case study based question class 12 biology

CBSE Expert

CBSE Class 12 Biology Case Study Questions PDF Download

Welcome to the comprehensive guide on CBSE Class 12 Biology Case Study Questions! In this article, we will delve into the world of Biology case studies, explore the importance of case study questions, and provide you with a PDF download that will assist you in mastering this subject. Whether you’re a student preparing for your examinations or a teacher looking to enhance your teaching materials, our detailed resource will help you excel in the realm of Biology.

Case studies are a widely used educational tool that involves the in-depth analysis of a particular situation, organism, process, or problem. In CBSE Class 12 Biology, case study questions are designed to evaluate students’ critical thinking, problem-solving abilities, and practical application of biological concepts. These questions require students to apply their theoretical knowledge to real-life scenarios, thus fostering a deeper understanding of the subject matter.

Class 12 Biology Case Study Questions

CBSE Class 12 Biology question paper will have case study questions too. These case-based questions will be objective type in nature. So, Class 12 Biology students must prepare themselves for such questions. First of all, you should study NCERT Textbooks line by line, and then you should practice as many questions as possible.

Chapter-wise Solved Case Study Questions for Class 12 Biology

Class 12 students should go through important Case Study problems for Biology before the exams. This will help them to understand the type of Case Study questions that can be asked in Grade 12 Biology examinations. Our expert faculty for standard 12 Biology have designed these questions based on the trend of questions that have been asked in last year’s exams. The solutions have been designed in a manner to help the grade 12 students understand the concepts and also easy-to-learn solutions.

Books for Class 12 Biology

Strictly as per the new term-wise syllabus for Board Examinations to be held in the academic session 2022-23 for class 12 Multiple Choice Questions based on new typologies introduced by the board- Stand-Alone MCQs, MCQs based on Assertion-Reason Case-based MCQs. Include Questions from CBSE official Question Bank released in April 2022 Answer key with Explanations What are the updates in the book: Strictly as per the Term wise syllabus for Board Examinations to be held in the academic session 2022-23. Chapter-wise -Topic-wise Multiple choice questions based on the special scheme of assessment for Board Examination for Class 12th.

case study based question class 12 biology

Tips to Excel in CBSE Class 12 Biology Case Study Questions

Thoroughly grasp the concepts.

Before attempting case study questions, ensure you have a strong grasp of fundamental biological concepts. Familiarize yourself with topics such as genetics, ecology, human physiology, and evolution. A solid foundation will empower you to tackle complex case studies with confidence.

Practice Regularly

Practice makes perfect, and this is especially true for case study questions. Allocate time to work through a diverse range of case studies regularly. Familiarizing yourself with different scenarios will prepare you for the unpredictability of examination questions.

Collaborate and Discuss

Engaging in group discussions with fellow students or teachers can be highly beneficial. Sharing perspectives, analyzing cases together, and discussing possible solutions can broaden your understanding and offer fresh insights.

Seek Guidance from Teachers

Don’t hesitate to approach your teachers for assistance. They possess valuable experience and expertise to guide you through challenging case studies and provide valuable feedback.

Time Management

During examinations, time management is crucial. Practice solving case study questions under timed conditions to improve your efficiency and ensure you complete all questions within the allocated timeframe.

In conclusion, mastering case study questions in CBSE Class 12 Biology is essential for a holistic understanding of the subject and for excelling in examinations. By honing your analytical abilities, practicing regularly, and seeking guidance, you can conquer even the most challenging case studies. Remember that learning Biology is not just about memorizing facts but about applying knowledge to real-world situations. So, embrace the power of case studies and delve into the fascinating world of Biology.

With the provided CBSE Class 12 Biology Case Study Questions PDF, you have a valuable resource at your disposal. Practice diligently, and you’ll witness your confidence soar as you become a proficient problem solver in the realm of Biology. Good luck on your academic journey!

Download India's best Exam Preparation App Now.

Key Features

Revision Notes
Important Questions
Previous Years Questions
Case-Based Questions
Assertion and Reason Questions

No thanks, I’m not interested!

myCBSEguide

Class 12 Biology Case...

Class 12 Biology Case Study Questions

Table of Contents

myCBSEguide App

Download the app to get CBSE Sample Papers 2023-24, NCERT Solutions (Revised), Most Important Questions, Previous Year Question Bank, Mock Tests, and Detailed Notes.

As we know that CBSE will now ask case study questions in each subject. In most of the cases, we have noticed that these case-based questions are high-scoring. A little effort on these case study questions can help you get good marks in your board exams. You can download CBSE Class 12 Biology Case Study Questions from the myCBSEguide App or from our Student Dashboard .

Let’s understand what type of case study questions CBSE asks in class 12 Biology. If you analyze the latest class 12 Biology sample papers , you will find that there are two types of case study questions in the Biology question papers.

Case Studies with objective questions
Case studies with subjective questions

As per the latest circular issued by CBSE on Assessment and Evaluation Practices of the Board for the Session 2022-23 , CBSE has clearly mentioned that competency-based questions including case studies will be different from subjective questions. Hence, we expect that CBSE will ask only objective questions in CBSE class 12 Biology case study questions too.

Biology Competency Based Questions

As discussed earlier too, the competency-based questions promote learning development for our students and test higher-order skills, such as analysis, critical thinking and conceptual clarity. Case study questions are actually competency-based questions. The very purpose of including such questions in the curriculum is to emphasise on development of problem-solving ability and the ability to apply knowledge in real-life situations.

Even in CBSE Class 12 Biology case studies, you will find some text input like paragraphs, pictures, data etc followed by some objective-type questions. You should read the given information carefully and then answer the questions.

CBSE 12th Biology Case Study MCQs

Here is one example question on subjective type case study questions. This was given in the term-2 sample paper in 2022.

Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single-stranded DNA. BamH1is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand.

What is the objective of this action?
Explain how the gene of interest is introduced into a vector.
You are given the DNA shown below. 5’ ATTTTGAGGATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAGGCATTACAGGA 5’ If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.
A gene M was introduced into E.coli cloning vector PBR322 at the BamH1 site. What will be its impact on the recombinant plasmids? Give a possible way by which you could differentiate non-recombinant to recombinant plasmids.

Let’s take another example from MCQ type question:

To answer the questions, study the graphs below for Subject-1 and 2 showing different levels of certain hormones.

The peak observed in Subject-1 and 2 is due to

progesterone
luteinizing hormone
follicle stimulating hormone

Subject 2 has higher level of hormone B, which is

If the peak of Hormone A does not appear in the study for Subject 1, which of the following statement is true?

Peak of Hormone B will be observed at a higher point in the graph
Peak of Hormone B will be observed at a point lower than what is given in the graph
There will be no observed data for Hormone B
The graph for Hormone B will be a sharp rise followed by a plateau

Which structure in the ovary will remain functional in subject 2?

Corpus Luteum
Tertiary follicle
Graafian follicle
Primary follicle

For subject 2 it is observed that the peak for hormone B has reached the plateau stage. After approximately how much time will the curve for hormone B descend?

Which of the following statements is true about the subjects?

Subject 1 is pregnant
Subject 2 is pregnant
Both subject 1 and 2 are pregnant
Both subject 1 and 2 are not pregnant

Another example of a class 12 Biology case study question

We use microbes or products which are derived from them every day. A common example is the production of curd from milk. Micro-organisms such as Lactobacillus and others commonly called lactic acid bacteria (LAB) grow in milk and convert it to curd. The dough, which is used for making foods such as dosa and idli is also fermented by bacteria. A number of traditional drinks and foods are also made by fermentation by microbes. ‘Toddy’, a traditional drink in some parts of southern India is made by fermenting sap from palms. The ‘Roquefort cheese’ is ripened by growing specific fungi on them, which gives them a particular flavour. Different varieties of cheese are known by their characteristic texture, flavour and taste, the specificity coming from the microbes used.

Penicillium notatum
Saccharomyces cerevisiae
Aspergillus niger
Clostridium butylicum
thermal vents
polluted water
all of these
None of the above
production of a large amount of CO 2
production of O 2
due to the presence of water
none of these
Both Assertion and Reason are true and Reason is the correct explanation of the Assertion
Both Assertion and Reason are true but Reason is not the correct explanation of the Assertion
Our Assertion is true but the Reason is false
Both the statements are false

Download 12 Biology Case Study Questions

In this article, we have given you a few examples of class 12 Biology case study questions. We advise you to download the myCBSEguide App or access our Student Dashboard to get more case study questions for CBSE class 12 biology. We have hundreds of questions on case studies related to CBSE Class 12 Biology. As CBSE is now focusing more on the understanding of the concepts, it is a must for students to practice such questions regularly.

Test Generator

Create question paper PDF and online tests with your own name & logo in minutes.

Question Bank, Mock Tests, Exam Papers, NCERT Solutions, Sample Papers, Notes

Competency Based Learning in CBSE Schools
Class 11 Physical Education Case Study Questions
Class 11 Sociology Case Study Questions
Class 12 Applied Mathematics Case Study Questions
Class 11 Applied Mathematics Case Study Questions
Class 11 Mathematics Case Study Questions
Class 11 Biology Case Study Questions
Class 12 Physical Education Case Study Questions

Save my name, email, and website in this browser for the next time I comment.

Book Solutions
State Boards

Case Study Questions Class 12 Biology Ecosystem

Case study questions class 12 biology chapter 14 ecosystem.

CBSE Class 12 Case Study Questions Biology Ecosystem. Term 2 Important Case Study Questions for Class 12 Board Exam Students. Here we have arranged some Important Case Base Questions for students who are searching for Paragraph Based Questions Ecosystem.

At Case Study Questions there will given a Paragraph. In where some Important Questions will made on that respective Case Based Study. There will various types of marks will given 1 marks, 2 marks, 3 marks, 4 marks.

CBSE Case Study Questions Class 12 Biology Ecosystem

Case study 1

Interaction of biotic and abiotic components result in a physical structure that is characteristic for each type of ecosystem. Identification and enumeration of plant and animal species of an ecosystem gives its species composition. Vertical distribution of different species occupying different levels is called stratification. For example, trees occupy top vertical strata or layer of a forest, shrubs the second and herbs and grasses occupy the bottom layers. The components of the ecosystem are seen to function as a unit when you consider the following aspects: (i) Productivity; (ii) Decomposition; (iii) Energy flow; and (iv) Nutrient cycling. To understand the ethos of an aquatic ecosystem let us take a small pond as an example. This is fairly a self-sustainable unit and rather simple example that explain even the complex interactions that exist in an aquatic ecosystem. A pond is a shallow water body in which all the above mentioned four basic components of an ecosystem are well exhibited. The abiotic component is the water with all the dissolved inorganic and organic substances and the rich soil deposit at the bottom of the pond. The solar input, the cycle of temperature, day-length and other climatic conditions regulate the rate of function of the entire pond. The autotrophic components include the phytoplankton, some algae and the floating, submerged and marginal plants found at the edges.

The consumers are represented by the zooplankton, the free swimming and bottom dwelling forms. The decomposers are the fungi, bacteria and flagellates especially abundant in the bottom of the pond. This system performs all the functions of any ecosystem and of the biosphere as a whole, i.e., conversion of inorganic into organic material with the help of the radiant energy of the sun by the autotrophs; consumption of the autotrophs by heterotrophs; decomposition and mineralisation of the dead matter to release them back for reuse by the autotrophs, these event are repeated over and over again. There is unidirectional movement of energy towards the higher trophic levels and its dissipation and loss as heat to the environment.

Que. 1) Autotrophs consumption in the ecosystem occurs by …………………………………………………………………………………… .

(a) Decomposers

(b) Autotrophs

(d) Herbivores

Que. 2) …………………………………………………………………… are represented as a consumer.

(a) Zooplanktons

Que. 3) Components of ecosystem include ………………………………………………………………………………… .

(a) Kreb cycle

(b) Glucose cycle

(d) Nutrient cycle

Que. 4) Write definition of ‘Stratification’ and give one example of it.

Que. 5) Which decomposers are important to function ecosystem?

Que. 1)(c) Heterotrophs.

Que. 2) (a) Zooplanktons.

Que. 3) (d) Nutrient cycle.

Que. 4) Answer: Different levels which are occupied by vertical distribution of different species, this is called as Stratification. In the forest, trees occupy top layer and grasses occupy bottom layer. This is an example of Stratification.

Que. 5) Answer: Decomposers such as flagellated, bacteria and fungi are import to function ecosystem.

Case study 2

A constant input of solar energy is the basic requirement for any ecosystem to function and sustain. Primary production is defined as the amount of biomass or organic matter produced per unit area over a time period by plants during photosynthesis. It is expressed in terms of weight (gm–2 ) or energy (kcal m–2 ). The rate of biomass production is called productivity. It is expressed in terms of gm–2 yr –1 or (kcal m–2) yr –1 to compare the productivity of different ecosystems. It can be divided into gross primary productivity (GPP) and net primary productivity (NPP). Gross primary productivity of an ecosystem is the rate of production of organic matter during photosynthesis. A considerable amount of GPP is utilised by plants in respiration. Gross primary productivity minus respiration losses (R), is the net primary productivity (NPP). GPP – R = NPP Net primary productivity is the available biomass for the consumption to heterotrophs (herbiviores and decomposers). Secondary productivity is defined as the rate of formation of new organic matter by consumers. Primary productivity depends on the plant species inhabiting a particular area. It also depends on a variety of environmental factors, availability of nutrients and photosynthetic capacity of plants. Therefore, it varies in different types of ecosystems. The annual net primary productivity of the whole biosphere is approximately 170 billion tons (dry weight) of organic matter. Of this, despite occupying about 70 per cent of the surface, the productivity of the oceans are only 55 billion tons. Rest of course, is on land.

Que. 1) In the ecosystem, the …………………………………………………………………………………. is expressed in terms of gm -2 yr -1 .

(a) Energy flow

(b) Productivity

(d) Cycle of nutrients

Que. 2) Complete the following equation of Net primary productivity.

NPP= GPP ___ _______.

Que. 3) Productivity is defined as the rate of …………………………………………………………………………….. production.

(a) Net primary

(b) Biomass

(d) All of them

Que. 4) Explain the factors on which primary productivity is dependent?

Que. 5) Define ‘Gross primary productivity’.

Que. 1)(b) Productivity

Que. 2) (d) –R.

Que. 3) (b) Biomass.

Que. 4) Answer: Availability of nutrients, environmental factors, plant species, and photosynthetic capacity of plants these are the factors on which primary productivity is dependent.

Que. 5) Answer: Gross primary productivity- During photosynthesis process, the rate of production of organic matter is called as GPP or Gross primary productivity.

Case study 3

You may have heard of the earthworm being referred to as the farmer’s ‘friend’. This is so because they help in the breakdown of complex organic matter as well as in loosening of the soil. Similarly, decomposers break down complex organic matter into inorganic substances like carbon dioxide, water and nutrients and the process is called decomposition. Dead plant remains such as leaves, bark, flowers and dead remains of animals, including fecal matter, constitute detritus, which is the raw material for decomposition. The important steps in the process of decomposition are fragmentation, leaching, catabolism, humification and mineralisation. Detritivores (e.g., earthworm) break down detritus into smaller particles. This process is called fragmentation. By the process of leaching, watersoluble inorganic nutrients go down into the soil horizon and get precipitated as unavailable salts. Bacterial and fungal enzymes degrade detritus into simpler inorganic substances. This process is called as catabolism. It is important to note that all the above steps in decomposition operate simultaneously on the detritus (Figure 14.1). Humification and mineralisation occur during decomposition in the soil. Humification leads to accumulation of a dark coloured amorphous substance called humus that is highly resistant to microbial action and undergoes decomposition at an extremely slow rate. Being colloidal in nature it serves as a reservoir of nutrients. The humus is further degraded by some microbes and release of inorganic nutrients occur by the process known as mineralisation. Decomposition is largely an oxygen-requiring process.

The rate of decomposition is controlled by chemical composition of detritus and climatic factors. In a particular climatic condition, decomposition rate is slower if detritus is rich in lignin and chitin, and quicker, if detritus is rich in nitrogen and water-soluble substances like sugars. Temperature and soil moisture are the most important climatic factors that regulate decomposition through their effects on the activities of soil microbes. Warm and moist environment favour decomposition whereas low temperature and anaerobiosis inhibit decomposition resulting in build-up of organic materials.

Que. 1) Which of the following is a raw material for decomposition?

(b) Dead Plant

(d) Animals

Que. 2) When water soluble inorganic nutrients goes down in the soil and precipitated as unavailable salts, then the process is called as ……………………………………………………………………………………… .

(a) Catabolism

(b) Fermentation

(d) Leaching

Que. 3) ……………..……………………………………………………… is required in the decomposition process.

(b) Phosphorous

(d) Nitrogen

Que. 4) What is meant by catabolism?

Que. 5) Write a very short note on Mineralisation from above paragraph.

Que. 1)(b) Dead Plant.

Que. 2) (d) Leaching.

Que. 3) (a) Oxygen.

Que. 4) Answer: When the fungal and bacterial enzymes degrade detritus and convert it into simpler inorganic substance, then it is called as Catabolism.

Que. 5) Answer: In this process, some microbes degrade humus. The inorganic nutrients are released by the process and the process is known as Mineralisation.

Case study 4

Except for the deep sea hydro-thermal ecosystem, sun is the only source of energy for all ecosystems on Earth. Of the incident solar radiation less than 50 per cent of it is photosynthetically active radiation (PAR). We know that plants and photosynthetic bacteria (autotrophs), fix Sun’s radiant energy to make food from simple inorganic materials. Plants capture only 2-10 per cent of the PAR and this small amount of energy sustains the entire living world. So, it is very important to know how the solar energy captured by plants flows through different organisms of an ecosystem. All organisms are dependent for their food on producers, either directly or indirectly. The green plant in the ecosystem are called producers. In a terrestrial ecosystem, major producers are herbaceous and woody plants. Likewise, producers in an aquatic ecosystem are various species like phytoplankton, algae and higher plants. You have read about the food chains and webs that exist in nature. Starting from the plants (or producers) food chains or rather webs are formed such that an animal feeds on a plant or on another animal and in turn is food for another. The chain or web is formed because of this interdependency. No energy that is trapped into an organism remains in it for ever. The energy trapped by the producer, hence, is either passed on to a consumer or the organism dies. Death of organism is the beginning of the detritus food chain/web. All animals depend on plants (directly or indirectly) for their food needs.

They are hence called consumers and also heterotrophs. If they feed on the producers, the plants, they are called primary consumers, and if the animals eat other animals which in turn eat the plants (or their produce) they are called secondary consumers. Likewise, you could have tertiary consumers too. Obviously the primary consumers will be herbivores. Some common herbivores are insects, birds and mammals in terrestrial ecosystem and molluscs in aquatic ecosystem.

Que. 1) ………………………………………………………………………. Is an herbivore organism in the aquatic ecosystem.

(a) Molluscs

(b) Insects

Que. 2) In the ecosystem, green plants are ……………………………………………………………………………………… .

(a) Consumers

(b) Decomposers

Que. 3) PAR is a …………………………………….……………………………… .

(a) Powerful Atomic Radiation.

(b) Photosynthetically Atomic Radiation.

(d) Powerful Active Radiation.

Que. 4) Which ecosystem on earth does not require sun as an energy source?

Que. 5) Name any two producers from aquatic ecosystem.

Que. 1)(a) Molluscs.

Que. 2) (c) Producers.

Que. 3) (c) Photosynthetically Active Radiation.

Que. 4) Answer: The deep sea hydro-thermal ecosystem is the ecosystem on earth that does not require sun as an energy source.

Que. 5) Answer: Algae and phytoplankton both are producers in an aquatic ecosystem.

Case study 5

The consumers that feed on these herbivores are carnivores, or more correctly primary carnivores (though secondary consumers). Those animals that depend on the primary carnivores for food are labelled secondary carnivores. A simple grazing food chain (GFC) is depicted below:

The detritus food chain (DFC) begins with dead organic matter. It is made up of decomposers which are heterotrophic organisms, mainly fungi and bacteria. They meet their energy and nutrient requirements by degrading dead organic matter or detritus. These are also known as saprotrophs (sapro: to decompose). Decomposers secrete digestive enzymes that breakdown dead and waste materials into simple, inorganic materials, which are subsequently absorbed by them. In an aquatic ecosystem, GFC is the major conduit for energy flow. As against this, in a terrestrial ecosystem, a much larger fraction of energy flows through the detritus food chain than through the GFC. Detritus food chain may be connected with the grazing food chain at some levels: some of the organisms of DFC are prey to the GFC animals, and in a natural ecosystem, some animals like cockroaches, crows, etc., are omnivores. These natural interconnection of food chains make it a food web. How would you classify human beings!

Que. 1) ………………………………………………………………………….. is a beginning of Detritus food chain.

(a) Living organic matter

(b) Producers

(d) Consumers

Que. 2) The meaning of sapro word in the saprotrophs is ………………………………………………………………………………………… .

(a) To produce

(b) To divide

(d) To decompose

Que. 3) GFC is a ………………………………………………………………………. .

(a) Global food chain

(b) Grazing food chain

(d) Grazing form chain

Que. 4) Write a short note on Grazing food chain.

Que. 5) What is ‘Food web’.

Que. 1)(c) Dead organic matter.

Que. 2) (d) To decompose.

Que. 3) (b) Grazing food chain.

Que. 4) Answer: The producers are present in beginning of grazing food chain. Grass is taken as producer in this chain. Then goat is primary consumer because it eats or consume grass. Man are secondary consumers in the chain because man consume goat which consumes grass.

Que. 5) Answer: The normal interconnection of food chain is known as Food web.

Case study 6

An important characteristic of all communities is that their composition and structure constantly change in response to the changing environmental conditions. This change is orderly and sequential, parallel with the changes in the physical environment. These changes lead finally to a community that is in near equilibrium with the environment and that is called a climax community. The gradual and fairly predictable change in the species composition of a given area is called ecological succession. During succession some species colonise an area and their population become more numerous whereas populations of other species decline and even disappear. The entire sequence of communities that successively change in a given area are called sere(s). The individual transitional communities are termed seral stages or seral communities.

In the successive seral stages there is a change in the diversity of species of organisms, increase in the number of species and organisms as well as an increase in the total biomass. The present day communities in the world have come to be because of succession that has occurred over millions of years since life started on earth. Actually succession and evolution would have been parallel processes at that time.Examples of areas where primary succession occurs are newly cooled lava, bare rock, newly created pond or reservoir. The establishment of a new biotic community is generally slow. Before a biotic community of diverse organisms can become established, there must be soil. Depending mostly on the climate, it takes natural processes several hundred to several thousand years to produce fertile soil on bare rock.

Secondary succession begins in areas where natural biotic communities have been destroyed such as in abandoned farm lands, burned or cut forests, lands that have been flooded. Since some soil or sediment is present, succession is faster than primary succession.

Que. 1) A succeseful change of entire sequence of communities in a given area is known as …………………………………………………………………………………… .

(a) Ecological succession

(d) Community

Que. 2) In a given area, when species composition predictably changes then it is a ………………………………………………………………………………… .

(b) Climax community

(d) Ecological succession

Que. 3) …………………………………………………………………… is the area where secondary succession begins.

(a) Cut forests

(b) Cooled lava

(d) Bare rock

Que. 4) Give an example of area where primary succession occurs.

Que. 5) Where does secondary succession begins?

Que. 1)(b) Sere

Que. 2) (a) Cut forests.

Que. 3) (d) Ecological succession.

Que. 4) Answer: Primary succession mainly occurs in the area such as bare rock, newly created ponds and newly cooled lava.

Que. 5) Answer: The natural biotic communities were destroyed in an area. From that area secondary succession begins.

We have a strong team of experienced Teachers who are here to solve all your exam preparation doubts

The second coming by william butler yeats mcq question and answers, case study questions class 7 maths algebraic expressions, assertion and reason questions class 7 maths chapter 12 algebraic expressions, sikkim scert class 3 english chapter 5 rivers and mountains solution.

Username or Email Address

Remember Me

Gurukul of Excellence

Classes for Physics, Chemistry and Mathematics by IITians

Join our Telegram Channel for Free PDF Download

Case Study and Passage Based Questions for Class 12 Biology Chapter 2 Sexual Reproduction in Flowering Plants

Last modified on: 2 years ago
Reading Time: 4 Minutes

In CBSE Class 12 Biology Paper, Students will have to answer some questions based on Assertion and Reason . There will be a few questions based on case studies and passage based as well. In that, a paragraph will be given, and then the MCQ questions based on it will be asked.

Here, we have provided case based/passage based questions for Class 12 Biology Chapter 2 Sexual Reproduction in Flowering Plants .

Case Study/Passage Based Questions for Class 12 Biology

Question 1:

A biology student Advik, read an article on apple being a false fruit. He asked his teacher about how fruit can be called false fruit and was explained about the development of fruits.

(i) A true fruit is formed from (a) ovary (b) ovary and thalamus (c) ovary and calyx (d) ovary and receptacle

(ii) Fruit is a (a) post fertilisation product of pistel (b) product of flower (c) body having seeds (d) product of ovary

(iii) Parthenocarp is a fruit (a) formed from superior ovary (b) formed from inferior ovary (c) consisting of ripened ovary and thalamus (d) which does not possess seeds

(iv) A fruit when is constricted in between the seeds is (a) Regma (b) Samara (c) lomantium (d) Frllicle

(v) Schizocarpic fruit splits up into (a) Achenial fruit (b) Capsular (c) Schizocarpic (d) Drupe

Case Study and Passage Based Questions for Class 12 Biology Chapter 3 Human Reproduction

Case Study Questions for Class 12 Biology Chapter 8 Human Health and Diseases

Last modified on:2 years agoReading Time:6MinutesCase Study Questions for Class 12 Biology Chapter 8 Human Health and Diseases Question 1: In a study to test a new vaccine against a viral disease, mouse model testing is done. In this process, mice are vaccinated and their blood samples were tested. Mice developed mild disease symptom. After few…

Case Study Questions for Class 12 Biology Chapter 10 Microbes in Human Welfare

Last modified on:2 years agoReading Time:3MinutesCase Study Questions for Class 12 Biology Chapter 10 Microbes in Human Welfare Question 1: Villagers in a place near Chambur started planning to make power supply for agricultural purposes from cow dung. They have started a biogas plant for the purpose. Study the flow chart for biogas production given below…

Case Study Questions for Class 12 Biology Chapter 11 Biotechnology – Principles and Techniques

Last modified on:2 years agoReading Time:4MinutesCase Study Questions for Class 12 Biology Chapter 11 Biotechnology – Principles and Techniques Question 1: The DNA, which is transferred from one organism into another by joining it with the vehicle DNA is called passenger or foreign DNA. Generally three types of passenger DNAs are used. These are complementary DNA…

Case Study Questions for Class 12 Biology Chapter 12 Biotechnology and Its Applications

Last modified on:2 years agoReading Time:5MinutesCase Study Questions for Class 12 Biology Chapter 12 Biotechnology and Its Applications Question 1: Transgenic cows have extra gene or genes inserted into their DNA. Firstly the genes for the desired product is identified and sequenced. Then a gene construct containing this desired gene is introduced into female cow cells.…

Download CBSE Books

Exam Special Series:

Sample Question Paper for CBSE Class 10 Science (for 2024)
Sample Question Paper for CBSE Class 10 Maths (for 2024)
CBSE Most Repeated Questions for Class 10 Science Board Exams
CBSE Important Diagram Based Questions Class 10 Physics Board Exams
CBSE Important Numericals Class 10 Physics Board Exams
CBSE Practical Based Questions for Class 10 Science Board Exams
CBSE Important “Differentiate Between” Based Questions Class 10 Social Science
Sample Question Papers for CBSE Class 12 Physics (for 2024)
Sample Question Papers for CBSE Class 12 Chemistry (for 2024)
Sample Question Papers for CBSE Class 12 Maths (for 2024)
Sample Question Papers for CBSE Class 12 Biology (for 2024)
CBSE Important Diagrams & Graphs Asked in Board Exams Class 12 Physics
Master Organic Conversions CBSE Class 12 Chemistry Board Exams
CBSE Important Numericals Class 12 Physics Board Exams
CBSE Important Definitions Class 12 Physics Board Exams
CBSE Important Laws & Principles Class 12 Physics Board Exams
10 Years CBSE Class 12 Chemistry Previous Year-Wise Solved Papers (2023-2024)
10 Years CBSE Class 12 Physics Previous Year-Wise Solved Papers (2023-2024)
10 Years CBSE Class 12 Maths Previous Year-Wise Solved Papers (2023-2024)
10 Years CBSE Class 12 Biology Previous Year-Wise Solved Papers (2023-2024)
ICSE Important Numericals Class 10 Physics BOARD Exams (215 Numericals)
ICSE Important Figure Based Questions Class 10 Physics BOARD Exams (230 Questions)
ICSE Mole Concept and Stoichiometry Numericals Class 10 Chemistry (65 Numericals)
ICSE Reasoning Based Questions Class 10 Chemistry BOARD Exams (150 Qs)
ICSE Important Functions and Locations Based Questions Class 10 Biology
ICSE Reasoning Based Questions Class 10 Biology BOARD Exams (100 Qs)

✨ Join our Online JEE Test Series for 499/- Only (Web + App) for 1 Year

✨ Join our Online NEET Test Series for 499/- Only for 1 Year

Discover more from Gurukul of Excellence

Subscribe now to keep reading and get access to the full archive.

Type your email…

New QB365-SLMS
NEET Materials
JEE Materials
Banking first yr Materials
TNPSC Materials
DIPLOMA COURSE Materials
5th Standard Materials
12th Standard Materials
11th Standard Materials
10th Standard Materials
9th Standard Materials
8th Standard Materials
7th Standard Materials
6th Standard Materials
12th Standard CBSE Materials
11th Standard CBSE Materials
10th Standard CBSE Materials
9th Standard CBSE Materials
8th Standard CBSE Materials
7th Standard CBSE Materials
6th Standard CBSE Materials
Tamilnadu Stateboard
Scholarship Exams
Scholarships

Class 12th Biology - Principles of Inheritance and Variation Case Study Questions and Answers 2022 - 2023

By QB365 on 08 Sep, 2022

QB365 provides a detailed and simple solution for every Possible Case Study Questions in Class 12 Biology Subject - Principles of Inheritance and Variation, CBSE. It will help Students to get more practice questions, Students can Practice these question papers in addition to score best marks.

QB365 - Question Bank Software

Principles of inheritance and variation case study questions with answer key.

12th Standard CBSE

Final Semester - June 2015

Two independent monohybrid crosses were carried out involving a tall pea plant with a dwarf pea plant. In the first cross, the offspring population had equal number of tall and dwarf plants, whereas in the second cross, it was different. Work out the crosses and explain giving reasons for the difference in the offspring populations.

ABO blood group character in human population exhibits four possible phenotypes and six different genotypes. Explain the different mechanisms of inheritance involved in exhibiting the possibility of four phenotypes and six genotypes.

In pea plants, let symbol Y represent dominant yellow, symbol y, the recessive green, symbol R, the round seed shape, and symbol r, the wrinkled seed shape. A typical Mendelian dihybrid cross was carried out starting with homozygous dominant and recessive parents. Answer the following questions. (a) Write the genotype and phenotype of the F 1 offspring. (b) The genetic make up of the gametes produced by F 1 individual. (c) Give the phenotypic ratio of F 2 generation.

During a cytological study conducted on the chromosomes of certain insect species, it was observed that only 50% of the sperms had a specific structure after spermatogenesis. (a) Name the scientist who conducted the above experiment. (b) Name the structure, the scientist observed. (c) Give an example of an insect that could possibly show such a phenomenon and name the mechanism of sex determination. (d) Write the sex chromosome complement of males and females.

Read the following and answer any four questions from (i) to (v) given below: Prashant wanted to find the genotype of a pea plant bearing purple coloured flowers in his kitchen garden. For this, he crossed purple flowered plant with white flowered plant. As a result, all plants which were produced had purple flower only. Upon selfing these plants, 75 purple flower plants and 25 white flower plants were produced. Now, he can determine the genotype of a purple flowered plant by crossing it with a white flowered plant. (i) Which of the following cannot be derived from the crosses done by Prashant?

(ii) To determine the genotype of a purple flowered plant, Prashant crossed this plant with a white flowered plant. This cross represents a

(iii) In white flowered plant, allele is expressed in

(iv) The character, i.e., purple colour of the flowers that appeared in the first filial generation is called

(v) Assertion : A geneticist crossed two plants and he obtained 50% purple flowered plants and 50% white flowered plants. Reasons : Purple coloured flower plant might be heterozygous.

(ii) Teacher asked to conduct an experiment on Drosophila because

(iii) Genes white eyed and yellow bodied located very close to one another on the same chromosome tend to be transmitted together are called

(iv) Select the correct statement regarding the given experiment.

(v) Assertion : When yellow bodied, white eyed Drosophila females were hybridised with brown-bodied, red eyed males; and FI progeny was intercross ed, F 2 ratio deviated from 9: 3: 3: 1. Reason : When two genes in a dihybrid are on the same chromosome, the proportion of parental gene combinations are much higher than the non-parental type.

Read the following and answer any four questions from (i) to (v) given below : Turner's syndrome is an example of mono somy. It is formed by the union of an allosome free egg and a normal 'X' containing sperm or a normal egg and an allosome free sperm. The individual has 2n = 45 chromosomes (44 + X0) instead of 46. Such individuals are sterile females who have rudimentary ovaries, under developed breasts, small uterus, short stature, webbed neck and abnormal intelligence. They may not menstruate or ovulate. This disorder can be treated by giving female sex hormone to the women from the age of puberty to make them develop breasts and have menstruation. This makes them feel more normal. (i) Number of Barr body present in a female with Turner's syndrome is

(ii) Turner's syndrome is an example of

(iii) Turner's syndrome is a/an

(iv) Which of the following statements regarding Turner's syndrome is incorrect?

(v) Assertion : Turner's syndrome is caused due to absence of anyone of the X and Y sex chromosome. Reason : Individuals suffering from Turner's syndrome show masculine as well as feminine development

Read the following and answer any four questions from (i) to (v) given below : According to Mendel, one gene control the expression of one character only. The ability of a gene to have multiple phenotypic effect because it influences a number of characters is an exception. The gene having a multiple phenotypic effect because of its ability to control of two or more characters can be seen in cotton. In cotton, a gene for the lint also influences the height of plant, size of the ball, number of ovules and viability of seeds. (i) Genes with multiple phenotypic effects are known as

(ii) Which of the following disorder is an example of genes with multiple phenotypic effects?

(iii) Which of the following is an example of gene with multiple phenotypic effect?

(iv) Which of the following statements is not correct regarding genes with multiple phenotypic effect?

(v) Assertion : In garden pea, the gene which controls the flower colour also controls the colour of the seed coat and presence of red spots in the leafaxils. Reason : A pleiotropic gene influences more than one trait.

Read the following and answer any four questions from (i) to (v) given below: Haemophilia is a sex linked disease which is also known as bleeder's disease as the patient will continue to bleed even from a minor cut since he or she does not possess the natural phenomenon of blood clotting due to absence of anti-haemophilic globulin or factor VIII and plasma thromboplastin factor IX essential for it. As a result of continuous bleeding the patient may die of blood loss. Colour blindness is another type of sex linked trait in which the eye fails to distinguish red and green colours. Vision is however, not affected and the colour blind can, lead a normal life, reading, writing and driving (distinguishing traffic lights by their position).(i) If a haemophilic man marries a woman whose father was haemophilic and mother was normal then which of the following holds true for their progenies?

(ii) A man whose father was colourblind and mother was normal marries a woman whose father was haemophilic and mother was normal. Which of the following is true for their progenies? [Note: Percentage is from the total number of progenies.

(iii) Which of the following statements is incorrect regarding haemophilia?

(iv) Anup is having colourblindness and is married to Soni who is normal. What is the chance that their son will have the disease?

(ii) Due to mutation Y the shape of RBCs under oxygen tension will be

(iii) GUG is code for

(iv) Which of the following genotype shows diseased phenotype due to mutation Y?

*****************************************

Principles of inheritance and variation case study questions with answer key answer keys.

(a) Genotype of: A - Tt, B - TT, C - tt, D - Tt (b) The phenotypic ratio is 3 Tall : I Dwarf (c) It is a monohybrid cross.

Mechanisms of Inheritance. (i) Multiple allelism. (a) The gene I controlling blood group character exists in three allelic forms, l A , I B and i. (ii) Dominance. (a) The allele IA is dominant over the allele i and the allele IB is also dominant over the allele, i. (iii) Codominance. (a) The alleles I A and I B are equally dominant and both of them express themselves, when they are present together; blood group AB results.

(a) (i) Genotype (W) - I A I A /I A i (ii) Genotype (X) - ii (iii) Phenotype (Y) - B (iv) Phenotype (Z) - AB (b) - Phenotype Y shows dominance of I B over i. (i) Phenotype Z shows codominance, i.e., I A and I B are equally dominant.

(a) Henking (b) X-chromosome (c) (i) Grasshopper (ii) It shows XO type of sex-determination. (d) (i) Males are XO (ii) Females are XX.

(a) It is an autosomal recessive trait. (i) The trait that is hidden in the parents (generation 1) has appeared in the daughter (generation II). (b) (i) Parents - Mother Aa, Father Aa (ii) Son (generation II) - Aa. (c) First grand daughter - Aa.

(a) Father - I A i, Mother I B i (b) (i) -I B i (ii) I A i or ii (C) (i) The alleles I A and I B ofthe blood group character are equally dominant and both of them express themselves when present together, resulting in blood group AB.

(i) (c) : By conducting the given cross teacher can conclude that the genes for eye colour and body colour are linked. Thus these genes were very tightly linked and showed very low recombination. (ii) (d) (iii) (c) : Genes located very close to one another on the same chromosome tend to be transmitted together and are called linked genes. (iv) (a) : The physical distance between two genes determines both the strength of the linkage and the frequency of the crossing over between two genes. The strength of the linkage increases with the closeness of the two genes. On the other hand the frequency of crossing over increases with the increase in the physical distance between the two genes. (v) (a) : In Drosophila, the genes for body and eye colour are located on X chromosome. When two genes in a dihybrid cross are situated on the same chromosome, the proportion of parental gene combination are higher than non-parental type. This occurs due to physical association or linkage of the two genes while non-parental gene combinations due to recombination between two genes. Thus, linkage and recombirtation deviates the ratio from Mendelian ratio of a dihybrid cross (9 : 3 : 3 : 1).

(i) (a) : Barr body is a structure consisting of a condensed X chromosome that is found in nondividing nuclei of female mammals. The presence of Barr body is used to confirm the sex of athletes in sex determination tests. It is named after the Canadian anatomist M.L. Barr, who identified it. The number of Barr bodies is one less than total number of X chromosomes. In Turner's syndrome genotype is 45 + X0,so, the number of Barr body is O. (ii) (a) : Failure of segregation of chromatids during cell division result in the gain or loss of a chromosomes called aneuploidy. For example, Turner's syndrome results due to loss of X chromosome in human females. (iii) (d) : Turner's syndrome is a chromosomal disorder that occurs due to absence of one chromosome. (iv) (c) : In Turner's syndrome individual lacks one X chromosome. This situation is known as monosomy. (v) (d): Turner's syndrome occurs due to absence of X chromosome. Individuals having a single X chromosome 22A + X0 (45) have female sexual differentiation but ovaries are rudimentary. Other associated phenotypes of this condition are short stature, webbed-neck, broad chest, lack of secondary sexual characteristics and sterility. Thus, any imbalance in the copies of the sex chromosomes may disrupt the genetic information necessary for normal sexual development.

(i) (c) (ii) (d) : The ability of a gene to have multiple phenotypic effects because it influences a number of characters simultaneously is known as pleiotropy. In human beings pleiotropy is exhibited by syndromes, i.e., sickle cell anaemia and phenylketonuria. (iii) (a) : Kernel colour in wheat, height in human beings and skin colour in human beings are examples of polygenic inheritance, i.e., inheritance controlled by three or more genes. In Drosophila, white eye mutation pleiotropic effect, it causes depigmentation in many part of the body. (iv) (d) (v) (a)

Related 12th Standard CBSE Biology Materials

12th standard cbse syllabus & materials, cbse 12th physics wave optics chapter case study question with answers, cbse 12th physics ray optics and optical instruments chapter case study question with answers, cbse 12th physics nuclei chapter case study question with answers, cbse 12th physics moving charges and magnetism chapter case study question with answers, cbse 12th physics electromagnetic induction chapter case study question with answers, cbse 12th physics atoms chapter case study question with answers, 12th physics alternating current chapter case study question with answers cbse, 12th maths vector algebra chapter case study question with answers cbse, 12th maths three dimensional geometry chapter case study question with answers cbse, 12th maths probability chapter case study question with answers cbse, 12th maths linear programming chapter case study question with answers cbse, 12th maths differential equations chapter case study question with answers cbse, 12th maths continuity and differentiability chapter case study question with answers cbse, 12th maths application of integrals chapter case study question with answers cbse, 12th chemistry the d and f block elements chapter case study question with answers cbse.

Class VI to XII

Tn state board / cbse, 3000+ q&a's per subject, score high marks.

12th Standard CBSE Study Materials

12th Standard CBSE Subjects

Andhra Pradesh
Chhattisgarh
West Bengal
Madhya Pradesh
Maharashtra
Jammu & Kashmir
NCERT Books 2022-23
NCERT Solutions
NCERT Notes
NCERT Exemplar Books
NCERT Exemplar Solution
States UT Book
School Kits & Lab Manual
NCERT Books 2021-22
NCERT Books 2020-21
NCERT Book 2019-2020
NCERT Book 2015-2016
RD Sharma Solution
TS Grewal Solution
TR Jain Solution
Selina Solution
Frank Solution
Lakhmir Singh and Manjit Kaur Solution
I.E.Irodov solutions
ICSE - Goyal Brothers Park
ICSE - Dorothy M. Noronhe
Sandeep Garg Textbook Solution
Micheal Vaz Solution
S.S. Krotov Solution
Evergreen Science
KC Sinha Solution
ICSE - ISC Jayanti Sengupta, Oxford
ICSE Focus on History
ICSE GeoGraphy Voyage
ICSE Hindi Solution
ICSE Treasure Trove Solution
Thomas & Finney Solution
SL Loney Solution
SB Mathur Solution
P Bahadur Solution
Narendra Awasthi Solution
MS Chauhan Solution
LA Sena Solution
Integral Calculus Amit Agarwal Solution
IA Maron Solution
Hall & Knight Solution
Errorless Solution
Pradeep's KL Gogia Solution
OP Tandon Solutions
Sample Papers
Previous Year Question Paper
Value Based Questions
CBSE Syllabus
CBSE MCQs PDF
Assertion & Reason
New Revision Notes
Revision Notes
HOTS Question
Marks Wise Question
Toppers Answer Sheets
Exam Paper Aalysis
Concept Map
CBSE Text Book
Additional Practice Questions
Vocational Book
CBSE - Concept
KVS NCERT CBSE Worksheets
Formula Class Wise
Formula Chapter Wise
JEE Crash Course
JEE Previous Year Paper
Important Info
JEE Mock Test
JEE Sample Papers
SRM-JEEE Mock Test
VITEEE Mock Test
BITSAT Mock Test
Manipal Engineering Mock Test
AP EAMCET Previous Year Paper
COMEDK Previous Year Paper
GUJCET Previous Year Paper
KCET Previous Year Paper
KEAM Previous Year Paper
Manipal Previous Year Paper
MHT CET Previous Year Paper
WBJEE Previous Year Paper
AMU Previous Year Paper
TS EAMCET Previous Year Paper
SRM-JEEE Previous Year Paper
VITEEE Previous Year Paper
BITSAT Previous Year Paper
UPSEE Previous Year Paper
CGPET Previous Year Paper
CUSAT Previous Year Paper
AEEE Previous Year Paper
Crash Course
Previous Year Paper
NCERT Based Short Notes
NCERT Based Tests
NEET Sample Paper
Previous Year Papers
Quantitative Aptitude
Numerical Aptitude Data Interpretation
General Knowledge
Mathematics
Agriculture
Accountancy
Business Studies
Political science
Enviromental Studies
Mass Media Communication
Teaching Aptitude
NAVODAYA VIDYALAYA
SAINIK SCHOOL (AISSEE)
Mechanical Engineering
Electrical Engineering
Electronics & Communication Engineering
Civil Engineering
Computer Science Engineering
CBSE Board News
Scholarship Olympiad
School Admissions
Entrance Exams
All Board Updates
Miscellaneous
State Wise Books
Engineering Exam

Biology Case Study for Class 12 (Download Free PDF)

Free pdf download.

SHARING IS CARING If our Website helped you a little, then kindly spread our voice using Social Networks. Spread our word to your readers, friends, teachers, students & all those close ones who deserve to know what you know now.

Biology Case Study for Class 12

While preparing for the board exams, students are being judged on different levels of skills, such as writing, reading, etc. Biology Case Study for Class 12 questions are one of them that helps in assessing critical thinking.

The Central Board of Secondary Education will be asking the case study questions in the Class 12 board examination. Therefore, here on this page, we have provided the Biology Case Study for Class 12 at free of cost. Our subject matter experts have prepared Case Study questions so that Apart from the basic standard questions, students can have a variety of problems to solve.

Just like MCQs, and other written types questions Biology Case Study for Class 12 questions will impact the overall performance of a student. Therefore for the convenience of the students we have provided the download links here, so that they can easily access the Class 12 Case Study.

Download Chapter Wise Biology Case Study for Class 12 Question and Answers PDF

There are lots of chapters in class 12 Biology from which Class 12 Case Study Questions can be framed. Going through such types of questions help the students to assess their understanding level in the topics discussed in NCERT Class 12 Biology Books. By practicing the Class 12 Case Study Questions for Biology students will be very confident to ace the board exam. Also the Biology case study will be very useful for the NEET exam preparation.

Doing a regular practice of Class 12 Biology Case Study questions is a great way to score higher marks in the board exams as it will help students to develop a grip on the concepts.

Here our subject experts have crafted the Subject Wise Case Study For Class 12. Download Subject Wise CBSE Case Study Class 12 Question and Answers PDF from the below given links.

Case Study Questions Class 12 Chapter 2 Sexual Reproduction in Flowering Plants

Case Study Questions Class 12 Chapter 3 Human Reproduction

Case Study Questions Class 12 Chapter 4 Reproductive Health

Case Study Questions Class 12 Chapter 5 Principles of Inheritance & Variation

Case Study Questions Class 12 Chapter 6 Molecular Basic of Inheritance

Case Study Questions Class 12 Chapter 8 Human Health And Diseases

Case Study Questions Class 12 Chapter 10 Microbes in Human Welfare

Case Study Questions Class 12 Chapter 11 Biotechnology - Principles & Processes

Case Study Questions Class 12 Chapter 12 Biotechnology And Its Applications

Case Study Questions Class 12 Chapter 13 Organisms And Populations

Case Study Questions Class 12 Chapter 15 Biodiversity And Conversation

Case study types of questions are generally descriptive that helps to gather more information easily so, it is kinda easy to answer. However, our subject matter experts have given the solutions of all the Biology Case Study for Class 12 Biology questions.

Passage Based Class 12 Biology Case Study Questions in PDF

CBSE Class 12 Case studies are known as Passage Based Questions. These types of problems usually contain a short/long paragraph with 4 to 5 questions.

Students can easily solve Passage Based Class 12 Case Study Questions by reading those passages. By reading the passage students will get the exact idea of what should be the answers. Because the passage already contains some vital information or data. However a better understanding of the basic concepts that can be learned from the NCERT Class 12 Textbooks will aid in solving the Case based questions or passage based questions.

How to Download CBSE Case Study of Class 12 Biology ?

Follow the below given simple steps to know how to download CBSE Case Study of Class 12 Biology:-

Open Selfstudys website in your browser
Go to the navigation menu that look like this
Now, click on CBSE and then Case Study respectively
A new page will open, where you have to click on “Class 12”
Now, you are ready to select the subject for which you want to download the case study questions.

How to Solve Biology Case Study Based Questions of Class 12?

There are very simple methods that a student should keep in mind while solving Biology Case Study for Class 12 for any subject:

Read each line of paragraph carefully and pay attention to the given data/numbers. Often questions are framed according to the highlighted data of the passage.
Since case study questions are often framed in Multiple choice questions, students should have the knowledge of elimination methods in MCQs.
Having a good understanding of the topics that are discussed in CBSE Class 12 Books are ideal to Solve Case Study Based Questions of Class 12.

Features Of Class 12 Biology Case Study Questions And Answers PDF

The three most noticeable features of Class 12 Biology Case Study Questions And Answers Pdf are -

It Is Free To Use: Keeping in mind the need of students and to help them in doing Self Study, our team has made all the PDF of Biology Case Study for Class 12 free of cost.
Answers Are Given: Not only the PDFs are free provided but answers are given for all the questions of Biology Case Study for Class 12.
PDF Can Be Downloaded Or Viewed Online: Many students don’t like to download the PDFs on their device due to the shortage of storage. Therefore, CBSE Class 12 Case Study questions are made available here in online format, so that students can view them online. However, through the Selfstudys app, a learner can download the PDFs too.

Benefits of Using CBSE Class 12 Biology Case Study Questions and Answers

The CBSE Class 12 Biology Case Study Questions and Answers can help a student in several ways:

In Exam Preparation: Those who go through the Biology Case Study for Class 12 will find support during the exam preparation as case based questions are also asked in the CBSE Class 12 Board examination.
Help in brushing up the previous learnings: No matter how brilliant you are, you have to revise the studied topics time and again to keep them refreshed. And in this task, the CBSE Class 12 Case Study Questions and Answers can help a lot.
To develop the critical thinking: Able to analyse information and make an objective judgement is a skill that is known as critical thinking. A student of class 12 can use Biology Case Study for Class 12 with answers to develop critical thinking so that they can make better decisions in their life and in the board examination.

Manipal MET 2024 Application (Released) (All Pages)

NCERT Solutions for Class 12 Maths
NCERT Solutions for Class 10 Maths
CBSE Syllabus 2023-24
Social Media Channels
Login Customize Your Notification Preferences

Second click on the toggle icon

Provide prime members with unlimited access to all study materials in PDF format.

Allow prime members to attempt MCQ tests multiple times to enhance their learning and understanding.

Provide prime users with access to exclusive PDF study materials that are not available to regular users.

Not Able To Find Desired Paper or Worksheet SEARCH

Find papers & worksheets search, class 12 biology case study questions chapter 12 biotechnology and its application.

(0) Comments
6 Downloads

Related Papers

Click to view more related papers, display_name = "class 11" && $paper->display_name = "class 12") { // echo $paper->display_name." questions papers and worksheets"; } //else { // echo $paper->display_name." sample papers and previous year papers"; //} //>, important questions for class 12 biology chapter wise with answers.

Get here all the Important questions for Class 12 Biology chapter wise as free PDF download. Here you will get Extra Important Questions with answers, assertion reasoning and Multiple Choice Questions (MCQ's) chapter wise in Printable format. Class 12 Biology has 16 important chapters covering various important topics related to human physiology evolution, diseases, genetics, organisms, populations, etc.Solving Chapter wise questions is one of the best ways to prepare for the examination. Students are advised to understand the concepts and theories of Biology properly before the exam. You can easily find 1 Mark, 2 marks, 3 marks, and 5 marks questions from each chapter of Class 12 Biology and prepare for exam more effectively. These preparation material for Class 12 Biology , shared by teachers, parents and students, are as per latest NCERT and CBSE Pattern syllabus and assure great success in achieving high score in Final CBSE Board Examinations.

Latest MCQ's and Important Questions for CBSE Class 12 Biology

Reproduction in Organisms class 12 important questions pdf Sexual Reproduction in Flowering Plants class 12 important questions pdf Human Reproduction class 12 important questions pdf Reproductive Health class 12 important questions pdf Principles of Inheritance and Variation class 12 important questions pdf Molecular Basis of Inheritance class 12 important questions pdf Evolution class 12 important questions pdf Human Health and Diseases class 12 important questions pdf Strategies for Enhancement in Food Production class 12 important questions pdf Microbes in Human Welfare class 12 important questions pdf Biotechnology Principles and Processes class 12 important questions pdf Organisms and Populations class 12 important questions pdf Ecosystem class 12 important questions pdf Biodiversity and Conservation class 12 important questions pdf Environmental Issues class 12 important questions pdf important questions of chapter 1 biology class 12 important questions of chapter 2 biology class 12 important questions of chapter 3 biology class 12 important questions of chapter 4 biology class 12 important questions of chapter 5 biology class 12 important questions of chapter 6 biology class 12 important questions of chapter 7 biology class 12 important questions of chapter 8 biology class 12 important questions of chapter 9 biology class 12 important questions of chapter 10 biology class 12 important questions of chapter 11 biology class 12 important questions of chapter 12 biology class 12 important questions of chapter 13 biology class 12 important questions of chapter 14 biology class 12 important questions of chapter 15 biology class 12 important questions of chapter 16 biology class 12 Reproduction in Organisms class 12 mcq Sexual Reproduction in Flowering Plants class 12 mcq Human Reproduction class 12 mcq Reproductive Health class 12 mcq Principles of Inheritance and Variation class 12 mcq Molecular Basis of Inheritance class 12 mcq Evolution class 12 mcq Human Health and Diseases class 12 mcq Strategies for Enhancement in Food Production class 12 mcq Microbes in Human Welfare class 12 mcq Biotechnology Principles and Processes class 12 mcq Biotechnology: and its Application class 12 mcq Organisms and Populations class 12 mcq Ecosystem class 12 mcq Biodiversity and Conservation class 12 mcq Environmental Issues class 12 mcq case based questions class 12 biology chapter 1 case based questions class 12 biology chapter 2 case based questions class 12 biology chapter 3 case based questions class 12 biology chapter 4 case based questions class 12 biology chapter 5 case based questions class 12 biology chapter 6 case based questions class 12 biology chapter 7 case based questions class 12 biology chapter 8 case based questions class 12 biology chapter 9 case based questions class 12 biology chapter 10 case based questions class 12 biology chapter 11 case based questions class 12 biology chapter 12 case based questions class 12 biology chapter 13 case based questions class 12 biology chapter 14 case based questions class 12 biology chapter 15 case based questions class 12 biology chapter 16 Assertion Reason questions Biology Class 12 Chapter 1 Assertion Reason questions Biology Class 12 Chapter 2 Assertion Reason questions Biology Class 12 Chapter 3 Assertion Reason questions Biology Class 12 Chapter 4 Assertion Reason questions Biology Class 12 Chapter 5 Assertion Reason questions Biology Class 12 Chapter 6 Assertion Reason questions Biology Class 12 Chapter 7 Assertion Reason questions Biology Class 12 Chapter 8 Assertion Reason questions Biology Class 12 Chapter 9 Assertion Reason questions Biology Class 12 Chapter 10 Assertion Reason questions Biology Class 12 Chapter 11 Assertion Reason questions Biology Class 12 Chapter 12 Assertion Reason questions Biology Class 12 Chapter 13 Assertion Reason questions Biology Class 12 Chapter 14 Assertion Reason questions Biology Class 12 Chapter 15 Assertion Reason questions Biology Class 12 Chapter 16

Total Papers :

CBSE Class 12 Biology Syllabus

Reproduction in Organisms
Sexual Reproduction in Flowering Plants
Human Reproduction
Reproductive Health
Principles of Inheritance and Variation
Molecular Basis of Inheritance
Human Health and Diseases
Strategies for Enhancement in Food Production
Microbes in Human Welfare
Biotechnology - Principles and Processes
Biotechnology and its Application
Organisms and Populations
Biodiversity and its Conservation
Environmental Issues

Course Syllabus Details

Unit vi. reproduction.

Chapter 1: Reproduction in Organisms

A characteristic feature of all organisms for continuation of species
Asexual reproduction
Sexual reproduction
Modes-Binary fission
Sporulation
Fragmentation
vegetative propagation in plants

Chapter 2: Sexual Reproduction in Flowering Plants

Flower structure
Development of male and female gametophytes
Outbreeding devices
Pollen-Pistil interaction
Double fertilization
Post fertilization Events-Development of endosperm and embryo
Development of seed and formation of fruit
Parthenocarpy
Polyembryony
Significance of seed and fruit formation

Chapter 3: Human Reproduction

Male and female reproductive systems
Microscopic anatomy of testis and ovary
Spermatogenesis
Menstrual cycle
Fertilisation embryo development up to blastocyst formation, implantation pregnancy and placenta formation (Elementary idea)
Parturition (Elementary idea)
Lactation (Elementary idea)

Chapter 4: Reproductive Health

Need for reproductive health and prevention of sexually transmitted diseases (STD)
Need and Methods
Contraception
Medical Termination of Pregnancy (MTP)
Amniocentesis
GIFT (Elementary idea for general awareness)

Unit VII. Genetics and Evolution

Chapter 5: Principles of Inheritance and Variation

Mendelian Inheritance
Incomplete dominance
Co-dominance
Multiple alleles
Inheritance of blood groups
Elementary idea of polygenic inheritance
Chromosome theory of inheritance
Chromosomes and genes
Linkage and crossing over
Haemophilia
Colour blindness
Thalassemia
Down's syndrome
Klinefelter's syndromes

Chapter 6: Molecular Basis of Inheritance

Search for genetic material and DNA as genetic material
Structure of DNA and RNA
DNA packaging
DNA replication
Central dogma
Transcription, genetic code, translation
Genome and human ganeome project
DNA fingerprinting

Chapter 7: Evolution

Origin of life
Biological evolution and evidences for biological evolution (Paleontological, comparative anatomy, embryology and molecular evidence)
Darwin's contribution
Modern Synthetic theory of Evolution
Variation (Mutation and Recombination)
Natural Selection with examples
Types of natural selection
Gene flow and genetic drift
Hardy - Weinberg's principle
Adaptive Radiation
Human evolution

Unit VIII. Biology and Human Welfare

Chapter 8: Human Health and Diseases

Common cold
Adolescence, drug and alcohol abuse

Chapter 9: Strategies for Enhancement in Food Production

Plant breeding
Tissue culture
Single cell protein
Biofortification
Apiculature
Animal husbandry

Chapter-10: Microbes in Human Welfare

In household food processing
Industrial production
Sewage treatment
Energy generation and as biocontrol agents
Biofertilizers
Production and judicious use

Unit IX. Biotechnology and Its Applications

Chapter 11: Biotechnology - Principles and Processes

Genetic engineering (Recombinant DNA technology).

Chapter 12: Biotechnology and its Application

Human insulin and vaccine production, gene therapy
Genetically modified organisms - Bt crops
Transgenic Animals; biosafety issues, biopiracy and patents

Unit X. Ecology and Environment

Chapter 13: Organisms and Populations

Ecological adaptations
Competition
Age distribution

Chapter 14: Ecosystem

Productivity
Decomposition
Energy flow
Pyramids of number, biomass, energy
Nutrient cycles (carbon and phosphorous)
Ecological succession
Carbon fixation
Pollination
Seed dispersal
Oxygen release (in brief)

Chapter-15: Biodiversity and its Conservation

Concept of biodiversity
Patterns of biodiversity
Importance of biodiversity
Loss of biodiversity
Endangered organisms
Red data book
Biosphere reserves
National parks
Sanctuaries
Ramsar sites

Chapter-16: Environmental Issues

Air pollution and its control
Water pollution and its control
Agrochemicals and their effects
Solid waste management
Radioactive waste management
Greenhouse effect and climate change
Ozone layer depletion
Deforestation
Any one case study as success story addressing environmental issue(s).

Practical Works

Part A: List of Experiments

Study pollen germination on a slide.
Collect and study soil from at least two different sites and study them for texture, moisture content, pH and water holding capacity. Correlate with the kinds of plants found in them.
Collect water from two different water bodies around you and study them for pH, clarity and presence of any living organisms.
Study the presence of suspended particulate matter in air at two widely different sites.
Study of plant population density by quadrat method.
Study of plant population frequency by quadrat method.
Prepare a temporary mount of onion root tip to study mitosis.
Study the effect of different temperatures and three different pH on the activity of salivary amylase on starch.
Isolation of DNA from available plant material such as spinach, green pea seeds, papaya, etc.

Part B: Study/observation of the following (Spotting)

Flowers adapted to pollination by different agencies (wind, insect, bird).
Pollen germination on stigma through a permanent slide.
Identification of stages of gamete development, i.e., T.S. of testis and T.S. of ovary through permanent slides (from grasshopper/mice).
Meiosis in onion bud cell or grasshopper testis through permanent slides.
T.S. of blastula through permanent slides.
Mendelian inheritance using seeds of different colour/sizes of any plant.
Prepared pedigree charts of any one of the genetic traits such as rolling of tongue, blood groups, ear lobes, widow's peak and colour blindness.
Controlled pollination - emasculation, tagging and bagging.
Common disease causing organisms like Ascaris, Entamoeba, Plasmodium, Roundworm through permanent slides or specimens. Comment on symptoms of disease that they cause.
Two plants and two animals (models/virtual images) found in xeric conditions. Comment upon their morphological adaptations.
Two plants and two animals (models/virtual images) found in aquatic conditions. Comment upon their morphological adaptations.

Structure of CBSE Biology Sample Paper for Class 12 Science is

For Preparation of exams students can also check out other resource material

CBSE Class 12 Biology Sample Papers

CBSE Class 12 Biology Worksheets

CBSE Class 12 Biology Question Papers

CBSE Class 12 Biology Test Papers

CBSE Class 12 Biology Revision Notes

Question Bank of Other Subjects of Class 12

Importance of Question Bank for Exam Preparation?

There are many ways to ascertain whether a student has understood the important points and topics of a particular chapter and is he or she well prepared for exams and tests of that particular chapter. Apart from reference books and notes, Question Banks are very effective study materials for exam preparation. When a student tries to attempt and solve all the important questions of any particular subject , it becomes very easy to gauge how much well the topics have been understood and what kind of questions are asked in exams related to that chapter.. Some of the other advantaging factors of Question Banks are as follows

Since Important questions included in question bank are collections of questions that were asked in previous exams and tests thus when a student tries to attempt them they get a complete idea about what type of questions are usually asked and whether they have learned the topics well enough. This gives them an edge to prepare well for the exam.Students get the clear idea whether the questions framed from any particular chapter are mostly either short or long answer type questions or multiple choice based and also marks weightage of any particular chapter in final exams.
CBSE Question Banks are great tools to help in analysis for Exams. As it has a collection of important questions that were asked previously in exams thereby it covers every question from most of the important topics. Thus solving questions from the question bank helps students in analysing their preparation levels for the exam. However the practice should be done in a way that first the set of questions on any particular chapter are solved and then solutions should be consulted to get an analysis of their strong and weak points. This ensures that they are more clear about what to answer and what can be avoided on the day of the exam.
Solving a lot of different types of important questions gives students a clear idea of what are the main important topics of any particular chapter that needs to focussed on from examination perspective and should be emphasised on for revision before attempting the final paper. So attempting most frequently asked questions and important questions helps students to prepare well for almost everything in that subject.
Although students cover up all the chapters included in the course syllabus by the end of the session, sometimes revision becomes a time consuming and difficult process. Thus, practicing important questions from Question Bank allows students to check the preparation status of each and every small topic in a chapter. Doing that ensures quick and easy insight into all the important questions and topics in each and every individual. Solving the important questions also acts as the revision process.

Question Bank of Other Classes

To Prepare better for CBSE paperclass; ?> " title="Download Free CBSE Papers">Ribblu.com brings to you all the previous years papers & worksheets of subject; ?//> for CBSE paperclass; ?>. This CBSE paper and worksheet can be instrumental in students achieving maximum marks in their exams. These Papers and worksheets help students gain confidence and make them ready to face their school examinations. These Papers and worksheets school wise, covers important concepts from an examination perspective. Students and parents can download all the available papers & worksheets directly in the form of PDF. One can use these papers and worksheets to get extensive practice and familiarise themselves with the format of the question paper.

You can help other users

Be the first to write comment .

Upload papers and the more your paper get downloaded the more you earn the points

You may send papers on email [email protected] along with userid

Downloaded by: Reenadharmendra Goswami
Downloaded by: Anu Antony

Rules and regulations for uploads

Write your comment, report this paper, how to earn points.

Upload Papers / Worksheets and Earn 50 Points.

The uploaded material should be original paper or worksheet of any school. Check out some videos on how to upload papers on ribblu

Rate & Review your school and Earn 25 Points.

Review any school that you may be knowing and once your review is approved, you will be credited with 25 points.

Answer on question posted on JustAsk and earn 15 points.

JustAsk is a platform where you can help others to find answers of any question. Share your Knowledge. Answer questions and once approved you will earn 15 points

Complete your profile and earn upto 25 Points.

Edit and complete your user profile and earn points. The more details you submit, the more points you will earn.

Download Ribblu Mobile App and you will (Earn 20 Points) (one time only)

CBSE Schools

CBSE Schools In Delhi
CBSE Schools In Noida
CBSE Schools In Greater Noida
CBSE Schools In Faridabad
CBSE Schools In Ghaziabad
CBSE Schools In Gurgaon
CBSE Schools In Mumbai
CBSE Schools In Pune
CBSE Schools In Bangalore
CBSE Schools In Hyderabad
CBSE Schools In Kolkata
CBSE Schools In Chennai
CBSE Schools In Patna
CBSE Schools In Meerut
CBSE Schools In Kanpur
CBSE Schools In Indore
CBSE Schools In Ludhiana
CBSE Schools In Dehradun

Top Schools

Schools In Delhi
Schools In Noida
Schools In Greater Noida
Schools In Faridabad
Schools In Ghaziabad
Schools In Gurgaon
Schools In Mumbai
Schools In Pune
Schools In Bangalore
Schools In Hyderabad
Schools In Kolkata
Schools In Chennai
Schools In Patna
Schools In Meerut
Schools In Kanpur
Schools In Indore
Schools In Ludhiana
Schools In Dehradun

Other Schools

Pre Nursery Schools In Noida
Day Boarding Schools In Noida
Pre Nursery Schools In Gurgaon
Pre Nursery Schools In Delhi
Play Schools In Delhi
Day Boarding Schools In Delhi

CBSE Papers

CBSE Class 1 Sample Papers
CBSE Class 2 Sample Papers
CBSE Class 3 Sample Papers
CBSE Class 4 Sample Papers
CBSE Class 5 Sample Papers
CBSE Class 6 Sample Papers
CBSE Class 7 Sample Papers
CBSE Class 8 Sample Papers

Class 12 Biology Case Study Questions Chapter 12 Biotechnology and its Application

Class 12 Biology Case Study of Chapter 6 Molecular Basis of Inheritance

Post author: studyrate
Post published:
Post category: Class 12 / 12 board
Post comments: 0 Comments

In Class 12 Boards there will be Case studies and Passage Based Questions will be asked, So practice these types of questions. Study Rate is always there to help you. Free PDF Downloads of CBSE Class 12 Biology Chapter 6 Molecular Basis of Inheritance Case Study and Passage Based Questions with Answers were Prepared Based on the Latest Exam Pattern. Students can solve Class 12 Biology Case Study Questions Molecular Basis of Inheritance to know their preparation level.

Join our Telegram Channel, there you will get various e-books for CBSE 2024 Boards exams for Class 9th, 10th, 11th, and 12th.

In CBSE Class 12 Biology Paper, There will be a few questions based on case studies and passage-based as well. In that, a paragraph will be given, and then the MCQ questions based on it will be asked.

Molecular Basis of Inheritance Case Study Questions With Answers

Here, we have provided case-based/passage-based questions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance

Case Study/Passage-Based Questions

Case Study 1: In prokaryotes, DNA is circular and present in the cytoplasm but in eukaryotes, DNA is linear and mainly confined to the nucleus. DNA or deoxyribonucleic acid is a long polymer of nucleotides. In 1953, the first correct double helical structure of DNA was worked out by Watson and Crick. Based on the X-ray diffraction data produced by Maurice Wilkins and Rosalind Franklin. It is composed of three components, i.e., A phosphate group, deoxyribose sugar, and a nitrogenous base. Different forms of DNA are B-DNA, Z-DNA, A-DNA, C-DNA, and D-DNA.

(i) Name the linkage present between the nitrogen base and pentose sugar in DNA.

Answer: (b) Glycosidic bond

(ii) The double helix structure of DNA was proposed by

Answer: (a) James Watson and Francis Crick

(iii) The double chain of B-DNA is coiled in a helical fashion. The spiral twisting of the B-DNA duplex produces

Answer: (b) major and minor grooves

(iv) Assertion: The two strands of DNA helix have a uniform distance between them. Reason: A large-sized purine is always paired opposite to a small-sized pyrimidine.

Answer: (a) Both assertion and reason are true and reason is the correct explanation of assertion

(v) Which of the following describes the structure of B-DNA?

Answer: (b)

Case Study 2: The process of translation requires the transfer of genetic information from a polymer of nucleotides to synthesize a polymer of amino acids. The relationship between the sequence of amino acids in a polypeptide and the nucleotide sequence of DNA or mRNA is called genetic code. George Gamow suggested that in order to code for all the 20 amino acids, code should be made up of three nucleotides.

What is the process by which a polymer of nucleotides is used to synthesize a polymer of amino acids? A) Replication B) Transcription C) Translation D) Mutation

What is the relationship between the sequence of amino acids in a polypeptide and the nucleotide sequence of DNA or mRNA known as? A) Genetic Translation B) Genetic Mutation C) Genetic Replication D) Genetic Code

Who suggested that the genetic code should be made up of three nucleotides? A) James Watson B) Francis Crick C) George Gamow D) Rosalind Franklin

How many nucleotides are required to code for one amino acid in the genetic code? A) One B) Two C) Three D) Four

What is the main reason that three nucleotides are used to code for each amino acid? A) To ensure replication accuracy B) To allow for more combinations and code for all 20 amino acids C) To facilitate faster transcription D) To prevent mutations

Which of the following molecules carries the genetic information from DNA to the ribosome for translation? A) tRNA B) rRNA C) mRNA D) DNA

Hope the information shed above regarding Case Study and Passage Based Questions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance with Answers Pdf free download has been useful to an extent. If you have any other queries about CBSE Class 12 Biology Molecular Basis of Inheritance Case Study and Passage Based Questions with Answers, feel free to comment below so that we can revert back to us at the earliest possible. By Team Study Rate

Class 12 biology case study questions chapter 3 human reproduction, class 12 biology case study questions chapter 13 organisms and populations, aunt jennifer’s tiger summary class 12 english pdf, leave a reply cancel reply.

Save my name, email, and website in this browser for the next time I comment.

This site uses Akismet to reduce spam. Learn how your comment data is processed .

The Topper Combo Flashcards

Contains the Latest NCERT in just 350 flashcards.
Colourful and Interactive
Summarised Important reactions according to the latest PYQs of NEET(UG) and JEE

No thanks, I’m not interested!

COMMENTS

Class 12 Biology Case Study Based Questions PDF Download
These Class 12th Case Study and Passage-Based Questions will help you to score 95% in Your Board Exams. Chapter of Biology. Link. Chapter 1: The Living World. Click Here. Chapter 2: Sexual Reproduction in Flowering Plants. Click Here. Chapter- 3: Human Reproduction. Click Here.
CBSE Class 12 Biology Case Study Questions PDF Download
CBSE Class 12 Biology question paper will have case study questions too. These case-based questions will be objective type in nature. So, Class 12 Biology students must prepare themselves for such questions. First of all, you should study NCERT Textbooks line by line, and then you should practice as many questions as possible. Chapter-wise ...
Class 12 Biology Case Study Questions
CBSE 12th Biology Case Study MCQs. Here is one example question on subjective type case study questions. This was given in the term-2 sample paper in 2022. Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single-stranded DNA.
Important CBSE Class 12 Biology Case Study Based Questions 2023: Check
CBSE Class 12 Biology Important Case Study Based Questions. Case Study 1: Nondisjunction is the failure of homologous chromosomes to disjoin correctly during meiosis.It leads to the formation of a ...
Case Study Question for Class 12 Biology Ch 1 to 16
Case Study Questions and Answers for Class 12 Biology all Chapter 1 to 16. Case Based Factual Passage Question & Answer. 100% FREE Exercise & Practice for CBSE, NCERT and ICSE ... Case Based Questions Class 12 Biology Chapterwise. Chapter 1: Reproduction in Organisms: Chapter 9: Strategies for Enhancement in Food Production:
CBSE 12th Standard Biology Case Study Questions With Solution
CBSE 12th Standard Biology Subject Case Study Questions With Solution 2021 Part - II Answer Keys. (i) (c) : Artificial Insemination (AI) is done in infertility cases either due to inability of male partner to copulate the female or due to very low sperm count in the semen of male partner.
Class 12 Biology Case Study Questions Chapter 2 Sexual ...
Here, we have provided case-based/passage-based questions for Class 12 Biology Chapter 2 Sexual Reproduction in Flowering Plants. Case Study/Passage-Based Questions. Case Sudy 1: In angiosperms, the pollen grains are transferred from the anther to the stigma which is termed pollination. This phenomenon was first discovered by Camerarius (1694 ...
Class 12 Biology Case Study of Chapter 5 Principles of ...
Here, we have provided case-based/passage-based questions for Class 12 Biology Chapter 5 Principles of Inheritance and Variation. Case Study/Passage-Based Questions. Case Study 1: During a study on the inheritance of two genes, the teacher asked students to perform an experiment. The students crossed white-eyed, yellow-bodied female Drosophila ...
CBSE 12th Standard Biology Human Reproduction Case Study Questions With
Case Study Questions. A. Acrosome. (i) The secretions.enzymes of acrosome dissolve the egg envelopes and help the sperm enter the cytoplasm of the ovum. B. Mitochondria. (i) The mitochondria in the middle piece provide energy for the sperm motility in the female reproductive tract towards ovum. C. Tail.
CBSE Class 12th
CBSE will ask two Case Study Questions in the CBSE class 12 Biology questions paper. Question numbers 15 and 16 are case-based questions where 5 MCQs will be asked based on a paragraph. Each theme will have five questions and students will have a choice to attempt any four of them. 2. Sexual Reproduction in Flowering Plants. 3. Human Reproduction.
CBSE Class 12 Biology Case Study Questions With Solutions
Case Study Questions Biology Class 12 PDF Chapter Wise. Class 12 Biology Case Study Questions Chapter Wise can be a great help in board exam preparations. Since students feel very overwhelmed while preparing for the examination, it will help them in doing that. Furthermore, finding many MCQs is a challenging task for the practice purpose.
Class 12 Biology Case Study Questions Chapter 1 The Living World
Here, we have provided case-based/passage-based questions for Class 12 Biology Chapter 1 The Living World. Case Study/Passage-Based Questions. Case Study 1: There are millions of plants and animals in the world and they are known by their local names in their area. The local names do vary from place to place, even within a country.
Case Study Questions for Class 12 Biology Chapter 8 Human Health and
Case Study Questions for Class 12 Biology Chapter 8 Human Health and Diseases Question 1: In a study to test a new vaccine against a viral disease, mouse model testing is done. In this process, mice are vaccinated and their blood samples were tested. Mice developed mild disease symptom. After few days those mice were … Continue reading Case Study Questions for Class 12 Biology Chapter 8 ...
CBSE 12th Standard Biology Human Health and Disease Case Study Questions
CBSE 12th Standard Biology Subject Human Health and Disease Case Study Questions 2021 Answer Keys. Case Study Questions. (a) In pneumonia, the lung alveoli become filled with a fluid leading to severe problems in breathing, whereas in common cold, only the nose and respiratory passage are affected, but not the lungs.
Case Study and Passage Based Questions for Class 12 Biology Chapter 3
In CBSE Class 12 Biology Paper, Students will have to answer some questions based on Assertion and Reason. There will be a few questions based on case studies and passage based as well. In that, a paragraph will be given, and then the MCQ questions based on it will be asked. Here, we have provided case … Continue reading Case Study and Passage Based Questions for Class 12 Biology Chapter 3 ...
Case Study Questions Class 12 Biology
At Case Study Questions there will given a Paragraph. In where some Important Questions will made on that respective Case Based Study. There will various types of marks will given 1 marks, 2 marks, 3 marks, 4 marks. CBSE Case Study Questions Class 12 Biology Ecosystem. Case study 1
Class 12 Biology Case Study Questions Chapter 7 Evolution
Here, we have provided case-based/passage-based questions for Class 12 Biology Chapter 7 Evolution. Case Study/Passage-Based Questions. Case Study 1: When the reptiles came down, mammals took over the earth. There' were mammals in South America, which resembled some of the modern day mammals. But due to continental drift, they disappeared ...
Case Study and Passage Based Questions for Class 12 Biology Chapter 2
Case Study/Passage Based Questions for Class 12 Biology. Question 1: A biology student Advik, read an article on apple being a false fruit. He asked his teacher about how fruit can be called false fruit and was explained about the development of fruits. (i) A true fruit is formed from (a) ovary (b) ovary and thalamus (c) ovary and calyx
Class 12th Biology
A typical Mendelian dihybrid cross was carried out starting with homozygous dominant and recessive parents. Answer the following questions. (a) Write the genotype and phenotype of the F 1 offspring. (b) The genetic make up of the gametes produced by F 1 individual. (c) Give the phenotypic ratio of F 2 generation.
Biology Case Study for Class 12 (Download Free PDF)
Passage Based Class 12 Biology Case Study Questions in PDF. CBSE Class 12 Case studies are known as Passage Based Questions. These types of problems usually contain a short/long paragraph with 4 to 5 questions. Students can easily solve Passage Based Class 12 Case Study Questions by reading those passages. By reading the passage students will ...
Class 12 Biology Case Study Questions Chapter 4 Reproductive Health
Here, we have provided case-based/passage-based questions for Class 12 Biology Chapter 4 Reproductive Health. Case Study/Passage-Based Questions. Case Study 1: Riya studies in II standards in a government school She belongs to a backward family and her parents did not get her properly vaccinated according to the immunization program.
Class 12 Biology Case Study Questions Chapter 12 Biotechnology and its
Get here all the Important questions for Class 12 Biology chapter wise as free PDF download. Here you will get Extra Important Questions with answers, assertion reasoning and Multiple Choice Questions (MCQ's) chapter wise in Printable format. Class 12 Biology has 16 important chapters covering various important topics related to human ...
Class 12 Biology Case Study of Chapter 6 Molecular Basis ...
Here, we have provided case-based/passage-based questions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance. Case Study/Passage-Based Questions. Case Study 1: In prokaryotes, DNA is circular and present in the cytoplasm but in eukaryotes, DNA is linear and mainly confined to the nucleus. DNA or deoxyribonucleic acid is a long ...

CBSE Class 12 Biology Case Study Questions PDF Download

Class 12 Biology Case Study Questions

Chapter-wise Solved Case Study Questions for Class 12 Biology

Books for Class 12 Biology

Tips to Excel in CBSE Class 12 Biology Case Study Questions

Practice Regularly

Collaborate and Discuss

Seek Guidance from Teachers

Time Management

Leave a Comment Cancel reply

Download India's best Exam Preparation App Now.

Class 12 Biology Case Study Questions

myCBSEguide App

Biology Competency Based Questions

CBSE 12th Biology Case Study MCQs

Download 12 Biology Case Study Questions

Related Posts

Leave a Comment

Case Study Questions Class 12 Biology Ecosystem

CBSE Case Study Questions Class 12 Biology Ecosystem

Case study 2

Case study 3

Case study 4

Case study 5

Case study 6

Leave a Reply Cancel reply

We have a strong team of experienced Teachers who are here to solve all your exam preparation doubts

Case Study and Passage Based Questions for Class 12 Biology Chapter 2 Sexual Reproduction in Flowering Plants

Case Study and Passage Based Questions for Class 12 Biology Chapter 3 Human Reproduction

Case Study Questions for Class 12 Biology Chapter 8 Human Health and Diseases

Case Study Questions for Class 12 Biology Chapter 10 Microbes in Human Welfare

Case Study Questions for Class 12 Biology Chapter 11 Biotechnology – Principles and Techniques

Case Study Questions for Class 12 Biology Chapter 12 Biotechnology and Its Applications

Download CBSE Books

Leave a Reply Cancel reply

Discover more from Gurukul of Excellence

Class 12th Biology - Principles of Inheritance and Variation Case Study Questions and Answers 2022 - 2023

QB365 - Question Bank Software

*****************************************

Related 12th Standard CBSE Biology Materials

Class VI to XII

12th Standard CBSE Study Materials

12th Standard CBSE Subjects

Biology Case Study for Class 12 (Download Free PDF)

Biology Case Study for Class 12

Download Chapter Wise Biology Case Study for Class 12 Question and Answers PDF

How to Download CBSE Case Study of Class 12 Biology ?

How to Solve Biology Case Study Based Questions of Class 12?

Features Of Class 12 Biology Case Study Questions And Answers PDF

Benefits of Using CBSE Class 12 Biology Case Study Questions and Answers

Not Able To Find Desired Paper or Worksheet SEARCH

Related Papers

Latest MCQ's and Important Questions for CBSE Class 12 Biology

Total Papers :

Course Syllabus Details

Unit VII. Genetics and Evolution

Unit VIII. Biology and Human Welfare

Unit IX. Biotechnology and Its Applications

Unit X. Ecology and Environment

Practical Works

Question Bank of Other Subjects of Class 12

Question Bank of Other Classes

You can help other users

Rules and regulations for uploads

CBSE Schools

Top Schools

Other Schools

CBSE Papers

Paper Categories

Class 12 Biology Case Study of Chapter 6 Molecular Basis of Inheritance

Molecular Basis of Inheritance Case Study Questions With Answers

You Might Also Like

The Topper Combo Flashcards

COMMENTS