solve my homework

StudyMonkey

Your personal ai tutor.

Learn Smarter, Not Harder with AI

Introducing StudyMonkey, your AI-powered tutor .

StudyMonkey AI can tutor complex homework questions, enhance your essay writing and assess your work—all in seconds.

No more long all-nighters

24/7 solutions to questions you're stumped on and essays you procrastinated on.

No more stress and anxiety

Get all your assignments done with helpful answers in 10 seconds or less.

No more asking friends for help

StudyMonkey is your new smart bestie that will never ghost you.

No more staying after school

AI tutoring is available 24/7, on-demand when you need it most.

AI Tutor for any subject

American college testing (act), anthropology, advanced placement exams (ap exams), arabic language, archaeology, biochemistry, chartered financial analyst (cfa) exam, communications, computer science, certified public accountant (cpa) exam, cultural studies, cyber security, dental admission test (dat), discrete mathematics, earth science, elementary school, entrepreneurship, environmental science, farsi (persian) language, fundamentals of engineering (fe) exam, gender studies, graduate management admission test (gmat), graduate record examination (gre), greek language, hebrew language, high school entrance exam, high school, human geography, human resources, international english language testing system (ielts), information technology, international relations, independent school entrance exam (isee), linear algebra, linguistics, law school admission test (lsat), machine learning, master's degree, medical college admission test (mcat), meteorology, microbiology, middle school, national council licensure examination (nclex), national merit scholarship qualifying test (nmsqt), number theory, organic chemistry, project management professional (pmp), political science, portuguese language, probability, project management, preliminary sat (psat), public policy, public relations, russian language, scholastic assessment test (sat), social sciences, secondary school admission test (ssat), sustainability, swahili language, test of english as a foreign language (toefl), trigonometry, turkish language, united states medical licensing examination (usmle), web development, step-by-step guidance 24/7.

Receive step-by-step guidance & homework help for any homework problem & any subject 24/7

Ask any question

StudyMonkey supports every subject and every level of education from 1st grade to masters level.

Get an answer

StudyMonkey will give you an answer in seconds—multiple choice questions, short answers, and even an essays are supported!

Review your history

See your past questions and answers so you can review for tests and improve your grades.

It's not cheating...

You're just learning smarter than everyone else

How Can StudyMonkey Help You?

Hear from our happy students.

"The AI tutor is available 24/7, making it a convenient and accessible resource for students who need help with their homework at any time."

"Overall, StudyMonkey is an excellent tool for students looking to improve their understanding of homework topics and boost their academic success."

Upgrade to StudyMonkey Premium!

Why not upgrade to StudyMonkey Premium and get access to all features?

Need Help with Your Homework ?

Your AI copilot for study

Question Answering & Homework Helper

Go with QuestionAI App, AI Powered Question Answering helper & Summarizer, instantly resolve all kinds of problems, summarize all kinds of texts and help to answer your questions with concise solution. Choice of more than 10 million users. A marvelous homework finisher!

Why Use Question AI Tool?

Our Question AI has unique features and all free, also known as Homework AI.

Snapping & Problem Solving

Just take a picture of your math problems and then get the answers quickly! Wonderful Homework AI copilot.

24-hour AI copilot

24 hours online answer questions and provide u with professional and concise solutions! Question AI is your good AI copilot.

Respond to your needs promptly and quickly. You can also discuss a pdf file or pdf files with your darling Question AI.

No Fear textbooks. Show you authoritative textbook solutions in all subjects with a clear and understandable way.

1. Can Question AI handle complex or technical language?

Yes, it can. The AI has been trained on a big dataset, so technical or complex data won’t be a problem. Question AI can handle any academic or technical langauge.

2. Can Question AI be used on mobile devices, or is it only available on desktop?

Question AI is accessible on both desktop and mobile. Question AI supports Windows and Mac systems as well as IOS and Android.

3. How fast Question AI generate an answer?

Within seconds. Never doubt Question AI's speed.

4. How many questions can Question AI tool handle at once?

There’s no limit. Question AI can handle several questions at the same time.

5. Can Question AI make several versions of the Same text, each with a different level of detail?

Question AI can give you a longer or shorter text, depending on your wishes.

• Fiii blank question portion electromagnetic spectrum
• Concept language ratios ratio comparison two numbers
• Sample ar gas volume 460l unknown pressure gas volume
• 19 promotes growth red algae low salinity water b high
• Occurs water contains excess nutrients excess plant
• Jackle 51261 savings account interest rate 5 per year
• First box acceleration double acceleration second box
• Following elements liquid room temperature n b b c br d
• S9 area circumference circles zdx radius circle 7 feet
• Select one classical pathway requires antibodies
• Four nucleotides make dna molecule purines pyrimidines
• Plot based percentiles seeks verify normality assumption
• Select best answer animals organisms autotrophic
• Endorphins released person feels toxic stress true false
• Content grupo 8vo jaden identifica de la siguiente lista
• Content museum thirty five thousand objects placed oth
• Contentahort story foreshadowing
• Content sa iyong palagay pagaralan ang akdang florante
• Suppose owe 500 credit card decide make no new purchases
• Crew working dynamite clear road blasted large rock
• Business management functions understand
• Line includes points 78 82 equation pointslope form use
• Two balloons balloon balloon b greater volume balloon 8
• Wire length 28 pi meters bent form circle radius circle
• Next question get similar question c ln a2ln b3 ln c5
• Veasts make energy process called fermentation 5 points
• Button miguels shirt radius 4 millimeters buttons area
• Se pregunt los estudiantes cuntos pares de zapatos tenan
• Sum interior angles pentagon 540 360 180 270
• Given points ab c find abbc ac ab c collinear point lies
• Question 14 factor polynomial drag expressions box part
• Two major reasons people immigrate violence persecution
• Question statements permits correct permits cancelled
• Select correct answer use dramatic irony works
• Expression sqrt140 without perfect square factor
• Evaluate expression 113xx34 write answer fraction whole
• Complete square fill number makes polynomial
• Content bn write structural formula followingn
• Contentgive reflection performing erobix exercise two
• Contentwhat materials
• Contentresearch
• Contentcontoh penguasaan tingkat tertingi
• Contentdare live life dreamed go forward make dreams
• Contentcerpen kekasih yang menghilang
• Contentsa iyong palagayang mga gusalu ba ay simbolo ng
• Unit fraction whole number 136
• Tor amp gures ae0
• Complete statements drop 1 points graphed drop 2 points
• Promoter 5 aatcgaigigggtcgaatggagatctaagtaacttaga 3
• Write 7811 improper fraction submit
• Piece silver weighing 15kg cooled near molten
• Public health nurse partnering local organization
• Find x intercept y intercept line 3x6y12 xintercept 4
• Complementary angles practice complete assessment review
• Expression equivalent 56r49r 3r20 20 r21 6r459r 21 r4
• Solve system substitution y8x6y2x answer attempt 1 2
• Form 2b264b7b25b3 x3x2342 36224 42x1 b 362
• Evaluate following formula v4pir33 pi314r1711m
• Questions 2122 refer following information number units
• Exponents expandcondense monomial base scorel 320
• List shows correct order importing xml data excel
• Following chronic complication diabetes melli deafness
• Types metals used conductors common type used automotive
• Short response 4 difference nonrenewable renewable
• B create dot plot using 18 inches c location received
• Contentgenera un guion para un podcast de futbol
• Match correct answers blank heart two upper chambers
• Evaluation temperature increases pressure temperature
• Content attribution question find linear approximation
• Argues background characteristics top management team
• Temperature 112l sample carbon monoxide co 744 torr
• Convert following equations x2y225 polar b y3x2 polar c
• Relationship marginal revenue product mrp demand curve
• Closely rebuted
• Multiple select question select apply following
• Example 2 college archaeology class 28 ttudents going e
• Scare 310 penalty 1 oft question watch video show
• Following solutions equation check apply 3x5219 xsqrt143
• Roblem watch vide current time 75 iation equivalent
• Francesca drawing picture electromagnetic spectrum needs
• 3 many moles carbon dioxide co2 gas 20l vessel
• Multiple select question select apply select following
• Quations solve equation using quadratic formula x212 x52
• Solve x x26x90 one solution separate commas no solution
• Solve c 2c124c submit
• Brightline spectrum element produced excitedstate
• Steps completing square move constant find 12 b square
• Find equation set simultaneous equation 3a2b8a3b254
• Question 20 20 following one rules strength training

AI Homework Help by TutorEva

Free ai homework solver, from homework help to exam prep, eva's got you all covered.

Upload PDF or Images here to solve

From homework help to exam prep ,

Eva’s got you all covered, ai coursemate.

AI Problem Solver

Textbook Answers Online

Knowledge agent system—kas:, powered by gpt4, more than just gpt4, with gpt using knowledge agents, eva is more like an expert-gpt mastering all university subjects, ensuring more reliable and precise outcomes, coupled with more vivid and personalized explanations and guidance..

Animated and interactive AI tutoring,

The study partner that outshines any chatbot, as you dive deeper into your courses, eva helps you excel everywhere with colourful illustrations and explanations on her virtual whiteboard, surpassing any real-life instructors..

Instant solutions for all subjects

Answers & step-by-step solutions, unlock the path to understanding with detailed, guided explanations for every question., chat with eva to get 24/7 support, feel free to ask any questions to eva, whenever you encounter any difficulty in the learning process..

Top AI CourseMate to assist your course studies

Our al coursemate, with methods from your textbooks and slides, will take you through every topic, challenging assignment, and difficult points., this is eva, one of the best classmates at doing homework and preparing for exams..

Struggling with a homework document?

Upload it to doclearn, tired of scanning questions one by one, just upload your homework document and get all the answers, solutions, and explanations quickly. feel free to ask eva any document-related questions..

Got a pile of textbook homework?

Find quick solutions here, no need to flip through answers or scan questions one by one anymore., experience speedy, one-stop access to textbook solutions and step-by-step explanations for popular textbook questions, all verified by experts..

Having trouble with online study?

Try tutoreva extension now, tutoreva extension allows you to crop and solve any questions popped up on your screen, you can also solve every question on your entire website page with one click..

A Simple, Fast, and Intelligent AI Homework Helper

HomeworkAI Is The Ultimate AI Homework Helper You Need

Struggling with piles of homework and tricky assignments? Let HomeworkAI help you out! Our smart AI homework helper delivers detailed, step-by-step solutions, transforming study sessions into smooth sailing.

Covering all subjects, from complex calculus to intricate biology, our homework AI is here to ease the stress and boost your grades. Say hello to effortless learning and wave goodbye to study blues with HomeworkAI!

Get Instant Answers From Our Homework AI

Description: This is how to unlock comprehensive answers and master your studies with our homework AI, in a fast, accurate, and educational fashion.

Upload Your Assignment - Simply upload images, text files, or type your question to get started.

AI Processing - Our advanced AI homework helper will process your assignment and provide detailed, accurate solutions.

Learn & Understand - Review the step-by-step guidance to improve your knowledge and complete your homework with confidence.

Gain Academic Advantages From HomeworkAI's Top Features

Instant Solutions

Quick, clear-cut answers are just a click away with an instant AI homework helper—skip the headache and let our homework AI do the heavy lifting for you.

Maximum Accuracy

Count on Homework AI for spot-on answers. Our advanced AI algorithm digs deep into a vast knowledge base to ensure you get the most accurate solutions every time.

Around-the-Clock Help

Day or night, our homework AI is at your beck and call, ready to dismantle any academic obstacle you encounter, so learning never has to pause for a break.

Comprehensive Support

Whatever the subject, our intelligent AI homework helper has you covered. Get expert help from algebra equations to zoological classifications with ease.

Easy to Use

Enjoy a super user-friendly platform with our homework AI, tailored to empower students and academic professionals at every level to navigate through assignments with confidence.

Our Homework AI Can Help You With All Subjects !

Turn to HomeworkAI for tailored homework and assignment assistance in every subject of your choice.

Mathematics

Solve complex equations and tackle calculus challenges with our AI-powered homework helper that turns numbers into knowledge.

From cellular structures to ecosystem dynamics, easily manage your biology assignments with clear, detailed explanations.

Balance chemical equations and understand reaction mechanisms with a quick online problem solver that simplifies the periodic table.

Analyze literary themes and decipher figurative language with insights that breathe new life into classic texts.

Connect historical dots with ease, as HomeworkAI helps you interpret events and understand their lasting impacts.

Discover Success Stories with Our Homework AI

Ever since using HomeworkAI for my math homework, studying has been way less stressful, and I can say that I'm enjoying math now. My grades are up and I actually get the hang of algebra now!

- Priya K., University Sophomore

I was dreading chemistry all semester, but HomeworkAI totally turned that around. I'm now breaking down reactions and acing quizzes with confidence. The step-by-step solutions it provides are a lifesaver for someone like me! Totally recommended. 

- Marcus D., High School Junior

HomeworkAI made sense of all those crazy bio terms I could never remember. HomeworkAI’s explanations have made it manageable. My test scores are also much better, and I'm not a bundle of nerves anymore!

- Lina J., College Freshman

No more panicking over biology assignments with this AI homework helper!! Nailed my biology midterm, all thanks to HomeworkAI! It's like having a tutor in my pocket, ready to help with homework anytime, day or night.

- Carlos M., High School Senior

Why HomeworkAI Is Your Go-To AI Homework Helper ?

What types of files can i upload to homeworkai.

HomeworkAI supports a variety of file formats, including text files such as PDF, DOC, DOCX, and image files like JPEG and PNG. This allows you to easily upload assignments, worksheets, and questions in the format that best suits your needs.

Is HomeworkAI suitable for all educational levels?

Yes, HomeworkAI is tailored for students and educational professionals of all levels—from middle schoolers to university undergrads—providing support and solutions customized to each educational stage.

Can HoweworkAI process practice questions from textbook material?

Yes. Simply upload the textbook material with practice questions, and our homework AI will analyze them to provide detailed solutions and explanations, just as it would with any other homework assignment or study query.

Does getting help from HomeworkAI considered cheating?

HomeworkAI is an AI question answerer designed to aid your learning process, much like a traditional tutor. Thus, utilizing HomeworkAI may not be considered cheating, as long as it aligns with your institution's guidelines for using external help.

Can I use HomeworkAI to prepare for my exam?

Absolutely, HomeworkAI can be an effective tool for exam preparation. It offers practice questions, solutions, and thorough explanations to help reinforce your understanding of the subject matter, giving you an extra edge in your study routine.

How does HomeworkAI handle problems with multiple solution methods?

HomeworkAI does have the ability to handle problems with multiple solution methods. It can provide a primary solution and, where applicable, may offer alternative approaches or explanations to give you a well-rounded understanding of the problem at hand.

Get Your Hands on The Best AI Homework Helper Right Now !

HomeworkAI doesn't just deliver answers—it teaches problem-solving, becoming your ultimate homework companion.

Omni scient

Omni is the most accurate AI homework solver on the market!

See Omni in Action

How to use Smodin Omni

1. type your homework question into the search box.

Make your question as precise as possible. The more clearly worded your question is, the more likely Smodin Omni will be able to find the answer to your question.

2. Search for Answers

Click the search button. Smodin Omni will search our large question-and-answer database as well as the internet for the solution to your question. This typically takes around 10 seconds. We will find relevant internet content, helpful images, and useful explanations.

3. Look for your answer

Majority of common questions are easy to answer, and you will see your answer appear in the answer list. However, more unique questions may not have sufficient answers in our database or on the web.

4. Ask Smodin Omni your Question

Smodin Omni uses various machine learning models to determine the answer to your question. The more questions you ask it, the smarter the Omni becomes. Currently, Smodin Omni can answer a limited amount of question types, but it is growing its understanding of topics daily.

5. Share your answer with your classmates

You love it when your friends help you with your homework, so why not help them with their homework? Share your answers from Smodin Omni to help your classmates with their homework!

Other Homework Solving Tools

How does smodin omni work.

Smodin Omni first searches for your homework question across the we and our large database of questions to see if your question has been answered. If your question is still not answered, Smodin Omni will attempt to answer your question using large machine learning models that understand various school subjects in depth.

Who is Smodin Omni for?

Smodin Omni is designed for students that want instantaneous answers to homework problems. It is designed for students who want to see related information on problems to their homework they cannot easily get from searching on the web. Smodin Omni is also designed to be a replacement for most tutor related needs. Smodin Omni can easily answer questions while you"re in class, in a study session, or any where else you need fast answers to homework questions. Smodin Omni was specifically designed for languages that don't have as many resources available on the web. It can help popular languages such as Spanish, Portuguese, Italian, Russian, Arabic, German, French, Norwegian, and many other languages. Smodin is on a mission to provide useful tools to every language, and Smodin Omni is part of that mission.

Smodin Omni improves your grades

A student's grades are one of the most important factors that determine his or her future opportunities. Having higher grades in school can help a student get into a good university, thus getting a better job after graduation. Trying to get better grades can be very hard at times, especially when the workload is too heavy and there is not enough time to study properly. The main problem of many students is that they lack time for studying due to their other priorities. Studying for hours on end is pointless if you don't understand the material. Students need to be able to absorb information quickly and easily so that they can focus on other aspects of school life. A student homework answer generator can help students learn different subjects more efficiently, which will lead to improved grades across all subjects. Students can use AI learning assistants during their free time while commuting or during breaks at school. These programs make it possible to learn new concepts even when there isn't a lot of time available. In addition, the use of an AI assistant makes it possible for students to learn without having to spend money on additional tutoring or educational courses.

An Answer Generator Enhances the Learning Experience

Tools like our AI student answer generator can help students review material more effectively and efficiently. They can also provide students with automatic feedback and suggestions that they should incorporate into their work or study practices. When used correctly, these tools are invaluable in helping students improve their learning curves and produce better quality work. Students can use them as self-help tools to complete projects on their own.

Smodin Omni Helps You Retain More Information

While the Internet is a great source of information, students often have limited time to retain information. As a result, they need to review their notes and textbooks repeatedly. An answer generator makes it easy to save time finding the right answer. Smodin Omni helps students retain information by offering answers to questions instantaneously leading to greater subject matter retention.

Student Answer Generators Provide an Equal Education Opportunity

The students who have the most trouble with their studies are those in rural and inner-city schools, as well as those in underprivileged neighborhoods. All these students are often at a disadvantage because they lack the resources for individual tutoring time or time with their professors. With Smodin Omni, an artificial intelligence answer generator, students of all backgrounds can spend time understanding their curriculum by receiving answers to all their questions instantly. This can help students reach his or her full potential and succeed in school.

Type Your Questions into Smodin Omni Today

Use our AI answer generator to receive the answers to all your questions. Our service is constantly improving with each inputted question. Continuing to use our service will only make it better. And a better Omni means better answers, improved grades, and a better student life.

Available Subjects

earth science

environmental science

organic chemistry

Answer homework questions in any of the following languages

© 2024 Smodin LLC

• For a new problem, you will need to begin a new live expert session.
• You can contact support with any questions regarding your current subscription.
• You will be able to enter math problems once our session is over.
• I am only able to help with one math problem per session. Which problem would you like to work on?
• Does that make sense?
• I am currently working on this problem.
• Are you still there?
• It appears we may have a connection issue. I will end the session - please reconnect if you still need assistance.
• Let me take a look...
• Can you please send an image of the problem you are seeing in your book or homework?
• If you click on "Tap to view steps..." you will see the steps are now numbered. Which step # do you have a question on?
• Please make sure you are in the correct subject. To change subjects, please exit out of this live expert session and select the appropriate subject from the menu located in the upper left corner of the Mathway screen.
• What are you trying to do with this input?
• While we cover a very wide range of problems, we are currently unable to assist with this specific problem. I spoke with my team and we will make note of this for future training. Is there a different problem you would like further assistance with?
• Mathway currently does not support this subject. We are more than happy to answer any math specific question you may have about this problem.
• Mathway currently does not support Ask an Expert Live in Chemistry. If this is what you were looking for, please contact support.
• Mathway currently only computes linear regressions.
• We are here to assist you with your math questions. You will need to get assistance from your school if you are having problems entering the answers into your online assignment.
• Have a great day!
• Hope that helps!
• You're welcome!
• Per our terms of use, Mathway's live experts will not knowingly provide solutions to students while they are taking a test or quiz.

Please ensure that your password is at least 8 characters and contains each of the following:

• a special character: @$#!%*?&

smart solve

Loved by 10,000+ students

Instant Answers, Any Subject

Instant Accurate Answers

From homework help to exam prep, SmartSolve is the perfect study assistant! With a 98.97% accuracy rate, confidently get answers to questions in any subject, including math, science, history, and more.

Powered By AI

SmartSolve utilizes next generation AI backed by industry leaders to ensure every answer provided is as detailed and accurate as possible!

Completely Undetectable

Customer privacy is our #1 concern. With various proprietary techniques embedded into SmartSolve, usage when browsing any website is completely hidden!

How SmartSolve

SmartSolve can be used in three different ways to ensure universal support across all websites and questions.

Direct Integration

Click a button and instantly get the answer on various learning platforms such as: Blackboard, Canvas, Cengage and McGraw Hill.

Simply highlight and solve any question found online.

Take a picture of any complex or image problem and let SmartSolve handle the rest.

Loved by Students and Teachers

SmartSolve has received an overwhelming amount of positive reviews and is embraced and cherished by both teachers and students across the world.

Choose Your Test

Sat / act prep online guides and tips, how to do homework: 15 expert tips and tricks.

Coursework/GPA

Everyone struggles with homework sometimes, but if getting your homework done has become a chronic issue for you, then you may need a little extra help. That’s why we’ve written this article all about how to do homework. Once you’re finished reading it, you’ll know how to do homework (and have tons of new ways to motivate yourself to do homework)!

We’ve broken this article down into a few major sections. You’ll find:

• A diagnostic test to help you figure out why you’re struggling with homework
• A discussion of the four major homework problems students face, along with expert tips for addressing them
• A bonus section with tips for how to do homework fast

By the end of this article, you’ll be prepared to tackle whatever homework assignments your teachers throw at you .

So let’s get started!

How to Do Homework: Figure Out Your Struggles 

Sometimes it feels like everything is standing between you and getting your homework done. But the truth is, most people only have one or two major roadblocks that are keeping them from getting their homework done well and on time. 

The best way to figure out how to get motivated to do homework starts with pinpointing the issues that are affecting your ability to get your assignments done. That’s why we’ve developed a short quiz to help you identify the areas where you’re struggling. 

Take the quiz below and record your answers on your phone or on a scrap piece of paper. Keep in mind there are no wrong answers! 

1. You’ve just been assigned an essay in your English class that’s due at the end of the week. What’s the first thing you do?

A. Keep it in mind, even though you won’t start it until the day before it’s due  B. Open up your planner. You’ve got to figure out when you’ll write your paper since you have band practice, a speech tournament, and your little sister’s dance recital this week, too.  C. Groan out loud. Another essay? You could barely get yourself to write the last one!  D. Start thinking about your essay topic, which makes you think about your art project that’s due the same day, which reminds you that your favorite artist might have just posted to Instagram...so you better check your feed right now. 

2. Your mom asked you to pick up your room before she gets home from work. You’ve just gotten home from school. You decide you’ll tackle your chores: 

A. Five minutes before your mom walks through the front door. As long as it gets done, who cares when you start?  B. As soon as you get home from your shift at the local grocery store.  C. After you give yourself a 15-minute pep talk about how you need to get to work.  D. You won’t get it done. Between texts from your friends, trying to watch your favorite Netflix show, and playing with your dog, you just lost track of time! 

3. You’ve signed up to wash dogs at the Humane Society to help earn money for your senior class trip. You: 

A. Show up ten minutes late. You put off leaving your house until the last minute, then got stuck in unexpected traffic on the way to the shelter.  B. Have to call and cancel at the last minute. You forgot you’d already agreed to babysit your cousin and bake cupcakes for tomorrow’s bake sale.  C. Actually arrive fifteen minutes early with extra brushes and bandanas you picked up at the store. You’re passionate about animals, so you’re excited to help out! D. Show up on time, but only get three dogs washed. You couldn’t help it: you just kept getting distracted by how cute they were!

4. You have an hour of downtime, so you decide you’re going to watch an episode of The Great British Baking Show. You: 

A. Scroll through your social media feeds for twenty minutes before hitting play, which means you’re not able to finish the whole episode. Ugh! You really wanted to see who was sent home!  B. Watch fifteen minutes until you remember you’re supposed to pick up your sister from band practice before heading to your part-time job. No GBBO for you!  C. You finish one episode, then decide to watch another even though you’ve got SAT studying to do. It’s just more fun to watch people make scones.  D. Start the episode, but only catch bits and pieces of it because you’re reading Twitter, cleaning out your backpack, and eating a snack at the same time.

5. Your teacher asks you to stay after class because you’ve missed turning in two homework assignments in a row. When she asks you what’s wrong, you say: 

A. You planned to do your assignments during lunch, but you ran out of time. You decided it would be better to turn in nothing at all than submit unfinished work.  B. You really wanted to get the assignments done, but between your extracurriculars, family commitments, and your part-time job, your homework fell through the cracks.  C. You have a hard time psyching yourself to tackle the assignments. You just can’t seem to find the motivation to work on them once you get home.  D. You tried to do them, but you had a hard time focusing. By the time you realized you hadn’t gotten anything done, it was already time to turn them in. 

Like we said earlier, there are no right or wrong answers to this quiz (though your results will be better if you answered as honestly as possible). Here’s how your answers break down: 

• If your answers were mostly As, then your biggest struggle with doing homework is procrastination. 
• If your answers were mostly Bs, then your biggest struggle with doing homework is time management. 
• If your answers were mostly Cs, then your biggest struggle with doing homework is motivation. 
• If your answers were mostly Ds, then your biggest struggle with doing homework is getting distracted. 

Now that you’ve identified why you’re having a hard time getting your homework done, we can help you figure out how to fix it! Scroll down to find your core problem area to learn more about how you can start to address it. 

And one more thing: you’re really struggling with homework, it’s a good idea to read through every section below. You may find some additional tips that will help make homework less intimidating. 

How to Do Homework When You’re a Procrastinator  

Merriam Webster defines “procrastinate” as “to put off intentionally and habitually.” In other words, procrastination is when you choose to do something at the last minute on a regular basis. If you’ve ever found yourself pulling an all-nighter, trying to finish an assignment between periods, or sprinting to turn in a paper minutes before a deadline, you’ve experienced the effects of procrastination. 

If you’re a chronic procrastinator, you’re in good company. In fact, one study found that 70% to 95% of undergraduate students procrastinate when it comes to doing their homework. Unfortunately, procrastination can negatively impact your grades. Researchers have found that procrastination can lower your grade on an assignment by as much as five points ...which might not sound serious until you realize that can mean the difference between a B- and a C+. 

Procrastination can also negatively affect your health by increasing your stress levels , which can lead to other health conditions like insomnia, a weakened immune system, and even heart conditions. Getting a handle on procrastination can not only improve your grades, it can make you feel better, too! 

The big thing to understand about procrastination is that it’s not the result of laziness. Laziness is defined as being “disinclined to activity or exertion.” In other words, being lazy is all about doing nothing. But a s this Psychology Today article explains , procrastinators don’t put things off because they don’t want to work. Instead, procrastinators tend to postpone tasks they don’t want to do in favor of tasks that they perceive as either more important or more fun. Put another way, procrastinators want to do things...as long as it’s not their homework! 

3 Tips f or Conquering Procrastination 

Because putting off doing homework is a common problem, there are lots of good tactics for addressing procrastination. Keep reading for our three expert tips that will get your homework habits back on track in no time. 

#1: Create a Reward System

Like we mentioned earlier, procrastination happens when you prioritize other activities over getting your homework done. Many times, this happens because homework...well, just isn’t enjoyable. But you can add some fun back into the process by rewarding yourself for getting your work done. 

Here’s what we mean: let’s say you decide that every time you get your homework done before the day it’s due, you’ll give yourself a point. For every five points you earn, you’ll treat yourself to your favorite dessert: a chocolate cupcake! Now you have an extra (delicious!) incentive to motivate you to leave procrastination in the dust. 

If you’re not into cupcakes, don’t worry. Your reward can be anything that motivates you . Maybe it’s hanging out with your best friend or an extra ten minutes of video game time. As long as you’re choosing something that makes homework worth doing, you’ll be successful. 

#2: Have a Homework Accountability Partner 

If you’re having trouble getting yourself to start your homework ahead of time, it may be a good idea to call in reinforcements . Find a friend or classmate you can trust and explain to them that you’re trying to change your homework habits. Ask them if they’d be willing to text you to make sure you’re doing your homework and check in with you once a week to see if you’re meeting your anti-procrastination goals. 

Sharing your goals can make them feel more real, and an accountability partner can help hold you responsible for your decisions. For example, let’s say you’re tempted to put off your science lab write-up until the morning before it’s due. But you know that your accountability partner is going to text you about it tomorrow...and you don’t want to fess up that you haven’t started your assignment. A homework accountability partner can give you the extra support and incentive you need to keep your homework habits on track. 

#3: Create Your Own Due Dates 

If you’re a life-long procrastinator, you might find that changing the habit is harder than you expected. In that case, you might try using procrastination to your advantage! If you just can’t seem to stop doing your work at the last minute, try setting your own due dates for assignments that range from a day to a week before the assignment is actually due. 

Here’s what we mean. Let’s say you have a math worksheet that’s been assigned on Tuesday and is due on Friday. In your planner, you can write down the due date as Thursday instead. You may still put off your homework assignment until the last minute...but in this case, the “last minute” is a day before the assignment’s real due date . This little hack can trick your procrastination-addicted brain into planning ahead! 

If you feel like Kevin Hart in this meme, then our tips for doing homework when you're busy are for you. 

How to Do Homework When You’re too Busy

If you’re aiming to go to a top-tier college , you’re going to have a full plate. Because college admissions is getting more competitive, it’s important that you’re maintaining your grades , studying hard for your standardized tests , and participating in extracurriculars so your application stands out. A packed schedule can get even more hectic once you add family obligations or a part-time job to the mix. 

If you feel like you’re being pulled in a million directions at once, you’re not alone. Recent research has found that stress—and more severe stress-related conditions like anxiety and depression— are a major problem for high school students . In fact, one study from the American Psychological Association found that during the school year, students’ stress levels are higher than those of the adults around them. 

For students, homework is a major contributor to their overall stress levels . Many high schoolers have multiple hours of homework every night , and figuring out how to fit it into an already-packed schedule can seem impossible. 

3 Tips for Fitting Homework Into Your Busy Schedule

While it might feel like you have literally no time left in your schedule, there are still ways to make sure you’re able to get your homework done and meet your other commitments. Here are our expert homework tips for even the busiest of students. 

#1: Make a Prioritized To-Do List 

You probably already have a to-do list to keep yourself on track. The next step is to prioritize the items on your to-do list so you can see what items need your attention right away. 

Here’s how it works: at the beginning of each day, sit down and make a list of all the items you need to get done before you go to bed. This includes your homework, but it should also take into account any practices, chores, events, or job shifts you may have. Once you get everything listed out, it’s time to prioritize them using the labels A, B, and C. Here’s what those labels mean:

• A Tasks : tasks that have to get done—like showing up at work or turning in an assignment—get an A. 
• B Tasks : these are tasks that you would like to get done by the end of the day but aren’t as time sensitive. For example, studying for a test you have next week could be a B-level task. It’s still important, but it doesn’t have to be done right away.
• C Tasks: these are tasks that aren’t very important and/or have no real consequences if you don’t get them done immediately. For instance, if you’re hoping to clean out your closet but it’s not an assigned chore from your parents, you could label that to-do item with a C.

Prioritizing your to-do list helps you visualize which items need your immediate attention, and which items you can leave for later. A prioritized to-do list ensures that you’re spending your time efficiently and effectively, which helps you make room in your schedule for homework. So even though you might really want to start making decorations for Homecoming (a B task), you’ll know that finishing your reading log (an A task) is more important. 

#2: Use a Planner With Time Labels

Your planner is probably packed with notes, events, and assignments already. (And if you’re not using a planner, it’s time to start!) But planners can do more for you than just remind you when an assignment is due. If you’re using a planner with time labels, it can help you visualize how you need to spend your day.

A planner with time labels breaks your day down into chunks, and you assign tasks to each chunk of time. For example, you can make a note of your class schedule with assignments, block out time to study, and make sure you know when you need to be at practice. Once you know which tasks take priority, you can add them to any empty spaces in your day. 

Planning out how you spend your time not only helps you use it wisely, it can help you feel less overwhelmed, too . We’re big fans of planners that include a task list ( like this one ) or have room for notes ( like this one ). 

#3: Set Reminders on Your Phone 

If you need a little extra nudge to make sure you’re getting your homework done on time, it’s a good idea to set some reminders on your phone. You don’t need a fancy app, either. You can use your alarm app to have it go off at specific times throughout the day to remind you to do your homework. This works especially well if you have a set homework time scheduled. So if you’ve decided you’re doing homework at 6:00 pm, you can set an alarm to remind you to bust out your books and get to work. 

If you use your phone as your planner, you may have the option to add alerts, emails, or notifications to scheduled events . Many calendar apps, including the one that comes with your phone, have built-in reminders that you can customize to meet your needs. So if you block off time to do your homework from 4:30 to 6:00 pm, you can set a reminder that will pop up on your phone when it’s time to get started. 

This dog isn't judging your lack of motivation...but your teacher might. Keep reading for tips to help you motivate yourself to do your homework.

How to Do Homework When You’re Unmotivated 

At first glance, it may seem like procrastination and being unmotivated are the same thing. After all, both of these issues usually result in you putting off your homework until the very last minute. 

But there’s one key difference: many procrastinators are working, they’re just prioritizing work differently. They know they’re going to start their homework...they’re just going to do it later. 

Conversely, people who are unmotivated to do homework just can’t find the willpower to tackle their assignments. Procrastinators know they’ll at least attempt the homework at the last minute, whereas people who are unmotivated struggle with convincing themselves to do it at a ll. For procrastinators, the stress comes from the inevitable time crunch. For unmotivated people, the stress comes from trying to convince themselves to do something they don’t want to do in the first place. 

Here are some common reasons students are unmotivated in doing homework : 

• Assignments are too easy, too hard, or seemingly pointless 
• Students aren’t interested in (or passionate about) the subject matter
• Students are intimidated by the work and/or feels like they don’t understand the assignment 
• Homework isn’t fun, and students would rather spend their time on things that they enjoy 

To sum it up: people who lack motivation to do their homework are more likely to not do it at all, or to spend more time worrying about doing their homework than...well, actually doing it.

3 Tips for How to Get Motivated to Do Homework

The key to getting homework done when you’re unmotivated is to figure out what does motivate you, then apply those things to homework. It sounds tricky...but it’s pretty simple once you get the hang of it! Here are our three expert tips for motivating yourself to do your homework. 

#1: Use Incremental Incentives

When you’re not motivated, it’s important to give yourself small rewards to stay focused on finishing the task at hand. The trick is to keep the incentives small and to reward yourself often. For example, maybe you’re reading a good book in your free time. For every ten minutes you spend on your homework, you get to read five pages of your book. Like we mentioned earlier, make sure you’re choosing a reward that works for you! 

So why does this technique work? Using small rewards more often allows you to experience small wins for getting your work done. Every time you make it to one of your tiny reward points, you get to celebrate your success, which gives your brain a boost of dopamine . Dopamine helps you stay motivated and also creates a feeling of satisfaction when you complete your homework !  

#2: Form a Homework Group 

If you’re having trouble motivating yourself, it’s okay to turn to others for support. Creating a homework group can help with this. Bring together a group of your friends or classmates, and pick one time a week where you meet and work on homework together. You don’t have to be in the same class, or even taking the same subjects— the goal is to encourage one another to start (and finish!) your assignments. 

Another added benefit of a homework group is that you can help one another if you’re struggling to understand the material covered in your classes. This is especially helpful if your lack of motivation comes from being intimidated by your assignments. Asking your friends for help may feel less scary than talking to your teacher...and once you get a handle on the material, your homework may become less frightening, too. 

#3: Change Up Your Environment 

If you find that you’re totally unmotivated, it may help if you find a new place to do your homework. For example, if you’ve been struggling to get your homework done at home, try spending an extra hour in the library after school instead. The change of scenery can limit your distractions and give you the energy you need to get your work done. 

If you’re stuck doing homework at home, you can still use this tip. For instance, maybe you’ve always done your homework sitting on your bed. Try relocating somewhere else, like your kitchen table, for a few weeks. You may find that setting up a new “homework spot” in your house gives you a motivational lift and helps you get your work done. 

Social media can be a huge problem when it comes to doing homework. We have advice for helping you unplug and regain focus.

How to Do Homework When You’re Easily Distracted

We live in an always-on world, and there are tons of things clamoring for our attention. From friends and family to pop culture and social media, it seems like there’s always something (or someone!) distracting us from the things we need to do.

The 24/7 world we live in has affected our ability to focus on tasks for prolonged periods of time. Research has shown that over the past decade, an average person’s attention span has gone from 12 seconds to eight seconds . And when we do lose focus, i t takes people a long time to get back on task . One study found that it can take as long as 23 minutes to get back to work once we’ve been distracte d. No wonder it can take hours to get your homework done! 

3 Tips to Improve Your Focus

If you have a hard time focusing when you’re doing your homework, it’s a good idea to try and eliminate as many distractions as possible. Here are three expert tips for blocking out the noise so you can focus on getting your homework done. 

#1: Create a Distraction-Free Environment

Pick a place where you’ll do your homework every day, and make it as distraction-free as possible. Try to find a location where there won’t be tons of noise, and limit your access to screens while you’re doing your homework. Put together a focus-oriented playlist (or choose one on your favorite streaming service), and put your headphones on while you work. 

You may find that other people, like your friends and family, are your biggest distraction. If that’s the case, try setting up some homework boundaries. Let them know when you’ll be working on homework every day, and ask them if they’ll help you keep a quiet environment. They’ll be happy to lend a hand! 

#2: Limit Your Access to Technology 

We know, we know...this tip isn’t fun, but it does work. For homework that doesn’t require a computer, like handouts or worksheets, it’s best to put all your technology away . Turn off your television, put your phone and laptop in your backpack, and silence notifications on any wearable tech you may be sporting. If you listen to music while you work, that’s fine...but make sure you have a playlist set up so you’re not shuffling through songs once you get started on your homework. 

If your homework requires your laptop or tablet, it can be harder to limit your access to distractions. But it’s not impossible! T here are apps you can download that will block certain websites while you’re working so that you’re not tempted to scroll through Twitter or check your Facebook feed. Silence notifications and text messages on your computer, and don’t open your email account unless you absolutely have to. And if you don’t need access to the internet to complete your assignments, turn off your WiFi. Cutting out the online chatter is a great way to make sure you’re getting your homework done. 

#3: Set a Timer (the Pomodoro Technique)

Have you ever heard of the Pomodoro technique ? It’s a productivity hack that uses a timer to help you focus!

Here’s how it works: first, set a timer for 25 minutes. This is going to be your work time. During this 25 minutes, all you can do is work on whatever homework assignment you have in front of you. No email, no text messaging, no phone calls—just homework. When that timer goes off, you get to take a 5 minute break. Every time you go through one of these cycles, it’s called a “pomodoro.” For every four pomodoros you complete, you can take a longer break of 15 to 30 minutes.

The pomodoro technique works through a combination of boundary setting and rewards. First, it gives you a finite amount of time to focus, so you know that you only have to work really hard for 25 minutes. Once you’ve done that, you’re rewarded with a short break where you can do whatever you want. Additionally, tracking how many pomodoros you complete can help you see how long you’re really working on your homework. (Once you start using our focus tips, you may find it doesn’t take as long as you thought!)

Two Bonus Tips for How to Do Homework Fast

Even if you’re doing everything right, there will be times when you just need to get your homework done as fast as possible. (Why do teachers always have projects due in the same week? The world may never know.)

The problem with speeding through homework is that it’s easy to make mistakes. While turning in an assignment is always better than not submitting anything at all, you want to make sure that you’re not compromising quality for speed. Simply put, the goal is to get your homework done quickly and still make a good grade on the assignment! 

Here are our two bonus tips for getting a decent grade on your homework assignments , even when you’re in a time crunch. 

#1: Do the Easy Parts First 

This is especially true if you’re working on a handout with multiple questions. Before you start working on the assignment, read through all the questions and problems. As you do, make a mark beside the questions you think are “easy” to answer . 

Once you’ve finished going through the whole assignment, you can answer these questions first. Getting the easy questions out of the way as quickly as possible lets you spend more time on the trickier portions of your homework, which will maximize your assignment grade. 

(Quick note: this is also a good strategy to use on timed assignments and tests, like the SAT and the ACT !) 

#2: Pay Attention in Class 

Homework gets a lot easier when you’re actively learning the material. Teachers aren’t giving you homework because they’re mean or trying to ruin your weekend... it’s because they want you to really understand the course material. Homework is designed to reinforce what you’re already learning in class so you’ll be ready to tackle harder concepts later.

When you pay attention in class, ask questions, and take good notes, you’re absorbing the information you’ll need to succeed on your homework assignments. (You’re stuck in class anyway, so you might as well make the most of it!) Not only will paying attention in class make your homework less confusing, it will also help it go much faster, too.

What’s Next?

If you’re looking to improve your productivity beyond homework, a good place to begin is with time management. After all, we only have so much time in a day...so it’s important to get the most out of it! To get you started, check out this list of the 12 best time management techniques that you can start using today.

You may have read this article because homework struggles have been affecting your GPA. Now that you’re on the path to homework success, it’s time to start being proactive about raising your grades. This article teaches you everything you need to know about raising your GPA so you can

Now you know how to get motivated to do homework...but what about your study habits? Studying is just as critical to getting good grades, and ultimately getting into a good college . We can teach you how to study bette r in high school. (We’ve also got tons of resources to help you study for your ACT and SAT exams , too!)

These recommendations are based solely on our knowledge and experience. If you purchase an item through one of our links, PrepScholar may receive a commission.

Ashley Sufflé Robinson has a Ph.D. in 19th Century English Literature. As a content writer for PrepScholar, Ashley is passionate about giving college-bound students the in-depth information they need to get into the school of their dreams.

Student and Parent Forum

Our new student and parent forum, at ExpertHub.PrepScholar.com , allow you to interact with your peers and the PrepScholar staff. See how other students and parents are navigating high school, college, and the college admissions process. Ask questions; get answers.

Ask a Question Below

Have any questions about this article or other topics? Ask below and we'll reply!

Improve With Our Famous Guides

• For All Students

The 5 Strategies You Must Be Using to Improve 160+ SAT Points

How to Get a Perfect 1600, by a Perfect Scorer

Series: How to Get 800 on Each SAT Section:

Score 800 on SAT Math

Score 800 on SAT Reading

Score 800 on SAT Writing

Series: How to Get to 600 on Each SAT Section:

Score 600 on SAT Math

Score 600 on SAT Reading

Score 600 on SAT Writing

Free Complete Official SAT Practice Tests

What SAT Target Score Should You Be Aiming For?

15 Strategies to Improve Your SAT Essay

The 5 Strategies You Must Be Using to Improve 4+ ACT Points

How to Get a Perfect 36 ACT, by a Perfect Scorer

Series: How to Get 36 on Each ACT Section:

36 on ACT English

36 on ACT Math

36 on ACT Reading

36 on ACT Science

Series: How to Get to 24 on Each ACT Section:

24 on ACT English

24 on ACT Math

24 on ACT Reading

24 on ACT Science

What ACT target score should you be aiming for?

ACT Vocabulary You Must Know

ACT Writing: 15 Tips to Raise Your Essay Score

How to Get Into Harvard and the Ivy League

How to Get a Perfect 4.0 GPA

How to Write an Amazing College Essay

What Exactly Are Colleges Looking For?

Is the ACT easier than the SAT? A Comprehensive Guide

Should you retake your SAT or ACT?

When should you take the SAT or ACT?

Stay Informed

Get the latest articles and test prep tips!

Solver Title

Generating PDF...

• Pre Algebra Order of Operations Factors & Primes Fractions Long Arithmetic Decimals Exponents & Radicals Ratios & Proportions Percent Modulo Number Line Mean, Median & Mode
• Algebra Equations Inequalities System of Equations System of Inequalities Basic Operations Algebraic Properties Partial Fractions Polynomials Rational Expressions Sequences Power Sums Interval Notation Pi (Product) Notation Induction Logical Sets Word Problems
• Pre Calculus Equations Inequalities Scientific Calculator Scientific Notation Arithmetics Complex Numbers Polar/Cartesian Simultaneous Equations System of Inequalities Polynomials Rationales Functions Arithmetic & Comp. Coordinate Geometry Plane Geometry Solid Geometry Conic Sections Trigonometry
• Calculus Derivatives Derivative Applications Limits Integrals Integral Applications Integral Approximation Series ODE Multivariable Calculus Laplace Transform Taylor/Maclaurin Series Fourier Series Fourier Transform
• Functions Line Equations Functions Arithmetic & Comp. Conic Sections Transformation
• Linear Algebra Matrices Vectors
• Trigonometry Identities Proving Identities Trig Equations Trig Inequalities Evaluate Functions Simplify
• Statistics Mean Geometric Mean Quadratic Mean Average Median Mode Order Minimum Maximum Probability Mid-Range Range Standard Deviation Variance Lower Quartile Upper Quartile Interquartile Range Midhinge Standard Normal Distribution
• Physics Mechanics
• Chemistry Chemical Reactions Chemical Properties
• Finance Simple Interest Compound Interest Present Value Future Value
• Economics Point of Diminishing Return
• Conversions Roman Numerals Radical to Exponent Exponent to Radical To Fraction To Decimal To Mixed Number To Improper Fraction Radians to Degrees Degrees to Radians Hexadecimal Scientific Notation Distance Weight Time Volume
• Pre Algebra
• Pre Calculus
• Linear Algebra
• Trigonometry
• Conversions

Most Used Actions

Number line.

• x^{2}-x-6=0
• -x+3\gt 2x+1
• line\:(1,\:2),\:(3,\:1)
• prove\:\tan^2(x)-\sin^2(x)=\tan^2(x)\sin^2(x)
• \frac{d}{dx}(\frac{3x+9}{2-x})
• (\sin^2(\theta))'
• \lim _{x\to 0}(x\ln (x))
• \int e^x\cos (x)dx
• \int_{0}^{\pi}\sin(x)dx
• \sum_{n=0}^{\infty}\frac{3}{2^n}
• Is there a step by step calculator for math?
• Symbolab is the best step by step calculator for a wide range of math problems, from basic arithmetic to advanced calculus and linear algebra. It shows you the solution, graph, detailed steps and explanations for each problem.
• Is there a step by step calculator for physics?
• Symbolab is the best step by step calculator for a wide range of physics problems, including mechanics, electricity and magnetism, and thermodynamics. It shows you the steps and explanations for each problem, so you can learn as you go.
• How to solve math problems step-by-step?
• To solve math problems step-by-step start by reading the problem carefully and understand what you are being asked to find. Next, identify the relevant information, define the variables, and plan a strategy for solving the problem.
• Practice Makes Perfect Learning math takes practice, lots of practice. Just like running, it takes practice and dedication. If you want...

Please add a message.

Message received. Thanks for the feedback.

Game Central

Get step-by-step explanations

Graph your math problems

Practice, practice, practice

Get math help in your language

Upload a screenshot and solve any math problem instantly with MathGPT!

Drag & drop an image file here, or click to select an image.

• Solve equations and inequalities
• Simplify expressions
• Factor polynomials
• Graph equations and inequalities
• Advanced solvers
• All solvers
• Arithmetics
• Determinant
• Percentages
• Scientific Notation
• Inequalities

What can QuickMath do?

QuickMath will automatically answer the most common problems in algebra, equations and calculus faced by high-school and college students.

• The algebra section allows you to expand, factor or simplify virtually any expression you choose. It also has commands for splitting fractions into partial fractions, combining several fractions into one and cancelling common factors within a fraction.
• The equations section lets you solve an equation or system of equations. You can usually find the exact answer or, if necessary, a numerical answer to almost any accuracy you require.
• The inequalities section lets you solve an inequality or a system of inequalities for a single variable. You can also plot inequalities in two variables.
• The calculus section will carry out differentiation as well as definite and indefinite integration.
• The matrices section contains commands for the arithmetic manipulation of matrices.
• The graphs section contains commands for plotting equations and inequalities.
• The numbers section has a percentages command for explaining the most common types of percentage problems and a section for dealing with scientific notation.

Math Topics

More solvers.

• Add Fractions
• Simplify Fractions

Ask Questions

Still have questions? Ask CameraMath online

• 24/7 expert live tutors

Unlimited numbers of questions

• Step-by-step explanations

You can enjoy

• Unlimited number of questions
• No interruptions
• Full access to answer and solution
• Limited Solutions

Meet Photomath.

Anytime. Anywhere.

You may feel like the only one who’s confused, but you’re not alone. Every single month Photomath helps millions of learners understand their math.

Math, explained.

For elementary through college..

Elementary math

Trigonometry

Build your math mind

Math from all angles: Photomath for different learning styles

Study Tips to Find Your Focus and Ace Your Next Math Test

Overcoming Math Anxiety: How to Conquer Fear & Build Confidence

How Photomath Helps with More than Just Homework

Explore your options.

Step-by-step explanations

Custom visual aids

Extra “how” and “why” tips

Deep-dive solutions for hundreds of textbooks

• Start trial

Get step-by-step solutions to your math problems

Try Math Solver

Get step-by-step explanations

Graph your math problems

Practice, practice, practice

Get math help in your language

7 Apps That Can Do Your Homework Much Faster Than You

In the field of educational technology, some apps might be getting too smart.

More and more apps are delivering on-demand homework help to students, who can easily re-purpose the learning tools to obtain not just assistance, but also answers. Whether or not that’s cheating—and how to stop it—is one of the concerns surrounding a new app that can solve math equations with the snap of a camera . While the software has inspired teachers to create real-world homework problems that can’t be automatically solved , that strategy doesn’t hold up to other apps that tap into real-life brains for solutions.

Here’s a look at 7 apps that can do your homework for you, and what they have to say about cheating:

Price : Free Availability : iOS, Android app coming in early 2015

The new, seemingly magic app allows users to take pictures of typed equations, and then outputs a step-by-step solution. As of Wednesday, the app is the number one free app on the App Store. But the biggest issue, one teacher argues , isn’t if students will use the app to cheat, because many will. Rather, it’s about how teachers will adapt. A PhotoMath spokeswoman said educators have welcomed the app with positive reviews, but the software remains “quite controversial.”

“We didn’t develop PhotoMath as a cheating tool. We really wanted kids to learn,” said Tijana Zganec, a sales and marketing associate at tech company MicroBlink, which created PhotoMath. “If you want to cheat, you will find a way to cheat. But if you want to learn, you can use PhotoMath for that.”

Whether you’re a high schooler with eight periods of classes or a college student tackling dozens of credits, there’s one thing you’ve got for sure: a mess of assignments. iHomework can help you keep track of all your work, slicing and dicing it in a variety of ways. Sorting it by due date, week, month, or by course, the app is more organized than a Trapper Keeper. And in integrating data from Questia, you can link your reading material to your assignments so you don’t have to dig through a pile of papers to find the right information.

A scheduling feature can help you keep track of those random bi-weekly Thursday labs, and you can even mark the location of your courses on a map so you don’t end up on the wrong side of campus. And finally, with iCloud syncing, you can access all this information on whatever Apple-compatible device you’re using at the moment — no need to dig for your iPad.

Google Apps for Education

Taking the search giant’s suite of free browser-based apps and sandboxing them so they are safe for school use, Google Apps for Education is an excellent alternative to the mainstream installable productivity software, but this one has a perk that almost school board will love—it’s free. Packaging together favorites like Gmail, Hangouts, Google Docs, Google Sheets, and Google Drive with Classroom, a digital hub for organizing assignments and sending feedback, the goal of this collection is to make learning a more collaborative process.

Though Google Apps for Education is cloud-hosted, the programs can be used offline, ideal for when your student needs to escape the internet and work distraction-free. And since it works on any device, it also helps students avoid buying overly expensive hardware. That means more money for extracurricular activities.

Price: Free, but some homework services require payment Availability: iOS and Android

HwPic is a tutoring service that allows students to take send pictures of their homework to tutors, who will then respond within minutes to your questions with a step-by-step solution. There’s even an option to expedite the answers if a student is in a hurry. HwPic Co-Founder Tiklat Issa said that the app was initially rejected by Apple’s App Store, which believed it would promote cheating, but he successfully argued that just because someone uses the app in a way that it’s not meant to be used doesn’t mean the app should be punished.

Issa added that HwPic prohibits cheating in its terms and conditions. Tutors don’t solve homework that has words like “Quiz” or “Exam,” and they often know if a student is sending a photo during a test if they’ve paid for expedited answers, and if the photo is dim, blurry and taken under a desk. “We’ve minimized cheating,” said Issa. “We haven’t eliminated it. That’s kind of unrealistic.”

Wolfram Alpha

Price : $2.99 Availability : iOS and Android

Wolfram Alpha is similar to PhotoMath, only that it targets older students studying high levels of math and doesn’t support photos. The service also outputs step-by-step solutions to topics as advanced as vector calculus and differential equations, making it a popular tool for college students.

“It’s cheating not doing computer-based math, because we’re cheating students out of real conceptual understanding and an ability to drive much further forward in the math they can do, to cover much more conceptual ground. And in turn, that’s cheating our economies,” said Conrad Wolfram, Wolfram Research’s Director of Strategic Development, in a TEDx Talk . “People talk about the knowledge economy. I think we’re moving forward to what we’re calling the computational knowledge economy.”

Homework Helper

Price: Free Availability: iOS and Android

Chinese Internet search company Baidu launched an app called Homework Helper this year with which students can crowdsource help or answers to homework. Users post a picture or type their homework questions onto online forums, and those who answer the questions can win e-coins that can be used to buy electronics like iPhones and laptops.

The app has logged 5 million downloads, much to the dismay of many some parents who argue that the students spend less time thinking about challenging problems. A Homework Helper staffer admitted to Quartz , “I think this is a kind of cheating.”

Price: Free, but some homework services require payment Availability: iOS

Slader is a crowdsourcing app for high school and college students to post and answer questions in math and science. While students can post original homework for help, many questions in popular textbooks have already been answered on the app, according to Fast Company . An Illinois high school said earlier this year that it suspected students were using the service to cheat on their math homework.

Slader argues that it’s “challenging traditional ideas about math and education,” and said that the ideas behind its app “aren’t a write-off to teachers,” according to its blog . Slader told San Francisco media outlet KQED that it shouldn’t be dismissed as a cheating tool, but rather considered a way for students to access real-time help.

More Must-Reads From TIME

• Jane Fonda Champions Climate Action for Every Generation
• Passengers Are Flying up to 30 Hours to See Four Minutes of the Eclipse
• Biden’s Campaign Is In Trouble. Will the Turnaround Plan Work?
• Essay: The Complicated Dread of Early Spring
• Why Walking Isn’t Enough When It Comes to Exercise
• The Financial Influencers Women Actually Want to Listen To
• The Best TV Shows to Watch on Peacock
• Want Weekly Recs on What to Watch, Read, and More? Sign Up for Worth Your Time

Contact us at [email protected]

You May Also Like

Photo. Solve. Learn. Get PhotoSolve.

• Join our Discord