungsten coated with DNA in a method known as biolistics or gene gun. And the last method uses ‘disarmed pathogen’ vectors, which when allowed to infect the cell, transfer the recombinant DNA into the host. Now that we have learnt about the tools for constructing recombinant DNA, let us discuss the processes facilitating recombinant DNA technology.

Que. 1) In …………………………………………………………………………… method, recombinant DNA is transferred into the host to infect the cell.

(a) Restriction method

(b)  Gene Gun

(c) Biolistics

(d) Disarmed pathogen

Que. 2) Biolistics or Gene gum method is suitable for ………………………………………………………………………………………. .

(a) Reptiles

(d) Insects

Que. 3) Calcium cation increases efficiency of …………………………………………………………………………….. for the bacterium entry.

(d) Ribosome

Que. 4) Why the DNA cannot pass through cell membrane?

Que. 5) In which method, the recombinant DNA is injected directly into animal’s nucleus?

Que. 1)(d) Disarmed pathogen.

Que. 2) (b) Plants.

Que. 3) (b) DNA.

Que. 4) Answer: DNA is basically a hydrophilic molecule and cell membrane is hydrophobic in nature. Hence, the DNA cannot pass through cell membrane.

Que. 5) Answer: In the micro-injection method, the recombinant DNA is injected directly into animal’s nucleus.

Leave a Reply Cancel reply

Your email address will not be published. Required fields are marked *

Save my name, email, and website in this browser for the next time I comment.

• Publications
• Conferences & Events
• Professional Learning
• Science Standards
• Awards & Competitions
• Daily Do Lesson Plans
• Free Resources
• American Rescue Plan
• For Preservice Teachers

NCCSTS Case Collection

• Partner Jobs in Education
• Interactive eBooks+
• Digital Catalog
• Regional Product Representatives
• e-Newsletters
• Bestselling Books
• Latest Books
• Popular Book Series
• Prospective Authors
• Web Seminars
• Exhibits & Sponsorship
• Conference Reviewers
• National Conference • Denver 24
• Leaders Institute 2024
• National Conference • New Orleans 24
• Submit a Proposal
• Latest Resources
• Professional Learning Units & Courses
• For Districts
• Online Course Providers
• Schools & Districts
• College Professors & Students
• The Standards
• Teachers and Admin
• eCYBERMISSION
• Toshiba/NSTA ExploraVision
• Junior Science & Humanities Symposium
• Teaching Awards
• Climate Change
• Earth & Space Science
• New Science Teachers
• Early Childhood
• Middle School
• High School
• Postsecondary
• Informal Education
• Journal Articles
• Lesson Plans
• e-newsletters
• Science & Children
• Science Scope
• The Science Teacher
• Journal of College Sci. Teaching
• Connected Science Learning
• NSTA Reports
• Next-Gen Navigator
• Science Update
• Teacher Tip Tuesday
• Trans. Sci. Learning

MyNSTA Community

• My Collections

Case Study Listserv

Permissions & Guidelines

Submit a Case Study

Resources & Publications

Enrich your students’ educational experience with case-based teaching

The NCCSTS Case Collection, created and curated by the National Center for Case Study Teaching in Science, on behalf of the University at Buffalo, contains over a thousand peer-reviewed case studies on a variety of topics in all areas of science.

Cases (only) are freely accessible; subscription is required for access to teaching notes and answer keys.

Subscribe Today

Browse Case Studies

Latest Case Studies

Development of the NCCSTS Case Collection was originally funded by major grants to the University at Buffalo from the National Science Foundation , The Pew Charitable Trusts , and the U.S. Department of Education .

• school Campus Bookshelves
• menu_book Bookshelves
• perm_media Learning Objects
• login Login
• how_to_reg Request Instructor Account
• hub Instructor Commons
• Download Page (PDF)
• Download Full Book (PDF)
• Periodic Table
• Physics Constants
• Scientific Calculator
• Reference & Cite
• Tools expand_more
• Readability

selected template will load here

This action is not available.

5.1: Case Study: The Importance of Cells

• Last updated
• Save as PDF
• Page ID 17026

• Suzanne Wakim & Mandeep Grewal
• Butte College

Case Study: More Than Just Tired

We all get tired sometimes, especially if we have been doing a lot of physical activity. But for Jasmin, a 34-year-old former high school track star who is now a recreational runner, her tiredness was going far beyond what she thought should be normal for someone who is generally in good physical shape. She was experiencing extreme fatigue after her runs, as well as muscle cramping, spasms, and an unusual sense of heaviness in her legs. At first, she chalked it up to getting older, but her exhaustion and pain worsened to the point where this former athlete could no longer run for more than a few minutes at a time. She also began to experience other unusual symptoms, such as blurry vision and vomiting for no apparent reason.

Concerned, she went to her doctor. Her doctor ran many tests and consulted with several specialists. After several months, Jasmin is finally diagnosed with a mitochondrial disease. Jasmin is surprised. She has an 8-year-old niece with a mitochondrial disease, but her niece’s symptoms started when she was very young, and included seizures and learning disabilities. How can Jasmin have the same disease but different symptoms? Why did she not have problems until adulthood while her niece had symptoms at an early age? And what are mitochondria anyway?

Chapter Overview: Cells

As you will learn in this chapter, mitochondria are important structures within our cells. This chapter will describe cells, which are the basic unit of structure and function in all living organisms. Specifically, you will learn:

• How cells were discovered, their common structures, and the principles of cell theory.
• The importance of size and shape in the functions of cells.
• The differences between eukaryotic cells (such as those in humans and other animals) and prokaryotic cells (such as bacteria).
• The structures and functions of parts of cells including mitochondria, the plasma membrane, cytoplasm, cytoskeleton, nucleus, ribosomes, Golgi apparatus, endoplasmic reticulum, vesicles, and vacuoles.
• How the processes of passive and active transport move substances into and out of cells and help maintain homeostasis.
• How organisms obtain the energy needed for life, including how the sugar glucose is broken down to produce ATP through the processes of aerobic cellular respiration and anaerobic respiration.

As you read this chapter, think about the following questions related to Jasmin’s disease:

• What are mitochondria? What is their structure, function, and where did they come from during evolution?
• Why are fatigue and “exercise intolerance,” such as Jasmin’s extreme exhaustion after running, common symptoms of mitochondrial diseases?
• Why do you think Jasmin has symptoms that affect so many different parts of her body including her legs, eyes, and digestive system?

Attributions

• Tired by Dace Kiršpile licensed CC BY 2.0 via Flickr
• Text adapted from Human Biology by CK-12 licensed CC BY-NC 3.0

An official website of the United States government

The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings
• Browse Titles

NCBI Bookshelf. A service of the National Library of Medicine, National Institutes of Health.

National Research Council (US). Intellectual Property Rights and the Dissemination of Research Tools in Molecular Biology: Summary of a Workshop Held at the National Academy of Sciences, February 15–16, 1996. Washington (DC): National Academies Press (US); 1997.

Intellectual Property Rights and the Dissemination of Research Tools in Molecular Biology: Summary of a Workshop Held at the National Academy of Sciences, February 15–16, 1996.

• Hardcopy Version at National Academies Press

5 Case Studies

• Introduction

Each of the following cases involves an important research tool in molecular biology, and each was chosen to illustrate a form of protection of intellectual property and a pattern of development involving both the public and the private sector. For each case, we present background material and a summary of the discussion that raised issues peculiar to the case.

The ideal strategies for the handling of intellectual property in molecular biology are not always immediately obvious, as these case studies illustrate. For most, final decisions have not been made about how access to these research tools will be controlled. Such decisions might be modified in response to both scientific and legal developments.

• Recombinant DNA: A Patented Research Tool, Nonexclusively Licensed With Low Fees

The Cohen-Boyer technology for recombinant DNA, often cited as the most-successful patent in university licensing, is actually three patents. One is a process patent for making molecular chimeras and two are product patents—one for proteins produced using recombinant prokaryote DNA and another for proteins from recombinant eukaryote DNA. Recombinant DNA, arguably the defining technique of modern molecular biology, is the founding technology of the biotechnology industry (Beardsley 1994). In 1976, Genentech became the first company to be based on this new technology and the first of the wave of biotechnology companies, which in fifteen years has grown from one to over 2000.

The first patent application was filed by Stanford University in November 1974 in the midst of much soul-searching on the part of the scientific community. Stanley Cohen and Herbert Boyer, who developed the technique together at Stanford and the University of California, San Francisco (UCSF), respectively, were initially hesitant to file the patent (Beardsley 1994). Several years of discussion involving the National Institutes of Health (NIH) and Congress followed. By 1978, NIH decided to support the patenting of recombinant DNA inventions by universities; in December 1980, the process patent for making molecular chimeras was issued. The product patent for prokaryotic DNA was issued in 1984. The patents were jointly awarded to Stanford and UCSF and shared with Herbert Boyer and Stanley Cohen. The first licensee signed agreements with Stanford on December 15, 1981. As of February 13, 1995, licensing agreements had generated $139 million in royalties, which have shown an exponential increase in value since their beginning. In 1990–1995 alone, the licensing fees earned $102 million.

This case has three key elements. First, the technology was inexpensive and easy to use; from a purely technical standpoint, there were only minimal impediments to widespread dissemination. Second, there were no alternative technologies. Third, the technology was critical and of broad importance to research in molecular biology.

The technology was developed in universities through publicly funded research. The strategy used to protect the value of the intellectual property was to make licenses inexpensive and attach minimal riders. The tremendous volume of sales made the patent very lucrative. Every molecular biologist uses this technology. However, not all inventions are as universally critical. Only a few university patents in the life sciences, such as warfarin and Vitamin D, have been even nearly as profitable as the Cohen-Boyer patent. Clearly, had this technology not been so pivotal for molecular biology or had an equally useful technology been available, the licenses would not have been sold so widely and the decision to license the technology might have met with more resistance.

The Cohen-Boyer patent is considered by many to be the classic model of technology transfer envisaged by supporters of the Bayh-Dole Act, which was intended to stimulate transfer of university-developed technology into the commercial sector. Ironically, it presents a different model of technology than that presumed by advocates of the Bayh-Dole act (for discussion, see chapter 3 ). Lita Nelsen, director of the Technology Licensing Office at the Massachusetts Institute of Technology (MIT), noted that the premise of the Bayh-Dole Act is that exclusivity is used to induce development and that universities should protect their intellectual property because without that protection, if everybody owns it, nobody invests in it. ''The most-successful patent in university licensing, in the entire history of university licensing, is the Cohen-Boyer pattern which is just the reverse. It is a nonexclusive license. It provides no incentive, just a small tax in the form of royalties on the exploitation of the technology.''

The biotechnology boom that followed the widespread dissemination of recombinant DNA techniques transformed the way universities manage intellectual property. It also fundamentally changed the financial environment and culture of biological research.

Nelsen described two ways in which this patent was so successful in fostering the aims of the Bayh-Dole Act. First, it got the attention of biologists by showing the advantages of protecting intellectual property. Stanford earned respectability for the venture by involving NIH and discussing in a public forum how this technology could be disseminated in a way that would not impede research. Second, it got the attention of university chancellors. They began to see that licensing, patenting, and technology transfer might have some financial benefits for the university. Nelsen commented that "that went a little too far. Everybody was waiting for $100 million per year out of their technology transfer offices. Most of them did not get it, and most of them are never going to get it." In the meantime, technology transfer managers developed more experience and became professionalized. They began to learn how to decide what to patent, how to market technology, and how to close deals at reasonable prices and with reasonable expectations. And industry learned how to negotiate licenses with universities.

Nelsen concluded that the whole biotechnology industry came out of the Cohen-Boyer patent, not only because Cohen-Boyer developed gene splicing, but because universities learned how to do biotechnology and early technology licensing—even if the first example was paradoxical.

The decision to negotiate nonexclusive, rather than exclusive, licenses was critical to the industry. If the technology had been licensed exclusively to one company and the entire recombinant DNA industry had been controlled by one company, the industry might never have developed. Alternatively, major pharmaceutical firms might have been motivated to commit their resources to challenging the validity of the patent.

Nelsen noted that at most major universities, it has become standard in industry-sponsored research agreements that the university will retain ownership of any resulting patents but almost without exception will grant the sponsor a first option to an exclusive license. With the increase in university-industry partnerships this applies to more research than in past years. Moreover, the Bayh-Dole Act encourages universities to grant exclusive licenses to companies even if the research was publically sponsored. But as the next case study shows, even when a company holds exclusive rights to a fundamental technology, it might choose to disseminate the technology broadly.

• PCR and TAQ Polymerase: A Patented Research Tool for Which Licensing Arrangements Were Controversial

Polymerase chain reaction (PCR) technology presents an interesting counterpoint to the Cohen-Boyer technology. Both are widely used innovations seen by many as critical for research in molecular biology. However, the licensing strategies for the two technologies have been quite different, and they were developed in different contexts.

PCR allows the specific and rapid amplification of targeted DNA or RNA sequences. Taq polymerase is the heat-stable DNA polymerase enzyme used in the amplification. PCR technology has had a profound impact on basic research not only because it makes many research tasks more efficient, in time and direct cost, but also because it has made feasible some experimental approaches that were not possible before the development of PCR. PCR allows the previously impossible analysis of genes in biological samples, such as assays of gene expression in individual cells, in specimens from ancient organisms, or in minute quantities of blood in forensic analysis.

In less than a decade, PCR has become a standard technique in almost every molecular biology laboratory, and its versatility as a research tool continues to expand. In 1989, Science chose Taq polymerase for its first "Molecule of The Year" award. Kary Mullis was the primary inventor of PCR, which he did when he worked at the Cetus Corporation. He won a Nobel Prize for his contributions merely 8 years after the first paper was published in 1985, which attests to its immediate and widely recognized impact. Tom Caskey, senior vice-president for research at Merck Research Laboratories and past-president of the Human Genome Organization, attributes much of the success of the Human Genome Project to PCR: "The fact is that, if we did not have free access to PCR as a research tool, the genome project really would be undoable. . . Rather than bragging about being ahead, we would be apologizing about being behind."

Whereas recombinant DNA technology resulted from a collaboration between university researchers whose immediate goal was to insert foreign genes into bacteria to study basic processes of gene replication, PCR was invented in a corporate environment with a specific application in mind—to improve diagnostics for human genetics. No one anticipated that it would so quickly become such a critical tool with such broad utility for basic research.

Molecular biology underwent considerable change during the decade between the development of recombinant DNA and PCR technologies (Blumenthal and others, 1986). The biotechnology industry emerged, laws governing intellectual property changed, there was a substantial increase in university-industry-government alliances, and university patenting in the life sciences increased tenfold (Blumenthal and others 1986, Henderson and others). There was virtually no controversy over whether such an important research tool should be patented and no quarrel with the principle of charging licensing fees to researchers. The controversy has been primarily over the amount of the royalty fees.

Cetus Corporation sold the PCR patent to Hoffman-LaRoche for $300 million in 1991. In setting the licensing terms for research use of PCR, Roche found itself in a very different position from Stanford with respect to the Cohen-Boyer patent. First, it was a business, selling products for use in the technology. That made it possible to provide rights to use the technology with the purchase of the products, rather than under direct license agreements, such as Stanford's. This product-license policy was instituted by Cetus, the original owner of the PCR patents. An initial proposal to the scientific community by the president of Cetus for reach-through royalties—royalties on second-generation products derived through use of PCR—was met with strong criticism. Ellen Daniell, director of licensing at Roche Molecular Systems, noted that the dismay caused by the proposal has continued to influence the scientific community's impression of Roche's policy.

Roche's licensing fees have met with cries of foul play from some scientists who claim that public welfare is jeopardized by Roche's goals. Nevertheless, most scientists recognize that Roche has the right to make business decisions about licensing its patents. The fact that Roche had paid Cetus $300 million for the portfolio of PCR patents led some observers to think that Roche intended to recoup its investment through licensing revenues, a point that Daniell disputed. She pointed out that Roche's business is the sale of products and that licensing revenues are far less than what would be needed to recoup the $300 million over a time period that would be relevant from a business viewpoint. Daniell listed Roche's three primary objectives in licensing technology:

• Expand and encourage the use of the technology.
• Derive financial return from use of the technology by others.
• Preserve the value of the intellectual property and the patents that were issued on it.

Roche has established different categories of licenses related to PCR, depending on the application and the users. They include research applications, such as the Human Genome Project, the discovery of new genes, and studies of gene expression; diagnostic applications, such as human in vitro diagnostics and the detection of disease-linked mutations; the production of large quantities of DNA; and the most extensive PCR licensing program, human diagnostic testing services. Licenses in the last-named category are very broad; there are no upfront fees or annual minimum royalties, and the licensees have options to obtain reagents outside Roche.

Discussion about access to PCR technology centered on the costs of Taq polymerase, rather than on the distribution of intellectual property rights. Tom Caskey's view was that "the company has behaved fantastically" with regard to allowing access to PCR technology for research purposes. Bernard Poiesz, professor of medicine at the State University of New York in Syracuse and director of the Central New York Regional Oncology Center, agreed that he knew of no other company that had done as well as Roche in making material available for research purposes. But he also argued that the price of Taq polymerase is too high and has slowed the progress of PCR products from the research laboratory to the marketplace. Poiesz stated that the diagnostic service licenses "are some of the highest royalty rates I have personally experienced." He cited the example of highly sensitive diagnostic tests for HIV RNA, which he said are too expensive for widespread use, largely because of the licensing fees charged by Roche. 1 Caskey felt that Roche should have expanded the market by licensing more companies to sell PCR-based diagnostic products and profited from the expansion of the market, rather than from the semiexclusivity that it has maintained.

Nor are all university researchers satisfied with their access to Taq polymerase. Ron Sederoff commented that—in contrast to the human genomics field, in which funding levels are much higher than for other fields of molecular biology—many academic researchers do not find easy access to the technology. Several workshop participants noted that the high cost Taq polymerase made many experiments impossible for them.

What is the effect of the Cetus-Roche licensing policy on small companies? Tom Gallegos, intellectual property counsel for Oncorpharm, a small biotechnology company, stated that most small companies cannot afford the fees charged by Roche. He noted that the entry fee for a company that wants to sell PCR-based products for certain fields other than diagnostics ranges from $100,000 to $500,000, with a royalty rate of 15%. By comparison, a company pays about $10,000 per year and a royalty fee of 0.5–10% for the Cohen-Boyer license. The effect is an inhibition of the development of PCR-related research tools, with consequent reductions or delays in the total royalty stream and possibly litigation.

Sidney Winter, professor of economics at the Wharton School of Business, suggested that in asking whether the price of some technology is too expensive, one should consider "compared with what?" Compared with licensing and royalty fees for Cohen-Boyer, PCR might seem excessive. If one imagines that the cost of the PCR patent were financed by a tax on the annual US health-care expenditure which was about $1 trillion in 1995 (Source: Congressional Budget Office), that tax would be roughly equal to 0.03% and might be a price worth paying for the advances made possible by PCR technology.

During the workshop, several people distinguished between research tools that are commercial products and tools that have little market value but are important tools for discovery. In the case of PCR, the research tool is both a commercial product and a discovery tool. As such, it raises questions. Are the PCR patents an example of valuable property that would have been widely disseminated in the absence of patent rights? Is PCR an example of a technology that has been more fully developed because of the existence of patent rights? Daniell stated that Roche has added considerable value to the technology, in part through the mechanism of patent rights. There was vigorous discussion and disagreement as to whether the licensing fees justify the value added by Roche.

• Protein and DNA Sequencing Instruments: Research Tools to Which Strong Patent Protection Promoted Broad Access

This case study was selected because it provides a clear example of how patent protection promoted the development and dissemination of research tools. By most standards, this would be considered a successful transfer of technology. The possibility of automated, highly sensitive DNA and protein sequencers was developed in the public sector by Leroy Hood's group at California Institute of Technology (Cal Tech). However, it was only with the help of substantial private investment that these research tools were widely disseminated.

The ability to synthesize and sequence proteins and DNA revolutionized molecular biology; automating these tasks promised to consolidate the revolution. Indeed much of the achievement of the Human Genome Project is attributable to the development of automated sequencing instruments, which greatly reduced the time and cost needed to sequence DNA. Because the effects of genes depend on the proteins that they encode, protein sequencing has been a key step in deciphering gene function. Until automated sequencing instruments were widely available, only a few laboratories had access to this technology.

The prototypes for these instruments were developed in Hood's laboratory during the years 1970–1986. Over a period of six or seven years, the team of scientists assembled by Hood increased the sensitivity of protein sequencing instruments by a factor of about 100. That transformed a difficult and uncertain task into one that could be reliably accomplished with the minute quantities of purified proteins that so often limited the scope of the analysis. Hood's laboratory was the first to sequence lymphokines, platelet-derived growth factor, and interferons. After those successes, he was approached by many scientists who asked why the technology could not be made available to the whole research community. Since the middle 1990s, the technology has become widely available.

The broad availability of sequencing technology is due, in no small part, to Hood's perseverance in the face of widespread skepticism. His 1980 manuscript that described, for the first time, automated DNA sequencing was delayed by the journal Nature on the grounds that this technology sounded like "idle speculation." Hood wrote three or four proposals to NIH and the National Science Foundation but was unable to obtain funding for his instrumentation work. The bulk of the support for this technology came from the private sector, and even then companies were reluctant to invest in developing the sequencing instrumentation. He approached nineteen companies, all of which declined to support the development of the sequencers. Eventually, he obtained funding from Applied Biosystems (ABI), but even this support required difficult negotiations between Cal Tech and ABI. ABI insisted on, and received, an exclusive license. As Hood told it, the argument that convinced Cal Tech to support the arrangement was that "if the scientific community wants these instruments, it is our moral obligation to make them commercially available."

At the time of this workshop, ABI had sold more than 3,000 DNA sequencers and more than 1,000 protein sequencers worldwide (although some elements of the technology, such as peptide synthesis, were not protected by patents, most of the instrumentation was patented by ABI). Sequencing facilities that serve multiple investigators are now standard features at research universities. That is not to say that licensing of this technology has been without controversy. Cal Tech licensed the technology to ABI with the stipulation that ABI would sublicense it under what Cal Tech considered reasonable terms. A number of companies have argued that ABI's terms are not reasonable. As with PCR, the situation is complicated in that the primary licensee claims that its license fees reflect what it needs to charge to earn a reasonable return on its investment in developing the technology.

ABI is clearly the leader in the world market for DNA sequencers. But other companies, such as Pharmacia and LI-COR, have important market shares. LI-COR has established a niche in the market with its infrared fluorescence DNA sequencer; infrared light has low background fluorescence, which allows for the development of more robust, solid-state instrumentation than is possible with other DNA sequencing technology. LI-COR is typical of many small biotechnology companies in its reliance on its patent portfolio. Harry Osterman, director of molecular biology at LI-COR, noted that "DNA sequencing is more than just an instrument, it is a system. To make a viable product, all the disparate pieces need to be integrated. That makes for a challenging intellectual property and licensing exercise, unless you have the internal funds to do everything. You require instrumentation, software, chemistry, and microbiology." Patent protection allows a small company to negotiate cross-licenses, which are critical in systems technologies, such as sequencing instrumentation. It can provide an opportunity that a small company would not otherwise have to compete in a market.

One might argue that patent protection served both the large company (ABI) and the small company (LI-COR) in bringing their sequencing technology to the market. In the case of ABI, patent protection afforded them the opportunity to develop a complex system of technology in an orderly and efficient manner, as proposed by the prospect development theory presented by Richard Nelson in chapter 3 . In the case of LI-COR, patent protection of sequencing systems enabled it to negotiate the cross-licenses needed to develop its product fully. In both cases, private support has driven the development and dissemination of a research tool. The public and private sectors seem to have gained equally.

• Research Tools in Drug Discovery: Intellectual Property Protection for Complex Biological Systems

Research tools in drug discovery present an example of the difficulties in protecting intellectual property when technologies involve complex biological systems that lack discrete borders. The information is often broad and refers to general categories of matter, such as a class of neural receptors, rather than finite entities, such as the human genome, or specific techniques, such as PCR or recombinant DNA techniques. Controversies have emerged over broad patents, which some see as stifling research on and development of useful drugs and others see as critical to the translation of research knowledge into useful products. The focus of the discussion in the workshop was the tension between the dependence of small biotechnology companies on patents and the difficulties created when research on complex biological systems is restricted by a thicket of patents on individual components of the systems.

When research on a complex system—for example, receptor biology or immunology—requires obtaining multiple licenses on individual components of the system, the potential for paying substantial royalty fees on any useful application derived from that product can be daunting. "Royalty stacking" can swamp the development costs of some therapies to the point where development is not economically feasible. That is a problem particularly in gene therapy, where the most promising advances now are related to rare genetic diseases that present small markets.

Bennett Shapiro, vice-president for worldwide basic research at Merck Research Laboratories, argued that the central issue is not about patenting, but about access, about encouraging the progress of biomedical research. Problems can arise when access to related components of biological systems is blocked. For example, schizophrenia is often treated with compounds that suppress dopaminergic neurotransmission. Many such compounds, for example haloperidol, act nonspecificially and suppress the entire family of dopamine receptors. People who take those compounds for schizophrenia often develop other disorders some of which resemble Parkinson's disease, another disease involving the dopamine system. A rational approach to discovery of improved schizophrenia drugs would be to target specific dopamine receptors. But if different companies hold patents on different receptors, the first step on the path to an important and much needed therapeutic advance can be blocked.

Shapiro commented that when only one company starts along the path of discovering a particular type of drug, its chance of discovering it is very low. Merck supports only a tiny fraction of total biomedical research, and it benefits enormously from research going on elsewhere in the world. It is in Merck's interest to share the results of its research with the understanding that they can be even more useful if placed in the pool of worldwide research resources.

It is interesting to compare that perspective on drug discovery with the early history of radio and television, other examples of complex systems of which many components were patented individually. In chapter 3 , Richard Nelson noted that it was not until cross-licensing practices became widespread in the early development of radio and television that important advances that enabled broad access to the technology took place. When the intellectual property was sequestered in the hands of a few companies, the entire electronics industry remained sluggish. Of course, the progress of the industry overall must be balanced by the financial needs of individual companies. Shapiro noted that Merck has felt the need to become more energetic about patenting than it was years ago. For example, carrageenan footpad assays were used to develop non-steroidal anti-inflammatory drugs. The assays were in the public domain, and many companies used them to develop new drugs. Today, Merck would patent such an assay and use its patent position to trade with other companies for access to other research tools.

James Wilson, director of the Institute for Human Gene Therapy at the University of Pennsylvania, described his experience with the different ways in which patents on research tools are used. One is to block others from using the tools—to protect one's proprietary use—which he did not see as economical. Genetic therapy patents might not generate enough financial return to offset the investment costs. Wilson also suggested that genetic therapy patent files are only going to waste money in lawsuits brought against those patents. Second is to generate revenues for universities to support their infrastructures, although, as Lita Nelsen noted, most universities are not likely to earn much from patent revenues. The third is to barter so as to continue development without creating an economic disadvantage.

Like previous panelists, Larry Respess of Ligand Pharmaceuticals, argued that the chances of survival of a small biotechnology company would be slight without patents. He noted that the biotechnology industry is composed of small companies that have grown through venture capital and public offerings and that finance research through equity, not product revenues. The goal is to develop products and then evolve into an independent company.

Wilson also pointed to a dramatic increase over the last two to three years in the difficulty in transferring material between universities. Nelsen emphasized that university technology transfer managers are still learning. And many decisions of the US Patent and Trademark Office (PTO) are controversial and under close scrutiny by those charged with managing intellectual property.

In commenting that "it is hard to know what the proprietary landscape is going to be, but it will be complex, whatever it is," Wilson summarized many of the workshop participants' comments.

Changes in Biotechnology Strategies

Respess discussed how R & D strategies for biotechnology have changed over the last twenty years. The biotechnology industry was born in about 1975 by Genentech, and most of the companies that followed Genentech pursued a similar strategy. Their objective was to produce and sell therapeutically-active large protein molecules, which was made possible by the availability of the Cohen-Boyer technology. The strategy was to discover and try to patent a gene for such a protein; it was hoped that the gene could be used to express abundant quantities of the protein. Some of the early examples are insulin, growth hormone, erythropoietin, and the interferons.

The advantages of that approach were that everyone knew that the products would be useful and that recombinant techniques were efficient for production, compared with earlier techniques of extraction from cadavers and tissue. Another advantage—albeit not from a scientific viewpoint—is that it is easy to sell to the investment community; it was a simple, easily understood model. Respess described the raising of capital in the early days of biotechnology as "unbelievable. You could found a company and, within a relatively short time, go public and raise many millions of dollars." However, those days are now past, in part because of the intrinsic limitation of large protein molecules: they are expensive to produce and to deliver to patients (they must be delivered by injection). The drug targets that are easy to identify have already been exploited.

A newer biopharmaceutical strategy emerged—not to discover large proteins or other large-molecule drugs, but to find other therapeutically active small molecules. These are the traditional targets of pharmaceutical research, but a biopharmaceutical company uses modern biotechnology and insights from molecular biology to get to the ultimate target product more quickly and efficiently. This approach has several advantages. The drugs are conventional and can typically be given orally, as well as by injection; they are relatively easy to manufacture; and the Food and Drug Administration is very familiar with such drugs, which makes it easier to get a new drug approved. The problem from a small company's perspective, however, is that it takes a very expensive infrastructure. Ultimately, synthesizing small molecules means making many molecules, and medicinal chemistry is very expensive. You have a tool, but you do not have any products in hand.

• Expressed-Sequence Tags (ESTs): Three Models for Disseminating Unpatented Research Tools

An expressed-sequence tag (EST) is part of a sequence from a cDNA clone that corresponds to an mRNA (Adams and others 1991). It can be used to identify an expressed gene and as a sequence-tagged site marker to locate that gene on a physical map of the genome. In 1991 and 1992, NIH filed patent applications for 6,800 ESTs and for the rapid sequencing method developed by Craig Venter, who was a scientist at NIH. The PTO rejected NIH's application and when Harold Varmus became director of NIH, he decided not to appeal. But controversy caused by the initial patent application continued. In 1992, Venter left NIH to form The Institute for Genome Research (TIGR), a nonprofit company, and William Haseltine joined the newly established private company, Human Genome Sciences (HGS), a for-profit company that initially provided almost all of TIGR's funding. The focus of the controversy then moved from the public to the private sector, and it changed from an issue about patenting research tools to an issue of access to unpatented research tools. Like many other research tools, ESTs fill different roles and some of the controversy has involved disputes of the relative importance of ESTs for uses other than research.

Two factors have contributed to the controversy over intellectual property issues in this particular setting. First is the perception that some of the participants have been staking out intellectual property claims that extend beyond their actual achievements to include discoveries yet to be made by others. There is no question that ESTs constitute a powerful research tool. Questions about the patenting of ESTs have focused on the criteria of utility. ESTs are of limited value without substantial and nonobvious development. Initially a public institution, NIH, proposed to patent discoveries that both scientists and some representatives of industry felt belonged in the public domain. More recently a private institution, Merck, has assumed the quasigovernment task of sponsoring a university-based effort to place information into the public domain. While other private companies have provided funds for public sector research, such as in the Sandoz-Scripps agreement, these efforts have not been with the expressed purpose of putting information into the public domain.

This is a particularly interesting case study, in part because it began as a controversy over patents—over what could be patented, what should be patented and what would be the effect of patenting. It has evolved into a controversy over the dissemination of unpatented information and the terms on which that information will be made available.

Different firms have taken different approaches to the dissemination of these unpatented research tools, thus providing a natural experiment with which to study three models for disseminating the same sort of information. The models all arose in the private sector, and we can assume that although each firm adopted a different strategy, they had the same ultimate goal of maximizing the value that they could obtain from the information. Merck has put the information in the public domain, Human Genome Sciences (HGS) initially adopted an exclusive-licensing model, and Incyte adopted a broad licensing approach of offering nonexclusive licenses to its database to as many firms as would sign up. Putting information in the public domain limits opportunities to exploit it as a trade secret by controlling access to it. Patents, or the patent applications of private database owners, potentially limit the ability to use the information that is in the public domain if any patent rights are ultimately obtained.

• HGS. The strategy of HGS has been to form a major partnership with the pharmaceutical firm SmithKline Beecham (SKB) 2 , with which it agreed to provide a three year exclusive license to its EST database. SKB has sublicensed its rights to a major Japanese pharmaceutical company, Takeda Chemical, Ltd., and HGS also has 200 restricted-licensing arrangements with university researchers. The TIGR database contains a limited portion of the data created by HGS and all of the data created by TIGR before April 1, 1994 which is when TIGR stopped work on human cDNAs. TIGR provides two levels of access to its EST databases. At the first level, an investigator is allowed access to sequences that are owned by HGS that overlap or are identical with sequences already in the public domain and for which public databases are available. At the second level, investigators are allowed access to about 70,000 sequences that are not listed in the publicly available databases (Genbank or the European databases). To obtain the second level, an investigator must agree to disclose any invention that is made at any time after access is gained. Furthermore, HGS or the Institute for Genome Research (TIGR) must be allowed at least six months to negotiate a licensing agreement. 3 The public does not have access to the much larger HGS cDNA database.
• Merck. Merck is interested in using the information from ESTs for furthering its research efforts. The Merck Gene Index was established to fill a public-access gap and was developed in partnership with established genome centers. Sequencing is carried out at Washington University, and the data are handled at the Los Alamos Laboratories. The international databases are a direct source of the information. A biotechnology company has taken all the clones into its distribution system and will freely distribute its materials. Other institutions, such as TIGR and Genethon, have entered sequences into this public database.
• Incyte. Incyte's strategy has been to offer nonexclusive licenses to its database. As of the time of the workshop, six companies (Pfizer, Upjohn, Novo Nordisk, Hoechst, Abbott Laboratories, and Johnson & Johnson) have contributed in the aggregate, around $100 million, exclusive of contingency payments and royalty payments for access to this database. Even as the Merck data continue to be placed in the public domain, Incyte continues to sign up new subscribers; there seems to be continuing value for the subscribing firms to obtain access to one of the private databases. This strategy is interesting not only for what it says about the nonexclusive-licensing strategy but because this is the most current information as to the relative values of the private databases versus the public-domain database.

The Informational Value of ESTs Is Rudimentary

None of the participants disputed the value of ESTs as research information, but several commented on the rudimentary nature of the information. Having an EST in hand does not guarantee a practical strategy for obtaining the identity of the gene of which the EST is but a fragment. Furthermore, if the gene identified is unknown, there remains substantial investment in understanding its function. It has been successfully accomplished in many cases, and many specific strategies have been developed over the years for approaching this task. Nonetheless, it remains fraught with uncertainty. In 1995 the Human Genome Organization (HUGO) issued a statement on ''Patenting of DNA sequences'' arguing that the nature of sequence information is so rudimentary that to limit access to it is to impede development of medical advances.

Several uses have been suggested for genes and gene fragments to claim utility requirement for patent protections. They include the use of genes or gene fragments for categorizing, mapping, tissue typing, forensic identification, antibody production, or locating gene regions associated with genetic disease. However, each of those suggested uses may not be carried out without considerable further effort and additional biological information that is not inherent in the sequence alone. Many of the workshop participants concurred with the HUGO statement that without databases to provide further information, the informational value of ESTs themselves is very limited.

William Haseltine, CEO of HGS, noted that patent applications filed by HGS for ESTs involve considerably more than simply identification of the gene fragments and involve information about the stage of development and tissue type in which those genes are expressed. He further commented that the importance of the EST database is not simply that the fragments are identified, but that the database itself provides a high level of information.

The Value of ESTs Could Be Reduced by Limiting Access

Many of the workshop participants echoed the HUGO statement of concern that "the patenting of partial and uncharacterized cDNA sequences will reward those who make routine discoveries but penalize those who determine biological function or application. Such an outcome would impede the development of diagnostics and therapeutics." Both Harold Varmus and Gerald Rubin suggested that some researchers are likely to be discouraged from working on patented ESTs for fear that the patent holders would lay claim to their future discoveries, particularly discoveries about gene function, which are clearly of far greater biological utility than the identification of anonymous fragments and are more likely to have useful applications for human health.

Several previous reports have stated that research-tool claims should not be so broad as to block the discoveries outside of the patent (House of Commons Science and Technology Committee 1995, National Academies Policy Advisory Group 1995). No one at the workshop argued otherwise.

Fragile X syndrome, which is the most-common form of mental retardation, provides an example of how ESTs can contribute to human disease. The name refers to the fact that the X chromosome is easily broken. Caskey described how he, Steve Warren, and Ed Benustra used an EST to discover that the genetic defect involves multiple repeats of the nucleotide triple CGG. They went on to characterize the gene, and that provided the information necessary to develop what is now the most widely used diagnostic test for fragile X syndrome. When they made their discovery, the sequence information on the gene involved gave no information on function. It was investigators like Bob Nussbaum, and Dreyfus, at Philadelphia, who went on to identify the gene's function.

Caskey suggested that if speculative claims were permitted among a certain set of ESTs the rights of investigation to discover that gene would be denied.

James Sikella cited the example of the HIV patent, which is jointly held by the US and French governments. The patent has not been tightly restricted for investigational use. At the time of its filing, its sequence and functions were not described. Many discoveries about HIV have evolved from that sequence information, and Sikella noted that it would have been a disservice to the public if the sequence information had not been available as a general research tool.

The Human Genome Is Finite

As of this workshop, some 27,000–5,000 human genes were represented in the database. Humans are estimated to have about 80,000–100,000 genes, so that represents about one-fourth to almost half of the total. Tom Caskey predicted that as the database begins to be flooded with sequence information, there will be a higher stringency on patents and patent claims will be directed more toward functional aspects of the genes, rather than being primarily descriptive.

Caskey also described how the usefulness of the gene index has improved with the addition of more sequences. When the general location of a disease gene is known from genetic mapping, limited sequencing is an important strategy for finding the gene. By sampling the critical region, the small bits of sequences can be used to search for homologies in the gene sequence database. In this way, a previously sequenced gene or gene fragment can be identified as being located in a critical region. Such a gene is then a prime suspect for more detailed studies in those individuals carrying the disease. Initially, the success rate for this technique of finding disease genes in positionally cloned regions was only about 40%. As the size of the gene database increases, so does the success rate. This is, therefore, becoming a fast and facile method for identifying a disease gene in a critical region identified by genetic mapping.

Sikella suggested that the success of the Human Genome Project may be measured, in part, by how the knowledge that it generates benefits society. He emphasized the importance of making these benefits available in a cost-effective way.

The Advent of DNA Sequencing Presents Important Questions about Patentability

Leon Rosenberg commented that "although the debate seems to have cooled a bit, the issues surely have not been resolved." Tom Caskey of Merck and William Haseltine of HGS both commented that they have no quarrel with the current criteria for patents, but they express different views as how those criteria should be interpreted. Since the workshop, HGS has received patents on a number of ESTs with broader claims of utility than the initial EST patent applications filed by NIH in 1974. Whether this will influence the debate over ESTs is an open question. Caskey noted that after one has an EST, identifying the full length sequence cDNA is the obvious next step. And yet this rarely leads to precise knowledge of that gene's function. He predicted that the complete cDNA sequences might become the 1997 version of ESTs—that is, research tools which many people do not believe meets the full potential criteria of novelty, nonobviousness, and utility. Rosenberg suggested that "the biomedical research community has not yet truly grappled with the possibility that a large number of genes could be controlled by the rights of a relatively small number of parties who could not possibly hope to fully exploit their potential value." He suggested that if research tools are not made available to the scientific community and others, we will have to confront this issue directly, whether that requires changes in patent law or other equally drastic directions.

• Adams MD, Kelley JM, Gocayne JD, Dubnick M, Polymeropoulos MH, Xiao H, Merril CR, Wu A, Olde B, Moreno RF, Kerlavage AR, McCombie WR, Venter JC. 1991. Complementary DNA sequencing: expressed sequence tags and human genome project . Science 252(5013): 1651–1656. [ PubMed : 2047873 ]
• Beardsley T. 1994. Big time biology . Sci Amer. November: 90–97. [ PubMed : 7997867 ]
• House of Commons Science and Technology Committee. 1995. Human genetics: the science and its consequences , Vol.1. London, UK: House of Commons;
• National Academies Policy Advisory Group. 1995. Intellectual property and the academic community . London: The Royal Society. 65p.

Royalty rates refer to a charge based on the revenues earned by the licensee and are different from the up-front fees and annual minimum royalties referred to earlier. As a member of a not-for-profit institution, Poiesz was offered the choice between a 9% or 12% royalty rate, with the lower rate available to those who agreed to use Roche-manufactured DNA polymerase for their testing.

Takeda Chemical, Ltd., the largest Japanese pharmaceutical firm, is another partner. Since the workshop, HGS has directly licensed three other companies: Schering-Plough, Merck KGAA (a German company, not affiliated with US Merck), and Synthelabo (a French company).

After April 1, 1997, all of the original EST sequences in the HGS-TIGR databases completed by April 1994 will be publicly available with no restrictions.

• Cite this Page National Research Council (US). Intellectual Property Rights and the Dissemination of Research Tools in Molecular Biology: Summary of a Workshop Held at the National Academy of Sciences, February 15–16, 1996. Washington (DC): National Academies Press (US); 1997. 5, Case Studies.
• PDF version of this title (240K)

In this Page

Related information.

• PubMed Links to PubMed

Recent Activity

• Case Studies - Intellectual Property Rights and the Dissemination of Research To... Case Studies - Intellectual Property Rights and the Dissemination of Research Tools in Molecular Biology

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

Connect with NLM

National Library of Medicine 8600 Rockville Pike Bethesda, MD 20894

Web Policies FOIA HHS Vulnerability Disclosure

Help Accessibility Careers

• Bioethics Cases
• Markkula Center for Applied Ethics
• Focus Areas
• Bioethics Resources

Find case studies on topics in health care and biotechnology ethics, including end-of-life care, clinical ethics, pandemics, culturally competent care, vulnerable patient populations, and other topics in bioethics. (For permission to reprint cases, submit requests to [email protected] .)

Cases can also be viewed by the following categories:

An obstetrician treating a heroin-addicted mother considers whether to comply with state law requiring medical professionals to report drug-addicted pregnant women to law enforcement for child endangerment.

A drug treatment counselor considers whether to allow a patient a second chance in the drug-treatment program, against stated program rules.

A religious cleric considers how to support a member of the community struggling with depression and alcoholism, who declines recommended referral to expert medical treatment.

A primary care physician considers if s/he can competently provide treatment to a patient who may have a serious psychiatric disorder and does not wish to go to another doctor.

A physician considers whether to honor a promising medical student’s request to withhold a diagnosis of depression from her record. The medical student fears a record of depression could hurt her career.

A psychologist considers whether there is a duty to warn a couple whom the jealous patient has expressed a desire to stalk and frighten.

An adolescent medicine physician considers how to help a potentially suicidal non-minor young adult who declines treatment. Potential options include the possibility of petitioning the court to coerce inpatient treatment.

A psychiatrist considers whether to use a placebo (a fake treatment) on a patient whom the clinician thinks might benefit.

While organ donation is necessary to alleviate suffering and save lives, questions of autonomy, coercion, and the yuk factor deserve careful consideration as we seek to increase supply in the face of unrelenting demand.

Is it ethical to eliminate native populations of disease-carrying pests through genetic manipulation?

• More pages:

myCBSEguide

• Class 12 Biology Case...

Class 12 Biology Case Study Questions

Table of Contents

myCBSEguide App

Download the app to get CBSE Sample Papers 2023-24, NCERT Solutions (Revised), Most Important Questions, Previous Year Question Bank, Mock Tests, and Detailed Notes.

As we know that CBSE will now ask case study questions in each subject. In most of the cases, we have noticed that these case-based questions are high-scoring. A little effort on these case study questions can help you get good marks in your board exams. You can download CBSE Class 12 Biology Case Study Questions from the myCBSEguide App or from our Student Dashboard .

Let’s understand what type of case study questions CBSE asks in class 12 Biology. If you analyze the latest class 12 Biology sample papers , you will find that there are two types of case study questions in the Biology question papers.

• Case Studies with objective questions
• Case studies with subjective questions

As per the latest circular issued by CBSE on Assessment and Evaluation Practices of the Board for the Session 2022-23 , CBSE has clearly mentioned that competency-based questions including case studies will be different from subjective questions. Hence, we expect that CBSE will ask only objective questions in CBSE class 12 Biology case study questions too.

Biology Competency Based Questions

As discussed earlier too, the competency-based questions promote learning development for our students and test higher-order skills, such as analysis, critical thinking and conceptual clarity. Case study questions are actually competency-based questions. The very purpose of including such questions in the curriculum is to emphasise on development of problem-solving ability and the ability to apply knowledge in real-life situations.

Even in CBSE Class 12 Biology case studies, you will find some text input like paragraphs, pictures, data etc followed by some objective-type questions. You should read the given information carefully and then answer the questions.

CBSE 12th Biology Case Study MCQs

Here is one example question on subjective type case study questions. This was given in the term-2 sample paper in 2022.

Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single-stranded DNA. BamH1is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand.

• What is the objective of this action?
• Explain how the gene of interest is introduced into a vector.
• You are given the DNA shown below. 5’ ATTTTGAGGATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAGGCATTACAGGA 5’ If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.
• A gene M was introduced into E.coli cloning vector PBR322 at the BamH1 site. What will be its impact on the recombinant plasmids? Give a possible way by which you could differentiate non-recombinant to recombinant plasmids.

Let’s take another example from MCQ type question:

To answer the questions, study the graphs below for Subject-1 and 2 showing different levels of certain hormones.

The peak observed in Subject-1 and 2 is due to

• progesterone
• luteinizing hormone
• follicle stimulating hormone

Subject 2 has higher level of hormone B, which is

If the peak of Hormone A does not appear in the study for Subject 1, which of the following statement is true?

• Peak of Hormone B will be observed at a higher point in the graph
• Peak of Hormone B will be observed at a point lower than what is given in the graph
• There will be no observed data for Hormone B
• The graph for Hormone B will be a sharp rise followed by a plateau

Which structure in the ovary will remain functional in subject 2?

• Corpus Luteum
• Tertiary follicle
• Graafian follicle
• Primary follicle

For subject 2 it is observed that the peak for hormone B has reached the plateau stage. After approximately how much time will the curve for hormone B descend?

Which of the following statements is true about the subjects?

• Subject 1 is pregnant
• Subject 2 is pregnant
• Both subject 1 and 2 are pregnant
• Both subject 1 and 2 are not pregnant

Another example of a class 12 Biology case study question

We use microbes or products which are derived from them every day. A common example is the production of curd from milk. Micro-organisms such as Lactobacillus and others commonly called lactic acid bacteria (LAB) grow in milk and convert it to curd. The dough, which is used for making foods such as dosa and idli is also fermented by bacteria. A number of traditional drinks and foods are also made by fermentation by microbes.  ‘Toddy’, a traditional drink in some parts of southern India is made by fermenting sap from palms. The ‘Roquefort cheese’ is ripened by growing specific fungi on them, which gives them a particular flavour. Different varieties of cheese are known by their characteristic texture, flavour and taste, the specificity coming from the microbes used.

• Penicillium notatum
• Saccharomyces cerevisiae
• Aspergillus niger
• Clostridium butylicum
• thermal vents
• polluted water
• all of these
• None of the above
• production of a large amount of CO 2
• production of O 2
• due to the presence of water
• none of these
• Both Assertion and Reason are true and Reason is the correct explanation of the Assertion
• Both Assertion and Reason are true but Reason is not the correct explanation of the Assertion
• Our Assertion is true but the Reason is false
• Both the statements are false

Download 12 Biology Case Study Questions

In this article, we have given you a few examples of class 12 Biology case study questions. We advise you to download the myCBSEguide App or access our Student Dashboard to get more case study questions for CBSE class 12 biology. We have hundreds of questions on case studies related to CBSE Class 12 Biology. As CBSE is now focusing more on the understanding of the concepts, it is a must for students to practice such questions regularly.

Test Generator

Create question paper PDF and online tests with your own name & logo in minutes.

Question Bank, Mock Tests, Exam Papers, NCERT Solutions, Sample Papers, Notes

Related Posts

• Competency Based Learning in CBSE Schools
• Class 11 Physical Education Case Study Questions
• Class 11 Sociology Case Study Questions
• Class 12 Applied Mathematics Case Study Questions
• Class 11 Applied Mathematics Case Study Questions
• Class 11 Mathematics Case Study Questions
• Class 11 Biology Case Study Questions
• Class 12 Physical Education Case Study Questions

Leave a Comment

Save my name, email, and website in this browser for the next time I comment.

Class 12 Biology Case Study Based Questions PDF Download

• Post author: studyrate
• Post published:
• Post category: Class 12 / 12 board
• Post comments: 0 Comments

In the pursuit of academic excellence, Class 12 Biology students often encounter case studies that challenge their problem-solving abilities and critical thinking skills. These case studies serve as valuable learning tools, allowing students to apply their theoretical knowledge to real-life scenarios. In this article, we will delve into the significance of Class 12 Biology Case Study Based Questions and provide a downloadable PDF resource containing a collection of such questions. So, let’s explore how these case studies can enhance students’ understanding and performance in the subject.

Join our Telegram Channel, there you will get various e-books for CBSE 2024 Boards exams for Class 9th, 10th, 11th, and 12th.

Case study-based questions simulate real-life situations, encouraging students to analyze, evaluate, and apply their knowledge to address specific problems. By engaging with these scenarios, students develop a deeper understanding of the subject matter, making their learning more meaningful and relevant.

Table of Contents

Case Study-Based Questions for Class 12 Biology

These Class 12th Case Study and Passage-Based Questions will help you to score 95% in Your Board Exams.

• Class 12 Physics Case Study Questions
• Class 12 Chemistry Case Study Questions
• Class 12 Biology Case Study Questions
• Class 12 Maths Case Study Questions

Books for Class 12 Biology

Strictly as per the new term-wise syllabus for Board Examinations to be held in the academic session 2024 for class 12 Multiple Choice Questions based on new typologies introduced by the board- Stand-Alone MCQs, MCQs based on Assertion-Reason Case-based MCQs. Include Questions from CBSE official Question Bank released in April 2024 Answer key with Explanations What are the updates in the book: Strictly as per the Term wise syllabus for Board Examinations to be held in the academic session 2024. Chapter-wise -Topic-wise Multiple choice questions based on the special scheme of assessment for Board Examination for Class 12th.

Case Study-Based Questions Benefit Class 12 Biology Students

Comprehensive learning.

By incorporating case studies into the curriculum, Class 12 Biology students gain a comprehensive understanding of complex biological concepts. These case studies encompass a wide range of topics, from ecology to genetics, and offer multifaceted learning experiences.

Application of Theoretical Knowledge

Theoretical knowledge becomes more valuable when students can apply it practically. Case study-based questions bridge the gap between theory and application, empowering students to connect classroom learning to real-world situations.

Engaging and Interactive Learning

Case studies have an inherent appeal, as they present intriguing problems that captivate students’ attention. This engagement enhances their motivation to learn, making the subject more enjoyable and meaningful.

Tips for Effective Utilization of Case Study-Based Questions

Collaborative learning.

Encourage students to discuss case studies in groups. Collaborative learning promotes teamwork, diverse perspectives, and a deeper understanding of the subject matter.

Teacher Guidance

Teachers play a crucial role in guiding students through the analysis of case studies. Providing insights, posing relevant questions, and facilitating discussions can significantly enhance the learning experience.

Regular Practice

Integrate case study-based questions into regular assessments. Regular practice helps students become more comfortable with this format and boosts their confidence in tackling complex problems.

Class 12 Biology Syllabus for 2024

Check the complete syllabus below along with the new exam scheme. 

Detailed Syllabus:

Unit-VI Reproduction

Chapter- 2:   Sexual Reproduction in Flowering Plants

Flower structure; development of male and female gametophytes; pollination – types, agencies and examples; out breeding devices; pollen-pistil interaction; double fertilization; post-fertilization events – development of endosperm and embryo, development of seed and formation of fruit; special modes- apomixis, parthenocarpy, polyembryony; Significance of seed dispersal and fruit formation.

Chapter- 3: Human Reproduction

Male and female reproductive systems; microscopic anatomy of testis and ovary; gametogenesis-spermatogenesis and oogenesis; menstrual cycle; fertilisation, embryo development up to blastocyst formation, implantation; pregnancy and placenta formation (Elementary idea); parturition (elementary idea); lactation (elementary idea).

Chapter- 4: Reproductive Health

Need for reproductive health and prevention of Sexually Transmitted Diseases (STDs); birth control – need and methods, contraception and medical termination of pregnancy (MTP); amniocentesis; infertility and assisted reproductive technologies – IVF, ZIFT, GIFT (Elementary idea for general awareness).

Unit-VII Genetics and Evolution

Chapter-5: Principles of Inheritance and Variation

Heredity and variation: Mendelian inheritance; deviations from Mendelism – incomplete

dominance, co-dominance, multiple alleles and inheritance of blood groups, pleiotropy; elementary idea of polygenic inheritance; chromosome theory of inheritance; chromosomes and genes; Sex determination – in humans, birds and honey bees; linkage and crossing over; sex-linked inheritance – haemophilia, colour blindness; Mendelian disorders in humans – thalassemia; chromosomal disorders in humans; Down’s syndrome, Turner’s and Klinefelter’s syndromes.

Chapter-6: Molecular Basis of Inheritance

Search for genetic material and DNA as genetic material; Structure of DNA and RNA; DNA packaging; DNA replication; Central Dogma; transcription, genetic code, translation; gene expression and regulation – lac operon; Genome, Human and rice genome projects; DNA fingerprinting.

Chapter-7: Evolution

Origin of life; biological evolution and evidence for biological evolution (paleontology, comparative anatomy, embryology, and molecular evidence); Darwin’s contribution, modern synthetic theory of evolution; mechanism of evolution – variation (mutation and recombination) and natural selection with examples, types of natural selection; Gene flow and genetic drift; Hardy – Weinberg’s principle; adaptive radiation; human evolution.

Unit-VIII Biology and Human Welfare

Chapter-8: Human Health and Diseases

Pathogens; parasites causing human diseases (malaria, dengue, chikungunya, filariasis, ascariasis, typhoid, pneumonia, common cold, amoebiasis, ring worm) and their control; Basic concepts of immunology – vaccines; cancer, HIV and AIDS; Adolescence – drug and alcohol abuse.

Chapter-10: Microbes in Human Welfare

Microbes in food processing, industrial production, sewage treatment, energy generation and microbes as bio-control agents and bio-fertilizers. Antibiotics; production and judicious use.

Unit-IX Biotechnology and its Applications

Chapter-11: Biotechnology  – Principles and Processes

Genetic Engineering (Recombinant DNA Technology).

Chapter-12: Biotechnology and its Applications

Application of biotechnology in health and agriculture: Human insulin and vaccine production, stem cell technology, gene therapy; genetically modified organisms – Bt crops; transgenic animals; biosafety issues, biopiracy and patents.

Unit-X Ecology and Environment

Chapter-13: Organisms and Populations

Population interactions – mutualism, competition, predation, parasitism; population attributes – growth, birth rate and death rate, age distribution. (Topics excluded: Organism and its Environment, Major Abiotic Factors, Responses to Abiotic Factors, Adaptations)

Chapter-14: Ecosystem

Ecosystems:  Patterns, components; productivity and decomposition; energy flow; pyramids of number, biomass, energy (Topics excluded: Ecological Succession and Nutrient Cycles)

Chapter-15: Biodiversity and its Conservation

Biodiversity-Concept, patterns, importance; loss of biodiversity; biodiversity conservation; hotspots, endangered organisms, extinction, Red Data Book, Sacred Groves, biosphere reserves, national parks, wildlife, sanctuaries and Ramsar sites.

Case study-based questions are invaluable tools that enrich the learning experience of Class 12 Biology students. They foster critical thinking, decision-making skills, and the practical application of theoretical knowledge. By engaging with case studies, students develop a deeper understanding of biological concepts and their relevance in the real world.

Are the case study-based questions suitable for self-study?

Absolutely! These case study-based questions are designed for both classroom learning and self-study. They are excellent resources for independent practice.

Where I can get Class 12th Biology Case Study Questions?

You can practice the Biology Class 12th Case Study Questions on studyrate.in for free.

Do the case studies cover the entire Class 12 Biology syllabus?

Yes, the case studies encompass various topics from the Class 12 Biology syllabus, providing comprehensive coverage.

Are answer keys provided for the case study-based questions?

Yes, after every questions the Ansswer is provided with detailed explanation

You Might Also Like

Class 12 physics case study questions of chapter 1 electric charges and fields, indigo summary class 12 english pdf, mcq questions class 12 economics chapter 5 government budget and the economy with answers, leave a reply cancel reply.

Save my name, email, and website in this browser for the next time I comment.

This site uses Akismet to reduce spam. Learn how your comment data is processed .

The Topper Combo Flashcards

• Contains the Latest NCERT in just 350 flashcards.
• Colourful and Interactive
• Summarised Important reactions according to the latest PYQs of NEET(UG) and JEE

No thanks, I’m not interested!

• Bihar Board

SRM University

Bseb 10th result.

• Bihar Board Result 2024
• UP Board Result 2024
• CBSE Board Result 2024
• MP Board Result 2024
• Rajasthan Board Result 2024
• Shiv Khera Special
• Education News
• Web Stories
• Current Affairs
• नए भारत का नया उत्तर प्रदेश
• School & Boards
• College Admission
• Govt Jobs Alert & Prep
• GK & Aptitude

Case Study Based Questions for CBSE Class 12 Biology Board Exam 2024: Read this article for Last Minute Revision

Cbse class 12 biology important case study questions : practise important case study based questions for class 12 biology board exam. these case study based questions are important for the upcoming cbse class 12 biology board exam 2024 on march 19, 2024..

CBSE Class 12th Biology Board Exam 2023-24 Pattern

The paper will be of 70 marks and the time duration for completing the paper will be 3 hours.

The paper will have 33 questions divided into 5 sections.

Section–A 16 questions of 1 mark each,

Section–B 5 questions of 2 marks each;

Section–C 7 questions of 3 marks each;

Section–D 2 case-based questions of 4 marks each,

and Section–E 3 questions of 5 marks each.

CBSE Class 12 Biology Important Case Study Based Questions

Case Study 1:  Nondisjunction is the failure of homologous chromosomes to disjoin correctly during meiosis. It leads to the formation of a new cell with an abnormal amount of genetic material. A number of clinical conditions are the result of this type of chromosomal mutation. This results in the production of gametes containing a greater or lesser chromosomal amount than normal ones. Consequently, the individual may develop a trisomy or monosomal syndrome. Nondisjunction can occur in both Meiosis I and Meiosis II of the cellular division. It is also the main cause of many genetic disorders; however, its origin and process remain vague. Although it results in the majority of cases from errors in maternal meiosis II, both paternal and maternal meiosis I do influence it. Maternal age is considered a risk factor for trisomy, as well as recombination alterations and many others that can affect chromosomal segregation.

• It is the presence of an extra chromosome in a diploid cell.
• An aneuploid cell differs from other cells only in size.
• It can be less number of chromosomes in a diploid cell.
• Aneuploidy always affects female individuals.
• both i and iii
• both ii and iii
• i, iii and iv
• Errors in meiosis I is the only cause of aneuploidy
• Aneuploidy always affects sex chromosomes.
• Most of the aneuploidy results from errors in cell division involved in egg formation.
• Nondisjunction in meiosis I can lead to more abnormal cells than disjunction in meiosis II.
• both I and iii
• both iii and iv
• I, iii and iv
• Aneuploidy is not influenced by the mother’s age.
• Delivery before 30 years of age can decrease the incidence of aneuploidy in most cases
• The chance of aneuploidy increases up to 22 years of age.
• There is a dramatic increase in aneuploidy if the maternal age exceeds 30

• both ii and iv
• Chromosomal disorders
• Mendelian disorders
• Incomplete dominance
• All the above

Q5: Assertion: All types of genetic disorders are caused by chromosomal nondisjunction.

• Both assertion and reason are correct and the reason is the correct explanation of assertion
• Both assertion and reason are correct but the reason is not the correct explanation of the assertion
• Assertion is correct but the reason is incorrect
• Both assertion and reason are incorrect

Case Study 2:  A Representative Diagram of the Human Genome Project:

• Biotechnology
• Biomonitoring
• Bioinformatics
• Biosystematics

Q2:  Name a free living, non-pathogenic nematode, the DNA of which has been completely sequenced.

Answer: Caenorhabditis elegans

Q3: Summarize the methodology adopted in the Human Genome Project.

Answer: Expressed Sequence Tags (ESTs) : The approach focused on identifying all the genes that are expressed as RNA.

Sequence Annotation : The other took the blind approach of simply sequencing the whole set of genome that contained all the coding and non-coding sequence, and later assigning different regions in the sequence with functions.

Q4: What are SNPs’? How are they useful in human genomics?

• Identify disease-causing genes in humans
• Can be used to understand the molecular mechanisms of sequence evolution.

Q5: Mention at least four salient features of the Human Genome Project.

• Human genome contains 3164.7 million bp.
• Average gene consists of 3000 bases, but sizes vary greatly.
• Almost all (99.9 percent) nucleotide bases are exactly the same in all people.
• Less than 2 percent of the genome codes for proteins.

Case Study 3: Two blood samples of suspects ‘A’ and ‘B’ were sent to the Forensic Department along with sample ‘C’ from the crime scene. The Forensic Department was assigned the responsibility of running the samples and matching the samples of the suspects with that of the sample from the scene of the crime and thereby identifying the culprit.

• A radioactively labelled double stranded RNA molecule.
• A radioactively labelled double stranded DNA molecule.
• A radioactively labelled single stranded DNA molecule.
• A radioactively labelled single stranded RNA molecule.

Q3: What does ‘minisatellite’ and ‘microsatellite’ mean in relation to DNA Fingerprinting?

Answer:  Minisatellite: the repeating unit consists of 10-100 base pairs.

Microsatellite: the repeating unit consists of 2-6 base pairs.

Q3: How does polymorphism arise in a population?

Answer: Polymorphism (variation at the genetic level) arises due to mutations.

Q4: State the steps involved in DNA Fingerprinting in a sequential manner.

• DNA isolation
• DNA digestion with restriction enzymes.
• DNA fragment separation by electrophoresis.
• Hybridization
• DNA visualization under UV light.

Case Study 4: Bacteria like Streptococcus pneumoniae  and Haemophilus influenzae  are responsible for the disease pneumonia in humans which infects the alveoli (air-filled sacs) of the lungs. As a result of the infection, the alveoli get filled with fluid leading to severe problems in respiration. The symptoms of pneumonia include fever, chills, cough, and headache. In severe cases, the lips and fingernails may turn gray to bluish in colour. A healthy person acquires the infection by inhaling the droplets/aerosols released by an infected person or even by sharing glasses and utensils with an infected person. Dysentery, plague, diphtheria, etc., are some of the other bacterial diseases in man. Many viruses also cause diseases in human beings. Rhinoviruses represent one such group of viruses that cause one of the most infectious human ailments – the common cold. They infect the nose and respiratory passage but not the lungs.

The common cold is characterized by nasal congestion and discharge, sore throat, hoarseness, cough,

headache, tiredness, etc., which usually lasts for 3-7 days. Droplets resulting from the cough or sneezes of an infected person are either inhaled directly or transmitted through contaminated objects such as pens, books, cups, doorknobs, computer keyboards or mice, etc., and cause infection in a healthy person.

• By exhaling droplets of a non-infected person.
• By headache or leg pain.
• By eating fast food.
• By inhaling droplets of an infected person.

Q4:  How long does the common cold last?

Answer: 3-7 days

Q5:  Write any two symptoms of the common cold and pneumonia.

Answer: Cough and nasal congestion.

Case Study 5: When you insert a piece of alien DNA into a cloning vector and transfer it into a bacterial, plant, or animal cell, the alien DNA gets multiplied. In almost all recombinant technologies, the ultimate aim is to produce a desirable protein. Hence, there is a need for the recombinant DNA to be expressed. The foreign gene gets expressed under appropriate conditions. The expression of foreign genes in host cells involves understanding many technical details. After having cloned the gene of interest and having optimised the conditions to induce the expression of the target protein, one has to consider producing it on a large scale. Can you think of any reason why there is a need for large-scale production? If any protein encoding gene is expressed in a heterologous host, it is called a recombinant protein. The cells harbouring cloned genes of interest may be grown on a small scale in the laboratory. The cultures may be used for extracting the desired protein and then purifying it by using different separation techniques.

• A continuous culture system
• A stirred-tank bioreactor without in-lets and out-lets
• Laboratory flask of the largest capacity
• None of the above
• upstream processing
• downstream processing
• bioprocessing
• postproduction processing
• Human insulin
• Growth hormone
• cleaving and joining of DNA segments with endonuclease
• cleaving DNA segments with endonuclease and re-joining with ligase
• cleaving and re-joining DNA segments with ligase
• cleaving DNA segments with ligase and re-joining with endonuclease

Case Study 6: Gene Therapy

Read the following and answer the questions that follow:

• Replacing a disease-causing gene with a healthy copy of the gene
• Inactivating a disease-causing gene that is not functioning properly
• Introducing a new or modified gene into the body to help treat a disease
• Adenosine deaminase
• phenylketonuria
• Phenylalanine
• Bone marrow transplantation
• Southern blotting

Q4 Introduction of gene isolate from bone marrow producing ADA should be introduced at what age to

• acute diseases
• physiological diseases
• hereditary diseases
• infectious diseases
• CBSE Class 12 Biology Previous Year Question Papers with Solutions PDF Download
• CBSE Class 12 Syllabus 2023-24 PDF (All Subjects)
• CBSE Class 12 Deleted Syllabus (All Subjects)
• CBSE Class 12 Previous Year Papers with Solution PDF Download
• CBSE Class 12 Additional Practice Questions
• CBSE Class 12 Sample Paper 2023-24 with Solution and Additional Practice Questions
• Important MCQs for CBSE Class 12 Biology, All Chapters
• CBSE Class 12 Biology Mind Maps for Quick Revision
• CBSE Class 12 NCERT Biology Revised Textbook PDF
• CBSE Class 12 NCERT Biology Solutions
• CBSE Class 12 Biology Chapter-wise notes
• CBSE Class 12 Date Sheet 2024
• CBSE Competency Based Questions 2023-24
• CBSE Class 12 Additional Practice Questions 2024

Get here latest School , CBSE and Govt Jobs notification in English and Hindi for Sarkari Naukari and Sarkari Result . Download the Jagran Josh Sarkari Naukri App . Check  Board Result 2024  for Class 10 and Class 12 like  CBSE Board Result ,  UP Board Result ,  Bihar Board Result ,  MP Board Result ,  Rajasthan Board Result  and Other States Boards.

• CBSE Board exam 2023 result date. + As per the guidelines released by the Central Board of Secondary Education (CBSE), the tentative dates for the CBSE Board Exam 2023 results are; for class 10th: 15th April 2023 and for class 12th: 30th April 2023.
• When is the Class 12th Biology CBSE Board exam? + According to the date sheet released by the Central Board of Secondary Education (CBSE) for class 12th, the Biology exam is scheduled for the 16th of March 2023. The day will be Thursday.
• BSEB Bihar Board 10th Result 2024
• Bihar Board 10th Result 2024
• BTEUP Result 2024
• NGEL Executive Recruitment 2024
• Bihar Deled Exam Postponed
• Bihar Board 10th Result 2024 Kab Aayega
• MHT SET Admit Card 2024
• AAI JE Result 2024
• UIIC Assistant Score Card2024

Trending Categories

• CBSE Class 10

Latest Education News

IB ACIO Result 2024 OUT at mha.gov.in: Download Tier 1 Selection List

IB ACIO Result 2024 Out: ग्रेड-2 एग्जीक्यूटिव टियर 1 परिणाम लिंक mha.gov.in पर घोषित, इस लिंक से करें चेक

Spot 3 differences in boy drinking milk picture in 15 seconds.

IB ACIO Tier 1 Result 2024 Declared: Check How to Download, Tier 2 Details

Delhi School Result 2024 Out for Class 3, 4, 6, and 7, Direct Link Available At edudel.nic.in

Punjab School Holidays 2024: All Schools To Remain Closed on March 29, Reason Here!

TS SSC Biological Sciences Question Paper 2024 with Answers, Download PDF

Top 10 Least Densely Populated Countries

Good Friday 2024 Holiday: Punjab Schools Closed on March 29, Check Latest Updates

Optical Illusion: Find the hidden bear in the forest in 5 seconds!

Bihar Board 10th Result 2024 Date and Time: बिहार बोर्ड 10वीं रिजल्ट, Check Official Link biharboardonline.bihar.gov.in

UGC Approves Use Of NET Scores For PhD Admissions Starting 2024-25 Academic Session

List of Top Courses You Need to Skill-up after Class 10th Board Exam 2024

Bihar Lekhpal IT Sahayak Bharti 2024: Notification Out for 6570 Vacancies

TS TET Application 2024: Direct Link to Apply Online at tstet2024.aptonline.in, Check Registration Fee

Optical Illusion: Find the hidden painter in the picture in 8 seconds!

Madras University Result OUT at unom.ac.in: Direct Link to Download UG and PG Marksheet

AP DSC Exam Date 2024 Out for SGT, PGT, TGT, and School Assistant Posts

BTEUP Result 2024 OUT on bteup.ac.in; Direct Link to Download Odd Semester and Special Back Paper Marksheet

Illusion Personality Test: What You See First Reveals If You Are A Deep Thinker Or Indecisive

CBSE Expert

CBSE Class 12 Biology Case Study Questions PDF Download

Welcome to the comprehensive guide on CBSE Class 12 Biology Case Study Questions! In this article, we will delve into the world of Biology case studies, explore the importance of case study questions, and provide you with a PDF download that will assist you in mastering this subject. Whether you’re a student preparing for your examinations or a teacher looking to enhance your teaching materials, our detailed resource will help you excel in the realm of Biology.

Case studies are a widely used educational tool that involves the in-depth analysis of a particular situation, organism, process, or problem. In CBSE Class 12 Biology, case study questions are designed to evaluate students’ critical thinking, problem-solving abilities, and practical application of biological concepts. These questions require students to apply their theoretical knowledge to real-life scenarios, thus fostering a deeper understanding of the subject matter.

Class 12 Biology Case Study Questions

CBSE Class 12 Biology question paper will have case study questions too. These case-based questions will be objective type in nature. So, Class 12 Biology students must prepare themselves for such questions. First of all, you should study NCERT Textbooks line by line, and then you should practice as many questions as possible.

Chapter-wise Solved Case Study Questions for Class 12 Biology

Class 12 students should go through important Case Study problems for Biology before the exams. This will help them to understand the type of Case Study questions that can be asked in Grade 12 Biology examinations. Our expert faculty for standard 12 Biology have designed these questions based on the trend of questions that have been asked in last year’s exams. The solutions have been designed in a manner to help the grade 12 students understand the concepts and also easy-to-learn solutions.

Books for Class 12 Biology

Strictly as per the new term-wise syllabus for Board Examinations to be held in the academic session 2022-23 for class 12 Multiple Choice Questions based on new typologies introduced by the board- Stand-Alone MCQs, MCQs based on Assertion-Reason Case-based MCQs. Include Questions from CBSE official Question Bank released in April 2022 Answer key with Explanations What are the updates in the book: Strictly as per the Term wise syllabus for Board Examinations to be held in the academic session 2022-23. Chapter-wise -Topic-wise Multiple choice questions based on the special scheme of assessment for Board Examination for Class 12th.

Tips to Excel in CBSE Class 12 Biology Case Study Questions

Thoroughly grasp the concepts.

Before attempting case study questions, ensure you have a strong grasp of fundamental biological concepts. Familiarize yourself with topics such as genetics, ecology, human physiology, and evolution. A solid foundation will empower you to tackle complex case studies with confidence.

Practice Regularly

Practice makes perfect, and this is especially true for case study questions. Allocate time to work through a diverse range of case studies regularly. Familiarizing yourself with different scenarios will prepare you for the unpredictability of examination questions.

Collaborate and Discuss

Engaging in group discussions with fellow students or teachers can be highly beneficial. Sharing perspectives, analyzing cases together, and discussing possible solutions can broaden your understanding and offer fresh insights.

Seek Guidance from Teachers

Don’t hesitate to approach your teachers for assistance. They possess valuable experience and expertise to guide you through challenging case studies and provide valuable feedback.

Time Management

During examinations, time management is crucial. Practice solving case study questions under timed conditions to improve your efficiency and ensure you complete all questions within the allocated timeframe.

In conclusion, mastering case study questions in CBSE Class 12 Biology is essential for a holistic understanding of the subject and for excelling in examinations. By honing your analytical abilities, practicing regularly, and seeking guidance, you can conquer even the most challenging case studies. Remember that learning Biology is not just about memorizing facts but about applying knowledge to real-world situations. So, embrace the power of case studies and delve into the fascinating world of Biology.

With the provided CBSE Class 12 Biology Case Study Questions PDF, you have a valuable resource at your disposal. Practice diligently, and you’ll witness your confidence soar as you become a proficient problem solver in the realm of Biology. Good luck on your academic journey!

Leave a Comment Cancel reply

Save my name, email, and website in this browser for the next time I comment.

Download India's best Exam Preparation App Now.

Key Features

• Revision Notes
• Important Questions
• Previous Years Questions
• Case-Based Questions
• Assertion and Reason Questions

No thanks, I’m not interested!

• Andhra Pradesh
• Chhattisgarh
• West Bengal
• Madhya Pradesh
• Maharashtra
• Jammu & Kashmir
• NCERT Books 2022-23
• NCERT Solutions
• NCERT Notes
• NCERT Exemplar Books
• NCERT Exemplar Solution
• States UT Book
• School Kits & Lab Manual
• NCERT Books 2021-22
• NCERT Books 2020-21
• NCERT Book 2019-2020
• NCERT Book 2015-2016
• RD Sharma Solution
• TS Grewal Solution
• DK Goel Solution
• TR Jain Solution
• Selina Solution
• Frank Solution
• ML Aggarwal Solution
• Lakhmir Singh and Manjit Kaur Solution
• I.E.Irodov solutions
• ICSE - Goyal Brothers Park
• ICSE - Dorothy M. Noronhe
• Sandeep Garg Textbook Solution
• Micheal Vaz Solution
• S.S. Krotov Solution
• Evergreen Science
• KC Sinha Solution
• ICSE - ISC Jayanti Sengupta, Oxford
• ICSE Focus on History
• ICSE GeoGraphy Voyage
• ICSE Hindi Solution
• ICSE Treasure Trove Solution
• Thomas & Finney Solution
• SL Loney Solution
• SB Mathur Solution
• P Bahadur Solution
• Narendra Awasthi Solution
• MS Chauhan Solution
• LA Sena Solution
• Integral Calculus Amit Agarwal Solution
• IA Maron Solution
• Hall & Knight Solution
• Errorless Solution
• Pradeep's KL Gogia Solution
• OP Tandon Solutions
• Sample Papers
• Previous Year Question Paper
• Value Based Questions
• CBSE Syllabus
• CBSE MCQs PDF
• Assertion & Reason
• New Revision Notes
• Revision Notes
• HOTS Question
• Marks Wise Question
• Toppers Answer Sheets
• Exam Paper Aalysis
• Concept Map
• CBSE Text Book
• Additional Practice Questions
• Vocational Book
• CBSE - Concept
• KVS NCERT CBSE Worksheets
• Formula Class Wise
• Formula Chapter Wise
• JEE Crash Course
• JEE Previous Year Paper
• Important Info
• JEE Mock Test
• JEE Sample Papers
• SRM-JEEE Mock Test
• VITEEE Mock Test
• BITSAT Mock Test
• Manipal Engineering Mock Test
• AP EAMCET Previous Year Paper
• COMEDK Previous Year Paper
• GUJCET Previous Year Paper
• KCET Previous Year Paper
• KEAM Previous Year Paper
• Manipal Previous Year Paper
• MHT CET Previous Year Paper
• WBJEE Previous Year Paper
• AMU Previous Year Paper
• TS EAMCET Previous Year Paper
• SRM-JEEE Previous Year Paper
• VITEEE Previous Year Paper
• BITSAT Previous Year Paper
• Crash Course
• Previous Year Paper
• NCERT Based Short Notes
• NCERT Based Tests
• NEET Sample Paper
• Previous Year Papers
• Quantitative Aptitude
• Numerical Aptitude Data Interpretation
• General Knowledge
• Mathematics
• Agriculture
• Accountancy
• Business Studies
• Political science
• Enviromental Studies
• Mass Media Communication
• Teaching Aptitude
• NAVODAYA VIDYALAYA
• SAINIK SCHOOL (AISSEE)
• Mechanical Engineering
• Electrical Engineering
• Electronics & Communication Engineering
• Civil Engineering
• Computer Science Engineering
• CBSE Board News
• Scholarship Olympiad
• School Admissions
• Entrance Exams
• All Board Updates
• Miscellaneous
• State Wise Books
• Engineering Exam

SHARING IS CARING If our Website helped you a little, then kindly spread our voice using Social Networks. Spread our word to your readers, friends, teachers, students & all those close ones who deserve to know what you know now.

CBSE Class 12th - BIOLOGY : Chapterwise Case Study Question & Solution

CBSE will ask two Case Study Questions in the CBSE class 12 Biology questions paper. Question numbers 15 and 16 are case-based questions where 5 MCQs will be asked based on a paragraph. Each theme will have five questions and students will have a choice to attempt any four of them.

• NCERT Solutions for Class 12 Maths
• NCERT Solutions for Class 10 Maths
• CBSE Syllabus 2023-24
• Social Media Channels
• Login Customize Your Notification Preferences
• CBSE Board 12th History Exam 2024 : Chapterwise Most Important Question with Answers 27 March, 2024, 4:57 pm
• CBSE Board Class 12 Business Studies Answer Key 2024 and Question Papers, Download PDF All SETs 27 March, 2024, 1:05 pm
• CBSE Class 12th Exam 2024: Business Studies Important MCQs & Assertion-Reason Questions 26 March, 2024, 3:39 pm
• CBSE Board Class 12 Political Science Answer Key 2024 and Question Papers, Download PDF All SETs 22 March, 2024, 1:36 pm
• CBSE Class 12th Accountancy Exam 2024 : Most Important Questions for Last Minute Revision; Download PDF 22 March, 2024, 12:58 pm
• CBSE Class 12th Political Science Exam 2024 : Most Important Questions for Last Minute Revision; Download PDF 21 March, 2024, 4:33 pm
• CBSE Class 12 Accountancy Exam 2024 : Chapterwise Important MCQs with Answers; Free PDF Download 20 March, 2024, 5:10 pm
• CBSE Class 12 Political Science Exam 2024 : Chapter-Wise Important MCQs; Free PDF Download 19 March, 2024, 4:33 pm
• CBSE Board Class 12 Biology Answer Key 2024 and Question Papers, Download PDF All SETs 19 March, 2024, 1:15 pm

• Second click on the toggle icon

Provide prime members with unlimited access to all study materials in PDF format.

Allow prime members to attempt MCQ tests multiple times to enhance their learning and understanding.

Provide prime users with access to exclusive PDF study materials that are not available to regular users.

Study says U.S. maternal death rate crisis is really a case of bad data

A new study calls into question the extent of the maternal mortality crisis in the United States, which has long posted a disproportionately high rate of maternal deaths compared with peer nations.

Data classification errors have inflated U.S. maternal death rates for two decades, according to the study , published Wednesday in the American Journal of Obstetrics & Gynecology. Instead of the maternal death rate more than doubling since 2002, it has remained flat, researchers found.

“There has been a lot of alarm and apprehension surrounding the fact that some of these reports show a threefold increase in maternal mortality, and that is not what we found. We found low and stable rates,” said K.S. Joseph, the study’s lead author and professor in the departments of obstetrics and gynecology and the School of Population and Public Health at the University of British Columbia in Vancouver.

A change in the way pregnancy was noted on death certificates 21 years ago to improve the detection of maternal deaths led to “substantial misclassification” and an “overestimation of maternal mortality,” the study found.

In 2003, the National Vital Statistics System added a checkbox to death certificates to note whether the deceased person was pregnant or had recently been pregnant to address concerns that pregnancy-related deaths were being undercounted.

But the box was checked for many deaths that were unrelated to pregnancy or childbirth, researchers found. For example, hundreds of deaths of people 70 or older were mistakenly classified as having been pregnant. Deaths from cancer and other causes also were counted as maternal deaths if the box was checked. As a result, the maternal mortality rates showed a dramatic increase since 2003.

Researchers noted that gaping racial disparities remain — especially between White and Black pregnant people. Black pregnant people die at nearly three times the rate of their White peers because they face higher rates of pregnancy complications such as ectopic pregnancy and eclampsia, as well as chronic diseases such as high blood pressure, heart disease and kidney failure, researchers found.

Some experts say the study’s biggest takeaway is the persistent racial disparities, with many pregnant Black people experiencing more medical complications involving Caesarean sections, postpartum hemorrhaging and preterm births. However the data is calculated, the pattern remains the same, said Colleen Denny, an associate professor in the department of obstetrics and gynecology and director of family planning at NYU Langone Hospital as well as a fellow of the American College of Obstetricians and Gynecologists.

“We should be targeting a lot of our public outreach to focus on conditions that are affecting patients of color while they’re pregnant,” said Denny, who was not involved with the study.

Joseph, whose 2017 paper previously noted the inflated U.S. maternal mortality rates, said: “Many maternal deaths, perhaps more than a half of maternal deaths, are preventable, so we have to initiate programs that address these specific causes of death and prevent them.”

The impetus for the new study was researchers’ confusion over why the U.S. maternal mortality rate was so high compared with other high-income nations, said Cande Ananth, a senior author of the study and chief of epidemiology and biostatistics at Rutgers Robert Wood Johnson Medical School. The authors said U.S. maternal mortality is actually comparable to that of Canada and Britain. Even with the adjusted rate, however, the U.S. rate would remain higher than most peer nations.

The authors decided to ignore the checkbox and count only deaths that listed a cause related to pregnancy.

Under the new criteria, researchers found that the mortality rates were 10.2 per 100,000 live births from 1999 to 2002 and 10.4 from 2018 to 2021. In contrast, the National Vital Statistics System method produced a mortality rate of 9.65 from 1999 to 2002 and 23.6 from 2018 to 2021.

An agency spokesman declined to comment on the new study and instead pointed to its own 2018 report .

In that report, the National Vital Statistics System reviewed several studies that found the pregnancy-and-birth checkbox was being used in error, particularly for people 45 and older. At that time, the agency’s report said that without the checkbox, the rate for maternal mortality would have remained flat since 2002.

To correct for misuse of the checkbox, the agency changed the way it counted deaths. It stopped classifying deaths as pregnancy-related for people over age 44 unless there was a specific cause of death tied to pregnancy or delivery. But for those 44 or younger, the agency continued to classify every death with the box checked as being related to pregnancy or delivery — even if the specific cause of death was unrelated.

Despite the study’s conclusion that use of the checkbox led to excessively high calculations of maternal mortality, the National Vital Statistics System said in its 2018 report that it would continue to calculate rates from the checkbox to avoid undercounting maternal mortality.

Other experts say the new study can be helpful to expand the ways public health initiatives are targeted to yield better outcomes.

This is an opportunity to rethink how the nation tracks maternal health outcomes and create a better system to help identify problems and interventions, said Chiamaka Onwuzurike, medical director of the gynecology clinic at Brigham and Women’s Hospital and an instructor at Harvard Medical School who was not involved with the study. “If we keep our blinders up and think that things are working well and our systems are tracking things appropriately, what good does that really do us?”

In 2022, the White House released a blueprint to address the maternal health crisis, outlining federal actions and long-term goals for improvement. But the federal government needs to better track progress toward achieving these goals, according to a February report from the Government Accountability Office .

Examining indirect causes of maternal deaths, including mental health, can lead to policies and interventions aimed at minimizing the instances of non-obstetric causes of death, according to Amita Vyas, a professor in the department of prevention and community health and director of George Washington University’s Center of Excellence in Maternal and Child Health.

“When we think about maternal deaths, it’s not just in pregnancy or during childbirth,” Vyas said. “We lose the ability to design lifesaving interventions if we disregard other indirect pregnancy-related factors in the postpartum period.”

Supreme Court skeptical of case to restrict abortion pill mifepristone: Live updates

W ASHINGTON − Supreme Court justices on Tuesday sounded skeptical that anti-abortion doctors have the ability to challenge the Food and Drug Administration’s rules for a common abortion drug, raising the possibility that the court could dismiss a case that threatened to sharply limit access to mifepristone .

Justices on both sides of the court's ideological divide pressed lawyers for anti-abortion doctors for evidence that physicians had been forced to violate their conscience by treating a patient suffering from mifepristone side effects, and they questioned the nationwide sweep of lower court orders restricting use of the drug.

Justice Neil Gorsuch said the case “seems like a prime example of turning what could be a small lawsuit into a nationwide legislative assembly on an FDA rule or any other federal government action.”

Start the day smarter. Get all the news you need in your inbox each morning.

Two years after overturning Roe v. Wade , the justices were asked to consider whether to rollback FDA decisions loosening restrictions on how mifepristone can be prescribed and dispensed. The drug was used in nearly two-thirds of U.S. abortions last year.

More: What does the mifepristone case mean for Plan B? The difference between the two explained.

The doctors challenging the drug said the FDA didn’t follow its own protocols and ignored contrary data when, in 2016 and 2020, it loosened the rules on who can prescribe mifepristone and how it can be dispensed. They said the FDA's changes created a “substantial risk” they would be forced treat women suffering emergency complications from the drug, which would violate their personal ethics.

Much of the nearly two hours of oral arguments focused on that issue, rather than on whether the FDA properly relaxed restrictions after the drug had been available for more than two decades. 

The court's decision, expected by the end of June, will land smack in the middle of an election year.

Follow along for live updates.

'Callous disregard versus an 'extensive body of evidence'

Speaking to reporters from the steps of the Supreme Court, Erin Hawley, representing the anti-abortion doctors behind the case, addressed what she called the FDA’s “callous disregard” by approving the postal delivery of mifepristone to patients.

“Women deserve better,” Hawley said, adding that regardless of one’s position, “we should all agree women’s health matters.”

Jessica Ellsworth, a lawyer for Danco Laboratories, makers of mifepristone, argued that because the doctors had not been harmed by the abortion drug, and that they had failed to prove they have standing to sue.

“The fact is they don’t,” Ellsworth said.

Ellsworth added that the FDA had approved mifepristone decades ago with “extensive body of evidence and well within its authority and in accordance with the law.”

--Savannah Kuchar

More: How the Supreme Court case on the abortion drug mifepristone could affect 2024 election

Justices question sweep of lower court judgements

Justices Amy Coney Barrett, Brett Kavanaugh and Neil Gorsuch − all appointees of former President Donald Trump − probed whether the doctors’ objections to medication abortions could be solved by anti-abortion doctors asserting a conscience objection to certain treatments, rather than a sweeping judgment affecting nationwide access.

“We say over and over again: Provide a remedy sufficient to address the plaintiff’s asserted injuries and go no further,” Gorsuch said. “We have before us a handful of doctors who have asserted a conscience objection.”

Erin M. Hawley, the attorney for the anti-abortion doctors, said the existing conscience objection is not good enough because doctors may not have time in an emergency situation to raise one.

But justices repeatedly asked for evidence that any doctor had ever been in those circumstances.

“Can you point me to any place in the declarations where a declarant states that they attempted to object, but were unable to?” asked Justice Ketanji Brown Jackson.

Hawley replied that she couldn't provide evidence because doctors don't always know the events that preceded an emergency before they reach the emergency room.

Chief Justice John Roberts asked why the case couldn’t be limited to the people involved in one region, rather than blocking the FDA from allowing the drug everywhere.

“I think it might be impracticable,” Hawley said, because the FDA regulation would remain in place “and permit things like mail-order abortions.”

More: Welcome to Bristol, where America’s abortion debate is right on your doorstep

'Profound mismatch': Biden administration lawyer decries sweeping abortion ruling

Solicitor General Elizabeth Prelogar closed her argument by denouncing what she called a “profound mismatch” between the remote harm the FDA opponents say they have suffered or could suffer, and the sweeping ruling from a lower court to restrict access to mifepristone.

“What is so telling,” Prelogar told the justices, is that FDA opponents can’t point to a single specific doctor who has ever had to violate their conscience by providing care to a woman suffering a serious health issue as a result of taking mifepristone under the FDA’s regulations.

It’s worth stepping back and thinking about “the profound mismatch” between the opponents’ theory of the injury that gives them the ability to sue − and the remedy they got from the lower court, Prelogar said.

What the lower court did to guard against the very remote risk to the FDA’s opponents is issue a sweeping, nationwide ruling that “restricts access to mifepristone for every single woman in this country," Prelogar said.

--Aysha Bagchi

More: VP Kamala Harris broke politics at an abortion clinic visit. She even said the 'u' word

The  Supreme Court has considered mifepristone before

This isn’t the first time mifepristone has become before the Supreme Court.

In April 2023, the court in an emergency ruling allowed full access to the drug while the underlying lawsuit continues. That happened over the objections of Justices Clarence Thomas and Samuel Alito, who would have allowed the rollback sought by anti-abortion groups to take effect.

In January 2021, the court sided 6-3 with the outgoing Trump administration in requiring women visit in person a doctor’s office, hospital or clinic to receive mifepristone.

That requirement had been challenged by the American College of Obstetricians and Gynecologists and other groups. Because of the risk of going to medical facilities during the pandemic, the administration had suspended similar requirements for other drugs, but not for mifepristone.

Months after President Joe Biden took office, the FDA said it would not enforce the in-person requirement.

--Maureen Groppe

More SCOTUS: 'Cancel culture': Supreme Court rejects case on dust-up between Catholic student and Native American

Studies used to attack mifepristone have been retracted

Two of the three studies a Texas federal judge cited in ruling last year that the FDA ignored the safety risks of mifepristone have been retracted by the medical journal that published them.

The publisher said a post-publication peer review found problems with the study design, methodology and data analysis.

The studies’ lead author called the retraction a “baseless attack.”

More SCOTUS: Supreme Court lets stand a ban against Cowboys for Trump co-founder using 14th Amendment

Rabbi says abortion access is a Jewish value

Amelia Wolf, a 32-year-old rabbi from Arlington, Virginia, traveled to the Supreme Court on Tuesday morning to advocate for the protection of what she sees as an important Jewish value.

“Our religious tradition mandates that, in many cases, abortion is very important for the life, health, and well-being of a pregnant person,” she said. “I am concerned that there's only one religious voice that gets the most hearing on this subject, and I want to offer another one.”

Wolf, who moved to the area recently, was alerted to demonstrations planned at the nation’s highest court by a call from the National Council for Jewish Women.

Wolf said she fears the effects of a ruling that further restricts abortion access. “I know that many people of different genders need abortions, but I think this is being used as a tool to control women's bodies, and that really frightens me,” she said.

“If it's overwhelmingly a women's issue, then I think they should listen to the overwhelming majority of women in this country.”

--Cybele Mayes-Osterman

More SCOTUS: Supreme Court says Trump White House official Peter Navarro must begin prison sentence

Doctors opposed to mifepristone contend risks of ER visits rises with online prescriptions

Justices Elena Kagan and Amy Coney Barrett asked how the Food and Drug Administration’s change in 2021, when the agency warned that without in-person visits to get a prescription for mifepristone, medical care such as emergency room visits or surgery are likely to increase.

Erin Hawley, representing doctors opposed to mifepristone, said in-person visits are the best way to examine a woman for an ectopic pregnancy or to gauge the gestational age of the fetus. She said the FDA’s current policy allows prescribing mifepristone online with a couple of screening questions.

“I don’t think that’s nearly as good as an in-person exam,” Hawley said.

But Barrett cited the government’s lawyer, Solicitor General Elizabeth Prelogar, saying the initial doctor’s visit doesn’t require an ultrasound or a test to detect a fetal heartbeat, so it wouldn’t necessarily reveal an ectopic pregnancy or fetal heartbeat.

Hawley cited FDA statistics showing the risk of ER visits nearly tripled from 2.1% with an in-person visit to 5.8% without.

“These are the same surgical interventions that harm” doctors who brought the lawsuit, Hawley said.

--Bart Jansen

Drug industry warns of dire consequences

Danco Laboratories, the maker of mifepristone, joined the federal government in fighting the challenge to the drug, with the pharmaceutical industry standing behind it.

PhRMA., the major trade group for drug companies, told the court the case threatens to “jeopardize the settled regulatory framework that facilitates the development of life-saving medicines.”

If the lower court’s ruling is upheld, PhRMA told the court, every drug approval could face a substantial risk of litigation, making the process more expensive − reducing drug makers’ incentive to produce new medicines.

The group called the FDA’s science-based evaluations the “bedrock” of the nation’s drug approval process.

If the Supreme Court agrees with the challengers that the FDA’s process was flawed, it would be an exceptional break from the deference federal courts traditionally give the FDA, according to Steven Schwinn, a professor at the University of Illinois Chicago School of Law, who previewed the case for the American Bar Association.

Thomas questions one basis for suing FDA

Justice Clarence Thomas questioned one argument brought by the mifepristone opponents for how they are injured and therefore have standing to sue. The argument is that an organization that is suing can be injured because it had to divert resources as a result of the FDA’s actions.

“Isn’t that just the cost of pursuing litigation?” Thomas asked Erin Hawley, who represents the doctors and groups challenging the FDA’s decisions. 

Thomas suggested that allowing a plaintiff to sue in such circumstances could widen the door to more lawsuits than the courts currently allow. 

“That would be anyone who is aggressive or vigilant about bringing lawsuits, just simply by using resources to advocate their position in court — you say now — causes an injury. That seems easily, easy to manufacture,” Thomas said.

“I don't think that's true in this case, Justice Thomas,” Hawley responded.

Hawley said FDA opponents did significant work that wasn’t related to litigation and wasn’t a prelude to litigation, including combing through data and thinking about the true nature of adverse events as a result of the FDA’s decisions.

Justices question district courts making decisions for entire country

Chief Justice John Roberts and Justice Neil Gorsuch raised concerns, as they have in other cases, about district courts issuing judgments that cover the entire country, as happened in the mifepristone case, rather than just their own geographic jurisdictions.

Roberts asked why the case couldn’t be limited to the people involved in one region, rather than blocking the FDA from allowing the drug everywhere.

Gorsuch said there zero nationwide injunctions during the 12 years of Franklin Delano Roosevelt’s administration compared to 60 in about the last four years.

“They’re a relatively new thing,” Gorsuch said. “You’re asking us to extend and pursue this relatively new remedial course, which this court has never adopted itself. Lower courts have kind of run with this.”

Hawley argued that nationwide remedies are often needed to so that everyone is treated the same. She argued it wouldn’t be equitable to have some people denied the medication while the FDA allowed it for others.

“That’s inconsistent with equity,” Hawley said.

Are conscience protections enough?

Erin M. Hawley, the attorney for the anti-abortion doctors challenging mifepristone, was pressed on why the doctors can’t avoid the drug by raising a conscience objection.

Justice Ketanjj Brown Jackson said that exemption already exists, but the doctors are now trying to prevent others from gaining access to medication abortion.  Why isn’t that an overly broad remedy, she asked.

Hawley said doctors can’t always raise a conscience objection because they may not know until they scrub in for an emergency whether the situation is a miscarriage, an ectopic pregnancy or an elective abortion.

“These are life-threatening situations,” she said.

Justice Elena Kagan asserted that most hospitals have mechanisms to ensure that doctors can assert conscience protections.

Alito questions company’s profit motive in trying to avoid restrictions on mifepristone

Because Justice Samuel Alito asked whether Danco Laboratories, the company that manufactures mifepristone, aimed to make more money if the court’s restriction on the FDA were lifted. He also asked whether the FDA has ever pulled a drug because of adverse results on patients.

“You will be harmed because you’re going to sell more,” Alito said. “Do you think the FDA is infallible?”

Jessica Ellsworth, a lawyer for Danco, said drugs have certainly been withdrawn after approval, which is why manufacturers keep tracking reactions to their products. She said the FDA stopped asking the company to report non-fatal consequence to the drug in 2016, based on 15 years of “a well-established safety profile.”

“You don’t want to sell a product that causes very serious harm to the people who take your product,” Alito said. “Wouldn’t you want that data?”

Ellsworth said the company tracks safety data, with an 800-number on its website and on the drug’s labeling. Ellsworth said Danco is still subject to lawsuits over allegations such as failing to warn about risks of the drug or deceptive advertising.

Ellsworth argued that the arguments in this case were “revolutionary” because people who don’t use the product or prescribe it are trying “to prevent anyone else from using it in line with FDA’s considered scientific judgment.”

How do I watch Supreme Court oral arguments?

Don't expect to see any Supreme Court justices on camera today. You can't watch the proceedings in the Supreme Court, but you can listen to live arguments here.

– Marina Pitofsky

Who is Jessica Ellsworth?

Jessica Ellsworth is an attorney for Danco Laboratories, the maker of mifepristone. She's joining Solicitor General Elizabeth Prelogar is representing the FDA as the court looks into the medication widely referred to as the abortion pill.

– Marina Pitofsky and Maureen Groppe

What is the solicitor general?

The solicitor general is the main lawyer who represents the federal government before the Supreme Court. The solicitor general is sometimes called the "10th justice" on the court, and they lead a team of attorneys who can argue before the court on behalf of the nation's government.

They may also choose whether to appeal lower court rulings if the government is involved in a lawsuit.

Who is Elizabeth Prelogar?

Elizabeth Prelogar is the Solicitor General of the United States. She's answering questions and making arguments today before the Supreme Court in the pivotal case surrounding the FDA's handling of the abortion pill.

But what does the solicitor general do? It's a wide-reaching role, but in general, the Department of Justice explains that they determine "the cases in which Supreme Court review will be sought by the government and the positions the government will take before the Court."

Conservative justices bring up Comstock Act

Two of the court’s most conservative justices – Samuel Alito and Clarence Thomas – raised the issue of whether a 19th-century obscenity law prevents mifepristone from being dispensed through the mail.

Both Solicitor General Elizabeth Prelogar and Jessica Ellsworth, the attorney representing the manufacturer, said the FDA wasn’t required to consider that law.

Ellsworth said the court should think hard about the mischief it would invite if it allows agencies to take action based on statutory authority that Congress assigned to other agencies.

Ellsworth also noted that Comstock Act hasn’t been enforced for nearly 100 years. This case, she said, isn’t an opportunity for the court to opine on it.

Some  abortion opponents are promoting  the Comstock Act as a de facto federal abortion ban that just needs enforcing.

Erin M. Hawley, the attorney for the anti-abortion doctors challenging mifepristone, said the FDA can’t ignore federal law.

‘What the people want’: Abortion rights protestor, father among crowd

Ronald Quirk, 65, came to the Supreme Court Tuesday from nearby Arlington, Virginia with a sign reading “Supreme Tyranny.” The father of a 24-year-old daughter, Quirk said he was protesting because he feels the justices have made women “second class citizens” by overturning Roe v. Wade and considering today’s case.“No U.S. citizen should have rights taken away and that’s what, they did it last year with Dobbs and now they’re trying to do it again. And where’s it going to stop?” Quirk said.Quirk noted that voters in deep red states, including Ohio, have passed state constitutional amendments to enshrine abortion access.“This is what the people want,” he said.

— Savannah Kuchar

Getting rid of in-person dispensing requirement

Justice Amy Coney Barrett asked government lawyer Elizabeth Prelogar about the FDA’s decision to get rid of a requirement for patients to have an in-person meeting in order to be given mifepristone. The FDA got rid of that requirement in 2021, in part based on experiences during the COVID-19 pandemic.

Barrett said it seemed to her, in looking at the data, that the elimination of the in-person visit at the outset would lead to mistakes in gestational aging, which could increase the risks of the medication, including when it comes to the amount of bleeding.

Prelogar said she believed Barrett was operating on a mistaken premise that getting rid of the in-person requirement would necessarily increase the risk of such events. An ultrasound was never required, Prelogar said, and while there has been an increase in emergency room visits, that didn’t correlate with an actual increase in serious adverse events.

Case marks first time federal courts blocked access to FDA-approved drug: DOJ

Justice Elena Kagan called the government’s argument an “arresting statement” that the case marked the first time federal courts have blocked the use of a drug approved by the Food and Drug Administration.

“To the government’s knowledge, this case marks the first time – and I’m going to say, ‘Is it the first time, is it the only time?’ – any court has restricted access to an FDA approved drug by second-guessing FDA’s expert judgment about the conditions required to assure that drug’s safe use,” Kagan read from the government’s written argument. “Is it still the only time?”

Solicitor General Elizabeth Prelogar said it was still true. She argued the courts have no business second-guessing FDA experts about which drugs are safe.

“That is still to our knowledge the only time a court has done that,” Prelogar said. “We have seen a disturbing trend of courts sometimes also overriding FDA’s judgment to grant greater access to drugs.”

Reasons for increase in ER visits probed

Questioned about an increase in emergency room visits after mifepristone was allowed to be dispensed through the mail, Solicitor General Elizabeth Prelogar said that increase wasn’t because of a troublesome uptick in complications. Many women might go to the ER because they have questions about heavy bleeding, for example, but didn’t need treatment.

In one study, she said, half of the women who went didn’t get any treatment.

Justice Sonya Sotomayor tried to drive that message home. Whatever the statistical increase in ER visits, she asked, the FDA determined the data didn’t show a significant increase in risk?

Prelogar said that’s correct.

What is the Comstock Act?

The first judge to hear this case said a 19th-century obscenity law called the Comstock Act prevents the mailing of abortion drugs.

The long-dormant law prohibits mailing " lewd or lascivious " material, as well as anything that could be used to cause an abortion.

While the appeals court did not rely on that law in ruling that the FDA went too far, anti-abortion advocates have  raised it in their filings  to the Supreme Court.

Any decision by the court that revives the Comstock Act could pave the way toward a national abortion ban.

How did the abortion pill case wind up at the Supreme Court?

Last April, U.S. District Judge Matthew Kacsmaryk in Texas effectively  invalidated the FDA's 23-year-old approval for the drug .

After the Biden administration and the manufacturer appealed that decision, the New Orleans-based 5th U.S. Circuit Court of Appeals panel waved off part of the lawsuit that challenged the FDA's underlying approval of the drug, ruling that it was likely barred by the statute of limitations.

But the three-judge panel affirmed Kacsmaryk's ruling that the FDA was wrong for approving changes in 2016 and 2021 that let women take the drug three weeks longer into a pregnancy and allowed the drugs to be dispensed through the mail without in-person visits with a doctor.

“In loosening mifepristone’s safety restrictions, FDA failed to address several important concerns about whether the drug would be safe for the women who use it," the court wrote. “It failed to gather evidence that affirmatively showed that mifepristone could be used safely without being prescribed and dispensed in person."

The case marks the first time a court has restricted access to an FDA-approved drug by second-guessing the agency’s expert judgement, according to the Biden administration.

Dividing line: Welcome to Bristol, where America’s abortion debate is right on your doorstep

What is mifepristone? How does mifepristone work in the body?

Mifepristone is one of two drugs used for medication abortion in the United States. The other is misoprostol, which is also used to treat other medical conditions. The pills are taken about two days apart.  

Mifepristone blocks a hormone needed for pregnancies to progress. Misoprostol causes the cervix to dilate and the uterus to contract, emptying the embryo.

Originally considered safe for use through seven weeks of a pregnancy, the FDA said in 2016 mifepristone could be used through ten weeks. That’s one of the decisions anti-abortion groups have asked the Supreme Court to rollback.

More: SCOTUS to hear arguments about mifepristone. The impact could go far beyond abortion, experts say

Who can sue FDA over mifepristone?

The first question out of the gate cut to the heart of the government’s argument against the case: Justice Clarence Thomas asked who is eligible to sue to block the Food and Drug Administration from allowing the use of mifepristone?

Solicitor General Elizabeth Prelogar argued that two doctors in the case don’t have standing because they don’t prescribe the drug and wouldn’t have to treat the rare women who have an emergency reaction to the drug. She said the doctors rely on a long chain of remote possibilities.

“The court should say so and put an end to this case,” Prelogar said.

But Thomas asked if the justices agreed with her, who could sue?

“If we agree with you on standing, could you give us an example of who would have standing to challenge these FDA regulations?” Thomas asked.

Prelogar said it’s possible a competing drug manufacturer could complain. But she argued the court should block doctors from second-guessing the FDA, so she couldn’t imagine anyone should be allowed to sue just for their opposition to abortion.

“The answer to that is no, but the reason is because those people aren’t regulated in any relevant way under FDA’s decisions here,” Prelogar said.

Chief Justice John Roberts asked how many potential adverse reactions to the drug it would take for her to change her mind or how many doctors who did work in emergency rooms treating the patients.

“It’s hard for me to imagine it could,” Prelogar said.

‘The American people have no remedy’: Alito questions DOJ position

Justice Samuel Alito questioned U.S. Solicitor General Elizabeth Prelogar about whether anyone would have standing to sue to get a judicial ruling on whether what the FDA did was lawful. The Constitution requires that every plaintiff who brings a lawsuit has standing, meaning they have to demonstrate a certain type of injury they have experienced or could experience.

Prelogar said it’s “hard to identify anyone" who would have the proper type of injury to sue over the FDA’s actions in the case on mifepristone, but the Supreme Court has said “time and again” that the Constitution requires standing even if that means no one can sue.

Alito pushed back on her claim, asking Prelogar to imagine if the FDA “flagrantly violated the law” and endangered the health of women. “The American people have no remedy for that,” he said, characterizing her position.

Prelogar said the FDA takes its responsibility to ensure safety very seriously and can make adjustments to its regulations based on its ongoing surveillance.

Not the only abortion case before the court

Today’s challenge to mifepristone is not the only abortion case the Supreme Court is deciding this term.

In April, the  Supreme Court will review  whether federal law requires doctors in emergency rooms to perform abortions when needed to treat an emergency medical condition, even if doing so might violate a state’s abortion restrictions.

In January, the court allowed Idaho to  enforce its strict abortion ban in emergency rooms  for now, rebuffing a Biden administration effort to ensure additional access to the procedure in red-state hospitals.

Dig deeper: What is mifepristone? Judge suspends FDA approval of abortion pill

An all-female lineup of lawyers before the court

All three of the lawyers arguing the medication abortion case before the court today are female.

Solicitor General Elizabeth Prelogar is representing the FDA.

She’s joined in the defense by Jessica Ellsworth, an attorney for Danco Laboratories, the maker of mifepristone.

Erin Hawley, senior counsel with Alliance Defending Freedom, is representing the anti-abortion doctors and groups challenging the FDA’s decisions.

Hawley is married to Sen. Josh, Hawley, R-Mo., both of whom clerked for Chief Justice John Roberts.

-- Maureen Groppe

Women’s March protestors arrested in front of Court

Capitol police arrested almost a dozen members of the Women’s March protest, including the group’s executive director Rachel O’Leary Carmona, for civil disobedience Tuesday,

The protestors stood on Constitution Ave and First St NE, a block from the Supreme Court, demonstrating in support of abortion rights ahead of the justices hearing oral arguments. — Savannah Kuchar

Conflict escalates between demonstrators outside Supreme Court

Conflict erupted between demonstrators chanting conflicting messages outside the court on Tuesday morning.“Shame on you for what you do,” one protester, holding a sign reading, “Anti-racist, anti-capitalist, anti-fascist, anti-abortion pills” shouted at a pro-choice demonstrator holding white plastic coat hangers stained with red paint.“This girl says I’m an incubator,” said one woman with “Fully Human” written across her stomach, pointing at the woman holding the coat hangers.A group of demonstrators shouting “abortion is healthcare” joined the group, attempting to drown out the opposing crowd.

-- Cybele Mayes-Osterman

Protestor says John Roberts as killing the Constitution; another sign says Brett Kavanaugh is 'sexiest man alive'

The group of anti-abortion doctors who are challenging mifepristone made their case to protestors before arguments began.

“When the FDA decided to roll back recklessly every single safety protocol for women before they got the abortion drug, they didn’t speak to the women who would become the living victims of abortion,” said Chelsey Youman, National Director of Public Policy for a group called the Human Coalitions.

Catherine Glenn Foster, former president and CEO of Americans United for Life, said she had felt alone when she visited an abortion clinic years ago, after she learned she was pregnant as a 19-year-old sophomore at a Christian university.

“As I get ready to go into the courtroom, I have one clear message for you. We are not alone,” she said.

A line of demonstrators wearing white doctors’ coats holding signs reading, “Women deserve safe medical care” and, “FDA: Put Women First” stood close to the stage, cheering for the speakers.As the speeches continued, a line of pro-choice demonstrators filed in front of the group, blocking it off from the street. They held mock magazine covers with pictures of the Supreme Court justices - one depicting Chief Justice John Roberts read, “John Roberts: The Man Who Presided Over the Death of the Constitution,” while another read, “Brett Kavanaugh: Sexist Man Alive.”

Biden campaign blames Trump for abortion pill challenge before Supreme Court

Ahead of the Supreme Court’s oral arguments, President Joe Biden’s reelection campaign blamed former President Donald Trump for a case that could strip access to abortion pills across the country – and warned he doesn’t want to stop there.

“It would be the biggest step towards Donald Trump's ultimate goal of a nationwide abortion ban since Roe was overturned,” Biden campaign manager Julie Rodriguez Chavez told reporters.

The campaign has worked aggressively to remind Americans that Trump’s three Supreme Court appointments led to the overturning of Roe v. Wade in 2022. More than 20 states have taken action to restrict abortions since the decision.

Trump, the presumptive Republican nominee, has signaled support for a 15-week national abortion ban.

-- Joey Garrison

Texas activist joins D.C. abortion rights protest

Lindsay London came to Washington from Amarillo, Texas, to join the Women’s March in front of the Supreme Court. She said being a part of the movement of hundreds of protestors from around the country is “very invigorating.”

“I’m in awe of how many people are willing to put their bodies on the line to stand up for this,” she said.

London, a nurse, is one of six Amarillo Reproductive Freedom Alliance leaders and has been leading abortion advocacy efforts for months in the town where the case originated.

She said she’s unsure about the Court’s eventual ruling.

“A lot of the decisions that have come down, you know, have been very disappointing,” London said. “It’s very difficult to say what will happen.“

Crowds gather overnight outside the Supreme Court

As the sun set in Washington Monday evening, several hours before the Supreme Court will hear oral arguments on the mifepristone case, around 50 protestors and counter-protestors assembled out front.

While one anti-abortion group held a vigil and an attendee prayed into a microphone, abortion advocates chanted back "abortion is healthcare" into their own megaphones. Nearby, others held signs referencing the Comstock Act, the nineteenth century obscenity law at the center of many abortion opponents' arguments.

And around the corner, a line of near twenty people formed, with those camping out for a spot in the courtroom audience Tuesday.

-- Savannah Kuchar

'We are the pro-life generation and we will abolish abortion'

Abortion advocates and opponents faced off in front of the Supreme Court early Tuesday morning.

Mark Lee Dickson, a Texas pastor and leader of a local anti-abortion ordinance movement, stood trying to block photos of Aid Access members, an organization supporting the access of mifepristone by mail.Nearby, calls by one protestor that “Abortion is healthcare, abortion is essential,” went against chants by Students for Life members saying, “We are the pro-life generation, and we will abolish abortion.” — Savannah Kuchar

How common are medication abortions?

More than 6 in 10 abortions in the United States last year were completed with pills,  according to the Guttmacher Institute , a research group that supports abortion rights.

That’s up from just over 5 in 10 abortions in 2020.

The FDA’s 2021 decision that mifepristone could be mailed directly to patients – one of the actions being challenged by abortion opponents − expanded access to medication abortion.

Access was further expanded in 2023 when the FDA set up a process for more pharmacies to dispense mifepristone.

Two of the nation’s largest retail pharmacies, CVS and Walgreens, announced this month they will carry the drug.

'Abolished from coast to coast' Anti-abortion movement looks to cities as target for bans

This article originally appeared on USA TODAY: Supreme Court skeptical of case to restrict abortion pill mifepristone: Live updates

• New QB365-SLMS
• NEET Materials
• JEE Materials
• Banking first yr Materials
• TNPSC Materials
• DIPLOMA COURSE Materials
• 5th Standard Materials
• 12th Standard Materials
• 11th Standard Materials
• 10th Standard Materials
• 9th Standard Materials
• 8th Standard Materials
• 7th Standard Materials
• 6th Standard Materials
• 12th Standard CBSE Materials
• 11th Standard CBSE Materials
• 10th Standard CBSE Materials
• 9th Standard CBSE Materials
• 8th Standard CBSE Materials
• 7th Standard CBSE Materials
• 6th Standard CBSE Materials
• Tamilnadu Stateboard
• Scholarship Exams
• Scholarships

CBSE 12th Standard Biology Subject Biotechnology: Principles and Processes Case Study Questions 2021

By QB365 on 21 May, 2021

QB365 Provides the updated CASE Study Questions for Class 12 Biology, and also provide the detail solution for each and every case study questions . Case study questions are latest updated question pattern from NCERT, QB365 will helps to get  more marks in Exams

QB365 - Question Bank Software

12th Standard CBSE

Final Semester - June 2015

Case Study Questions

(a) Name and write the significance of enzyme X. (b) Name and write the role of enzyme Y. (c) Name the processes A and B.

*****************************************

Cbse 12th standard biology subject biotechnology: principles and processes case study questions 2021 answer keys.

(a) Recombinant DN Atechnology/Genetic engineering. (b) 1. Isolation of the desired segment of DNA. 2. Ligation of the isolated DNA to a plasmid vector. 3. Introduction of rDNA into the bacterial cell. 4. The bacterium produces the gene product. (c) Human insulin is produced by transgenic Escherichia coli cells.

(a) Restriction endonuclease - the same restriction enzyme cuts the foreign DNA and vector/plasmid DNA. (b) DNA ligase joins the foreign DNA segment to the plasmid. (c) A is transformation. B is cell division or clone formation.

(a) It is called a palindromic sequence. (b) The overhanging chains, called 'sticky ends' facilitate the action of DNA ligase. (c) EcoRI.

(i) a–Vector DNA  b–Foreign DNA  (ii) 5' — GAATTC — 3'  3' — CTTAAG — 5'  (iii) DNA ligase

(a) It depicts agarose gel electrophoresis used for separation of DNA fragments. (b) The 'largest' and 'smallest' mean the DNA fragments oflarge size and small size, respectively. (c) Ethidium bromide. (d) Elution is the process in which the separated bands of DNA are cut out from the gel and extracted.

Related 12th Standard CBSE Biology Materials

12th standard cbse syllabus & materials, cbse 12th physics wave optics chapter case study question with answers, cbse 12th physics ray optics and optical instruments chapter case study question with answers, cbse 12th physics nuclei chapter case study question with answers, cbse 12th physics moving charges and magnetism chapter case study question with answers, cbse 12th physics electromagnetic induction chapter case study question with answers, cbse 12th physics atoms chapter case study question with answers, 12th physics alternating current chapter case study question with answers cbse, 12th maths vector algebra chapter case study question with answers cbse, 12th maths three dimensional geometry chapter case study question with answers cbse, 12th maths probability chapter case study question with answers cbse, 12th maths linear programming chapter case study question with answers cbse, 12th maths differential equations chapter case study question with answers cbse, 12th maths continuity and differentiability chapter case study question with answers cbse, 12th maths application of integrals chapter case study question with answers cbse, 12th chemistry the d and f block elements chapter case study question with answers cbse.

Class VI to XII

Tn state board / cbse, 3000+ q&a's per subject, score high marks.

12th Standard CBSE Study Materials

12th Standard CBSE Subjects