case study based questions biology class 12

myCBSEguide

• Class 12 Biology Case...

Class 12 Biology Case Study Questions

Table of Contents

myCBSEguide App

Download the app to get CBSE Sample Papers 2023-24, NCERT Solutions (Revised), Most Important Questions, Previous Year Question Bank, Mock Tests, and Detailed Notes.

As we know that CBSE will now ask case study questions in each subject. In most of the cases, we have noticed that these case-based questions are high-scoring. A little effort on these case study questions can help you get good marks in your board exams. You can download CBSE Class 12 Biology Case Study Questions from the myCBSEguide App or from our Student Dashboard .

Let’s understand what type of case study questions CBSE asks in class 12 Biology. If you analyze the latest class 12 Biology sample papers , you will find that there are two types of case study questions in the Biology question papers.

• Case Studies with objective questions
• Case studies with subjective questions

As per the latest circular issued by CBSE on Assessment and Evaluation Practices of the Board for the Session 2022-23 , CBSE has clearly mentioned that competency-based questions including case studies will be different from subjective questions. Hence, we expect that CBSE will ask only objective questions in CBSE class 12 Biology case study questions too.

Biology Competency Based Questions

As discussed earlier too, the competency-based questions promote learning development for our students and test higher-order skills, such as analysis, critical thinking and conceptual clarity. Case study questions are actually competency-based questions. The very purpose of including such questions in the curriculum is to emphasise on development of problem-solving ability and the ability to apply knowledge in real-life situations.

Even in CBSE Class 12 Biology case studies, you will find some text input like paragraphs, pictures, data etc followed by some objective-type questions. You should read the given information carefully and then answer the questions.

CBSE 12th Biology Case Study MCQs

Here is one example question on subjective type case study questions. This was given in the term-2 sample paper in 2022.

Some restriction enzymes break a phosphodiester bond on both the DNA strands, such that only one end of each molecule is cut and these ends have regions of single-stranded DNA. BamH1is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand.

• What is the objective of this action?
• Explain how the gene of interest is introduced into a vector.
• You are given the DNA shown below. 5’ ATTTTGAGGATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAGGCATTACAGGA 5’ If this DNA was cut with BamHI, how many DNA fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.
• A gene M was introduced into E.coli cloning vector PBR322 at the BamH1 site. What will be its impact on the recombinant plasmids? Give a possible way by which you could differentiate non-recombinant to recombinant plasmids.

Let’s take another example from MCQ type question:

To answer the questions, study the graphs below for Subject-1 and 2 showing different levels of certain hormones.

The peak observed in Subject-1 and 2 is due to

• progesterone
• luteinizing hormone
• follicle stimulating hormone

Subject 2 has higher level of hormone B, which is

If the peak of Hormone A does not appear in the study for Subject 1, which of the following statement is true?

• Peak of Hormone B will be observed at a higher point in the graph
• Peak of Hormone B will be observed at a point lower than what is given in the graph
• There will be no observed data for Hormone B
• The graph for Hormone B will be a sharp rise followed by a plateau

Which structure in the ovary will remain functional in subject 2?

• Corpus Luteum
• Tertiary follicle
• Graafian follicle
• Primary follicle

For subject 2 it is observed that the peak for hormone B has reached the plateau stage. After approximately how much time will the curve for hormone B descend?

Which of the following statements is true about the subjects?

• Subject 1 is pregnant
• Subject 2 is pregnant
• Both subject 1 and 2 are pregnant
• Both subject 1 and 2 are not pregnant

Another example of a class 12 Biology case study question

We use microbes or products which are derived from them every day. A common example is the production of curd from milk. Micro-organisms such as Lactobacillus and others commonly called lactic acid bacteria (LAB) grow in milk and convert it to curd. The dough, which is used for making foods such as dosa and idli is also fermented by bacteria. A number of traditional drinks and foods are also made by fermentation by microbes.  ‘Toddy’, a traditional drink in some parts of southern India is made by fermenting sap from palms. The ‘Roquefort cheese’ is ripened by growing specific fungi on them, which gives them a particular flavour. Different varieties of cheese are known by their characteristic texture, flavour and taste, the specificity coming from the microbes used.

• Penicillium notatum
• Saccharomyces cerevisiae
• Aspergillus niger
• Clostridium butylicum
• thermal vents
• polluted water
• all of these
• None of the above
• production of a large amount of CO 2
• production of O 2
• due to the presence of water
• none of these
• Both Assertion and Reason are true and Reason is the correct explanation of the Assertion
• Both Assertion and Reason are true but Reason is not the correct explanation of the Assertion
• Our Assertion is true but the Reason is false
• Both the statements are false

Download 12 Biology Case Study Questions

In this article, we have given you a few examples of class 12 Biology case study questions. We advise you to download the myCBSEguide App or access our Student Dashboard to get more case study questions for CBSE class 12 biology. We have hundreds of questions on case studies related to CBSE Class 12 Biology. As CBSE is now focusing more on the understanding of the concepts, it is a must for students to practice such questions regularly.

Test Generator

Create question paper PDF and online tests with your own name & logo in minutes.

Question Bank, Mock Tests, Exam Papers, NCERT Solutions, Sample Papers, Notes

Related Posts

• Competency Based Learning in CBSE Schools
• Class 11 Physical Education Case Study Questions
• Class 11 Sociology Case Study Questions
• Class 12 Applied Mathematics Case Study Questions
• Class 11 Applied Mathematics Case Study Questions
• Class 11 Mathematics Case Study Questions
• Class 11 Biology Case Study Questions
• Class 12 Physical Education Case Study Questions

Leave a Comment

Save my name, email, and website in this browser for the next time I comment.

• Bihar Board

SRM University

Nbse result 2024.

• MP Board 10th Result 2024
• MP Board 12th Result 2024
• TS Board Results 2024
• NBSE Board Result 2024
• UK Board Result 2024
• Karnataka Board Result
• Shiv Khera Special
• Education News
• Web Stories
• Current Affairs
• नए भारत का नया उत्तर प्रदेश
• School & Boards
• College Admission
• Govt Jobs Alert & Prep
• GK & Aptitude

Case Study Based Questions for CBSE Class 12 Biology Board Exam 2024: Read this article for Last Minute Revision

Cbse class 12 biology important case study questions : practise important case study based questions for class 12 biology board exam. these case study based questions are important for the upcoming cbse class 12 biology board exam 2024 on march 19, 2024..

CBSE Class 12th Biology Board Exam 2023-24 Pattern

The paper will be of 70 marks and the time duration for completing the paper will be 3 hours.

The paper will have 33 questions divided into 5 sections.

Section–A 16 questions of 1 mark each,

Section–B 5 questions of 2 marks each;

Section–C 7 questions of 3 marks each;

Section–D 2 case-based questions of 4 marks each,

and Section–E 3 questions of 5 marks each.

CBSE Class 12 Biology Important Case Study Based Questions

Case Study 1:  Nondisjunction is the failure of homologous chromosomes to disjoin correctly during meiosis. It leads to the formation of a new cell with an abnormal amount of genetic material. A number of clinical conditions are the result of this type of chromosomal mutation. This results in the production of gametes containing a greater or lesser chromosomal amount than normal ones. Consequently, the individual may develop a trisomy or monosomal syndrome. Nondisjunction can occur in both Meiosis I and Meiosis II of the cellular division. It is also the main cause of many genetic disorders; however, its origin and process remain vague. Although it results in the majority of cases from errors in maternal meiosis II, both paternal and maternal meiosis I do influence it. Maternal age is considered a risk factor for trisomy, as well as recombination alterations and many others that can affect chromosomal segregation.

• It is the presence of an extra chromosome in a diploid cell.
• An aneuploid cell differs from other cells only in size.
• It can be less number of chromosomes in a diploid cell.
• Aneuploidy always affects female individuals.
• both i and iii
• both ii and iii
• i, iii and iv
• Errors in meiosis I is the only cause of aneuploidy
• Aneuploidy always affects sex chromosomes.
• Most of the aneuploidy results from errors in cell division involved in egg formation.
• Nondisjunction in meiosis I can lead to more abnormal cells than disjunction in meiosis II.
• both I and iii
• both iii and iv
• I, iii and iv
• Aneuploidy is not influenced by the mother’s age.
• Delivery before 30 years of age can decrease the incidence of aneuploidy in most cases
• The chance of aneuploidy increases up to 22 years of age.
• There is a dramatic increase in aneuploidy if the maternal age exceeds 30

• both ii and iv
• Chromosomal disorders
• Mendelian disorders
• Incomplete dominance
• All the above

Q5: Assertion: All types of genetic disorders are caused by chromosomal nondisjunction.

• Both assertion and reason are correct and the reason is the correct explanation of assertion
• Both assertion and reason are correct but the reason is not the correct explanation of the assertion
• Assertion is correct but the reason is incorrect
• Both assertion and reason are incorrect

Case Study 2:  A Representative Diagram of the Human Genome Project:

• Biotechnology
• Biomonitoring
• Bioinformatics
• Biosystematics

Q2:  Name a free living, non-pathogenic nematode, the DNA of which has been completely sequenced.

Answer: Caenorhabditis elegans

Q3: Summarize the methodology adopted in the Human Genome Project.

Answer: Expressed Sequence Tags (ESTs) : The approach focused on identifying all the genes that are expressed as RNA.

Sequence Annotation : The other took the blind approach of simply sequencing the whole set of genome that contained all the coding and non-coding sequence, and later assigning different regions in the sequence with functions.

Q4: What are SNPs’? How are they useful in human genomics?

• Identify disease-causing genes in humans
• Can be used to understand the molecular mechanisms of sequence evolution.

Q5: Mention at least four salient features of the Human Genome Project.

• Human genome contains 3164.7 million bp.
• Average gene consists of 3000 bases, but sizes vary greatly.
• Almost all (99.9 percent) nucleotide bases are exactly the same in all people.
• Less than 2 percent of the genome codes for proteins.

Case Study 3: Two blood samples of suspects ‘A’ and ‘B’ were sent to the Forensic Department along with sample ‘C’ from the crime scene. The Forensic Department was assigned the responsibility of running the samples and matching the samples of the suspects with that of the sample from the scene of the crime and thereby identifying the culprit.

• A radioactively labelled double stranded RNA molecule.
• A radioactively labelled double stranded DNA molecule.
• A radioactively labelled single stranded DNA molecule.
• A radioactively labelled single stranded RNA molecule.

Q3: What does ‘minisatellite’ and ‘microsatellite’ mean in relation to DNA Fingerprinting?

Answer:  Minisatellite: the repeating unit consists of 10-100 base pairs.

Microsatellite: the repeating unit consists of 2-6 base pairs.

Q3: How does polymorphism arise in a population?

Answer: Polymorphism (variation at the genetic level) arises due to mutations.

Q4: State the steps involved in DNA Fingerprinting in a sequential manner.

• DNA isolation
• DNA digestion with restriction enzymes.
• DNA fragment separation by electrophoresis.
• Hybridization
• DNA visualization under UV light.

Case Study 4: Bacteria like Streptococcus pneumoniae  and Haemophilus influenzae  are responsible for the disease pneumonia in humans which infects the alveoli (air-filled sacs) of the lungs. As a result of the infection, the alveoli get filled with fluid leading to severe problems in respiration. The symptoms of pneumonia include fever, chills, cough, and headache. In severe cases, the lips and fingernails may turn gray to bluish in colour. A healthy person acquires the infection by inhaling the droplets/aerosols released by an infected person or even by sharing glasses and utensils with an infected person. Dysentery, plague, diphtheria, etc., are some of the other bacterial diseases in man. Many viruses also cause diseases in human beings. Rhinoviruses represent one such group of viruses that cause one of the most infectious human ailments – the common cold. They infect the nose and respiratory passage but not the lungs.

The common cold is characterized by nasal congestion and discharge, sore throat, hoarseness, cough,

headache, tiredness, etc., which usually lasts for 3-7 days. Droplets resulting from the cough or sneezes of an infected person are either inhaled directly or transmitted through contaminated objects such as pens, books, cups, doorknobs, computer keyboards or mice, etc., and cause infection in a healthy person.

• By exhaling droplets of a non-infected person.
• By headache or leg pain.
• By eating fast food.
• By inhaling droplets of an infected person.

Q4:  How long does the common cold last?

Answer: 3-7 days

Q5:  Write any two symptoms of the common cold and pneumonia.

Answer: Cough and nasal congestion.

Case Study 5: When you insert a piece of alien DNA into a cloning vector and transfer it into a bacterial, plant, or animal cell, the alien DNA gets multiplied. In almost all recombinant technologies, the ultimate aim is to produce a desirable protein. Hence, there is a need for the recombinant DNA to be expressed. The foreign gene gets expressed under appropriate conditions. The expression of foreign genes in host cells involves understanding many technical details. After having cloned the gene of interest and having optimised the conditions to induce the expression of the target protein, one has to consider producing it on a large scale. Can you think of any reason why there is a need for large-scale production? If any protein encoding gene is expressed in a heterologous host, it is called a recombinant protein. The cells harbouring cloned genes of interest may be grown on a small scale in the laboratory. The cultures may be used for extracting the desired protein and then purifying it by using different separation techniques.

• A continuous culture system
• A stirred-tank bioreactor without in-lets and out-lets
• Laboratory flask of the largest capacity
• None of the above
• upstream processing
• downstream processing
• bioprocessing
• postproduction processing
• Human insulin
• Growth hormone
• cleaving and joining of DNA segments with endonuclease
• cleaving DNA segments with endonuclease and re-joining with ligase
• cleaving and re-joining DNA segments with ligase
• cleaving DNA segments with ligase and re-joining with endonuclease

Case Study 6: Gene Therapy

Read the following and answer the questions that follow:

• Replacing a disease-causing gene with a healthy copy of the gene
• Inactivating a disease-causing gene that is not functioning properly
• Introducing a new or modified gene into the body to help treat a disease
• Adenosine deaminase
• phenylketonuria
• Phenylalanine
• Bone marrow transplantation
• Southern blotting

Q4 Introduction of gene isolate from bone marrow producing ADA should be introduced at what age to

• acute diseases
• physiological diseases
• hereditary diseases
• infectious diseases
• CBSE Class 12 Biology Previous Year Question Papers with Solutions PDF Download
• CBSE Class 12 Syllabus 2023-24 PDF (All Subjects)
• CBSE Class 12 Deleted Syllabus (All Subjects)
• CBSE Class 12 Previous Year Papers with Solution PDF Download
• CBSE Class 12 Additional Practice Questions
• CBSE Class 12 Sample Paper 2023-24 with Solution and Additional Practice Questions
• Important MCQs for CBSE Class 12 Biology, All Chapters
• CBSE Class 12 Biology Mind Maps for Quick Revision
• CBSE Class 12 NCERT Biology Revised Textbook PDF
• CBSE Class 12 NCERT Biology Solutions
• CBSE Class 12 Biology Chapter-wise notes
• CBSE Class 12 Date Sheet 2024
• CBSE Competency Based Questions 2023-24
• CBSE Class 12 Additional Practice Questions 2024

Get here latest School , CBSE and Govt Jobs notification in English and Hindi for Sarkari Naukari and Sarkari Result . Download the Jagran Josh Sarkari Naukri App . Check  Board Result 2024  for Class 10 and Class 12 like  CBSE Board Result ,  UP Board Result ,  Bihar Board Result ,  MP Board Result ,  Rajasthan Board Result  and Other States Boards.

• CBSE Board exam 2023 result date. + As per the guidelines released by the Central Board of Secondary Education (CBSE), the tentative dates for the CBSE Board Exam 2023 results are; for class 10th: 15th April 2023 and for class 12th: 30th April 2023.
• When is the Class 12th Biology CBSE Board exam? + According to the date sheet released by the Central Board of Secondary Education (CBSE) for class 12th, the Biology exam is scheduled for the 16th of March 2023. The day will be Thursday.
• MP बोर्ड 2024 12th Result
• 10th MP बोर्ड रिजल्ट 2024
• MP बोर्ड 10th, 12th रिजल्ट 2024
• mpbse.nic.in 2024 रिजल्ट
• mpbse.mponline.gov.in रिजल्ट 2024
• MPBSE रिजल्ट 2024 10th, 12th
• MP बोर्ड 12वीं टॉपर लिस्ट 2024
• एमपी बोर्ड 10 वीं टॉपर लिस्ट 2024
• AP SSC Results 2024 Manabadi by Jagran Josh
• AP SSC Topper List 2024
• CBSE Class 10

Latest Education News

Lok Sabha Elections 2024: यहां देखें दूसरे फेज के 5 सबसे अमीर उम्मीदवारों की संपत्ति, उड़ जायेंगे होश

MP Board 12th Topper List 2024 OUT: जयंत यादव ने प्रदेश में किया टॉप, जिलेवार 12वीं साइंस, कॉमर्स और आर्ट्स के होनहारों की लिस्ट यहां देखें

Most Runs In IPL 2024: दिलचस्प हो गयी है ऑरेंज कैप की रेस, ये युवा बल्लेबाज रेस में है शामिल

[Current] Orange Cap and Purple Cap Holders in IPL 2024

Most wickets in ipl 2024: इन पांच गेंदबाजों में है पर्पल कैप की रेस, कौन निकलेगा सबसे आगे?

IPL Points Table 2024: आईपीएल 2024 अपडेटेड पॉइंट टेबल यहां देखें, राजस्थान ऑन टॉप

Purple Cap in IPL 2024: Top Players List with Most Wickets in TATA IPL

Lok Sabha election 2024: केंद्रीय गृह मंत्री Amit Shah कितनी संपत्ति के मालिक है? देखें पूरी Net Worth

MP Board Compartment 2024: परीक्षा में फेल हुए छात्रों को एक और मौका, 10वीं कंपार्टमेंट परीक्षा के लिए 09 जून से करें आवेदन

Orange Cap in IPL 2024: Top Players List with Most Runs in TATA IPL

[Today] IPL 2024 Points Table: Team Rankings and Net Run Rate

Who Won Yesterday IPL Match: RCB vs SRH, Match 41, Check All Details and Latest Points Table

Nagaland Board HSSLC Result 2024: NBSE 12th Result at Jagran Josh and nbsenl.edu.in

Nagaland Board HSLC Result 2024: NBSE 10th Result at Jagran Josh and nbsenl.edu.in

Nagaland Board Result 2024: NBSE Result at Jagran Josh and nbsenl.edu.in

Nagaland Board Result 2024 Tomorrow at 2pm: Check NBSE HSLC, HSSLC Result Notice at nbsenl.edu.in

TNPSC Group 1 Online Application Link 2024 Available: Apply at tnpsc.gov.in

Brain Teaser IQ Test: Find six hidden words in the birthday party picture in 15 seconds!

Picture Puzzle IQ Test: Only 1% With Razor Sharp Eyes Can Spot The Lost Watch In 8 Seconds!

RMLAU Result 2024 OUT at rmlau.ac.in; Direct Link to Download UG and PG Odd Semester Marksheet

CBSE Expert

CBSE Class 12 Biology Case Study Questions PDF Download

Welcome to the comprehensive guide on CBSE Class 12 Biology Case Study Questions! In this article, we will delve into the world of Biology case studies, explore the importance of case study questions, and provide you with a PDF download that will assist you in mastering this subject. Whether you’re a student preparing for your examinations or a teacher looking to enhance your teaching materials, our detailed resource will help you excel in the realm of Biology.

Case studies are a widely used educational tool that involves the in-depth analysis of a particular situation, organism, process, or problem. In CBSE Class 12 Biology, case study questions are designed to evaluate students’ critical thinking, problem-solving abilities, and practical application of biological concepts. These questions require students to apply their theoretical knowledge to real-life scenarios, thus fostering a deeper understanding of the subject matter.

Class 12 Biology Case Study Questions

CBSE Class 12 Biology question paper will have case study questions too. These case-based questions will be objective type in nature. So, Class 12 Biology students must prepare themselves for such questions. First of all, you should study NCERT Textbooks line by line, and then you should practice as many questions as possible.

Chapter-wise Solved Case Study Questions for Class 12 Biology

Class 12 students should go through important Case Study problems for Biology before the exams. This will help them to understand the type of Case Study questions that can be asked in Grade 12 Biology examinations. Our expert faculty for standard 12 Biology have designed these questions based on the trend of questions that have been asked in last year’s exams. The solutions have been designed in a manner to help the grade 12 students understand the concepts and also easy-to-learn solutions.

Books for Class 12 Biology

Strictly as per the new term-wise syllabus for Board Examinations to be held in the academic session 2022-23 for class 12 Multiple Choice Questions based on new typologies introduced by the board- Stand-Alone MCQs, MCQs based on Assertion-Reason Case-based MCQs. Include Questions from CBSE official Question Bank released in April 2022 Answer key with Explanations What are the updates in the book: Strictly as per the Term wise syllabus for Board Examinations to be held in the academic session 2022-23. Chapter-wise -Topic-wise Multiple choice questions based on the special scheme of assessment for Board Examination for Class 12th.

Tips to Excel in CBSE Class 12 Biology Case Study Questions

Thoroughly grasp the concepts.

Before attempting case study questions, ensure you have a strong grasp of fundamental biological concepts. Familiarize yourself with topics such as genetics, ecology, human physiology, and evolution. A solid foundation will empower you to tackle complex case studies with confidence.

Practice Regularly

Practice makes perfect, and this is especially true for case study questions. Allocate time to work through a diverse range of case studies regularly. Familiarizing yourself with different scenarios will prepare you for the unpredictability of examination questions.

Collaborate and Discuss

Engaging in group discussions with fellow students or teachers can be highly beneficial. Sharing perspectives, analyzing cases together, and discussing possible solutions can broaden your understanding and offer fresh insights.

Seek Guidance from Teachers

Don’t hesitate to approach your teachers for assistance. They possess valuable experience and expertise to guide you through challenging case studies and provide valuable feedback.

Time Management

During examinations, time management is crucial. Practice solving case study questions under timed conditions to improve your efficiency and ensure you complete all questions within the allocated timeframe.

In conclusion, mastering case study questions in CBSE Class 12 Biology is essential for a holistic understanding of the subject and for excelling in examinations. By honing your analytical abilities, practicing regularly, and seeking guidance, you can conquer even the most challenging case studies. Remember that learning Biology is not just about memorizing facts but about applying knowledge to real-world situations. So, embrace the power of case studies and delve into the fascinating world of Biology.

With the provided CBSE Class 12 Biology Case Study Questions PDF, you have a valuable resource at your disposal. Practice diligently, and you’ll witness your confidence soar as you become a proficient problem solver in the realm of Biology. Good luck on your academic journey!

Leave a Comment Cancel reply

Save my name, email, and website in this browser for the next time I comment.

Download India's best Exam Preparation App Now.

Key Features

• Revision Notes
• Important Questions
• Previous Years Questions
• Case-Based Questions
• Assertion and Reason Questions

No thanks, I’m not interested!

• New QB365-SLMS
• NEET Materials
• JEE Materials
• Banking first yr Materials
• TNPSC Materials
• DIPLOMA COURSE Materials
• 5th Standard Materials
• 12th Standard Materials
• 11th Standard Materials
• 10th Standard Materials
• 9th Standard Materials
• 8th Standard Materials
• 7th Standard Materials
• 6th Standard Materials
• 12th Standard CBSE Materials
• 11th Standard CBSE Materials
• 10th Standard CBSE Materials
• 9th Standard CBSE Materials
• 8th Standard CBSE Materials
• 7th Standard CBSE Materials
• 6th Standard CBSE Materials
• Tamilnadu Stateboard
• Scholarship Exams
• Scholarships

CBSE 12th Standard Biology Subject Case Study Questions With Solution 2021 Part - II

By QB365 on 21 May, 2021

QB365 Provides the updated CASE Study Questions for Class 12 Biology, and also provide the detail solution for each and every case study questions . Case study questions are latest updated question pattern from NCERT, QB365 will helps to get  more marks in Exams

QB365 - Question Bank Software

12th Standard CBSE

Final Semester - June 2015

Case Study Questions

Read the following and answer any four questions from (i) to (v) given below: A woman unable to conceive after many years of regular unprotected coitus went to specialised infertility clinic. On complete examination, woman was found to be normal while male partner was diagnosed with infertility. Male partner is unable to copulate the female. Couple was advised to opt for assisted reproductive technology (ART). (i) Which ART could have been useful for this couple?

(ii) In which of the following infertility issues could this technique be used?

(iii) Which among the following techniques is useful to conceive when there is very low sperm count?

(iv) Assertion: Artificial insemination (AI) is intra-uterine insemination. Reason: In AI, sperms collected from donor are introduced into the uterus.

(v) Success rate of artificial insemination technique is

Read the following and answer any four questions from (i) to (v) given below : Riya studies in II standard in a government schooL She belongs to a backward family and her parents did not get her properly vaccinated according to immunisation programme. Once while playing in school playground she fell down due to weakness and developed high fever, headache and stiffness in her neck. Identify the illness she could be suffering from and answer the following questions. (i) The microbe responsible for Riyas illness could be

(ii) Which vaccine, if administered earlier, would have saved Riya from the illness she unfortunately contracted?

(iii) The disease that Riya has contracted spreads through

(iv) Riya can spread her illness to other children through

(v) Assertion: Polio produces inflammation of the nervous system. Reason: Stiffness of the neck, paralysis of particular skeletal muscle is an important symptom of polio.

(ii) The given graph indicates that person Y is suffering from

(iii) Which of the following conditions are common in person Y?

(iv) A person suffering from diabetes mellitus becomes weak because

(v) Assertion: Type I diabetes involves failure of insulin to facilitate the movement of glucose into cells. Reason : Type II diabetes is caused by failure of beta cells to produce adequate amount of insulin due to beta cell depletion.

Read the following and answer any four questions from (i) to (v) given below : Turner's syndrome is an example of mono somy. It is formed by the union of an allosome free egg and a normal 'X' containing sperm or a normal egg and an allosome free sperm. The individual has 2n = 45 chromosomes (44 + X0) instead of 46. Such individuals are sterile females who have rudimentary ovaries, under developed breasts, small uterus, short stature, webbed neck and abnormal intelligence. They may not menstruate or ovulate. This disorder can be treated by giving female sex hormone to the women from the age of puberty to make them develop breasts and have menstruation. This makes them feel more normal. (i) Number of Barr body present in a female with Turner's syndrome is

(ii) Turner's syndrome is an example of

(iii) Turner's syndrome is a/an

(iv) Which of the following statements regarding Turner's syndrome is incorrect?

(v) Assertion : Turner's syndrome is caused due to absence of anyone of the X and Y sex chromosome. Reason : Individuals suffering from Turner's syndrome show masculine as well as feminine development

Read the following and answer any four questions from (i) to (v) given below: Aditya went to his hometown located in countryside along with his parents during his summer vacations. His grand parents' house is surrounded by farmland from all sides. Lots of crops were growing nearby and Aditya was very excited to visit the crop fields. He seeked permission from his mother to play in farmland along with his friends and then went to play in the fields. On returning back he had running nose, watering eyes and continuous sneezing which was very frequent. The symptoms worsened with time. Based on the above information, answer the following questions. (i) What could be the possible reason for Adityas condition?

(ii) How can allergy be diagnosed in a person?

(iii) The symptoms which Aditya developed on account of being allergic are consequence of

(iv) Name the type of allergy that Aditya developed.

(v) Assertion: Hay fever is the form of allergy due to pollens of grasses and other plants. Reason : Hay fever symptoms are due to release of histamines and often respond well to treatment with antihistamines.

Read the following and answer any four questions from (i) to  (v) given below: A group of teenagers was involved in drug abuse. They used syringes and needles to inject drugs. They indulged in this habit when they became adults. Administration of drug through needles became a piece of cake for them. Raj was the most active drug abuser amongst them and used to take drugs in high profile parties. In a span of time he started losing weight and suffered persistent diarrhoea. He developed constant low grade fever and used to catch opportunistic infection. When he consulted a doctor, he got himself tested for HIV in his blood and finally diagnosed with AIDS. Based on the above information, answer the following questions. (i) Select the incorrect statement.

(ii) How do you think Raj got AIDS infection?

(iii) How AIDS can be diagnosed?

(iv) How can AIDS be prevented?

(v) Select the correct statement for AIDS virus.

Read the following and answer any four questions from (i) to (v) given below: Kangaroo rat seldom drinks water. It has thick coat to minimise evaporative desiccation. The animal seldom comes out of its comparatively humid and cool burrow during the day time. 90% of its water requirement is met from metabolic water (water produced by respiratory breakdown of fats) while 10% is obtained from its food. Loss of water is minimised by producing nearly solid urine and faeces. As the animal faces acute water scarcity, it develops two types of adaptations: reducing water loss and ability to tolerate desert conditions. (i) Kangaroo rat is a

(ii) Metabolic water refers to

(iii) Desert animals minimise water loss by

(iv) Assertion : Kangaroo rat can tolerate and thrive in wide temperature range and is known as stenothermal. Reason: Kangaroo rats go into hibernation during winter to escape cold weather.

(v) The adaptations in an organism are meant for

(ii) Total number of individuals of a species per unit area per unit time is called

(iii) Which of the following is correct regarding age sex pyramid A and B?

(iv) A population with a large proportion of older individuals than younger ones will likely to

(v ) Assertion: Bell shaped age pyramid represents a stable population. Reason : In a stable population, proportion of individuals in reproductive age group is higher than the individuals in pre-reproductive age group.

(ii) Which of the following associations is an example of competitions?

(iii) If '+ ' sign is assigned to beneficial interaction, '-' sign to detrimental and 0 sign to neutral interaction, then the population interaction of competition refers to

(iv) Intraspecific competition is more severe due to

(v) Assertion: Two members of a competing species may co-exist. Reason: Different individuals of a species have different resource requirements.

Read the following and answer any four questions from (i) to (v) given below: The Kakapo is the world's largest and heaviest parrot, found only in New Zealand. It is unusual in that it is nocturnal, flightless and ground-dwelling. It is an excellent climber of trees, has strong legs that allow it to "jog" several kilometres in a single trip, and has mossy green plumage mottled with brown and yellow. The Kakapo is also critically endangered as of now, there were only few known living individuals left. (i) Which could be the possible reason for Kakapo to be well-adapted to its environment prior to the arrival of humans in New Zealand?

(ii) When humans started to settle in New Zealand, they took with them non-native animals, including mammals such as cats, dogs and stoats. By which of the following ways, human settlement likely contributed to a near decimation of Kakapo populations in New Zealand?

(iii) All known survived Kakapo have been relocated by the New Zealand government to three predator-free islands, where they are monitored year round by staffs and volunteers to ensure that the birds are safe, healthy and well-fed. The extremely low population of Kakapo is a hurdle to the species becoming viable in the long term, despite such dedicated conservation efforts. This is because

(iv) The reasons behind conserving biodiversity have been grouped into which of the following categories?

(v) One of the ex situ conservation methods for endangered species is

Read the following and answer any four questions from (i) to (v) given below: Non-native or alien species are often introduced in advertently for their economic and other uses. They often become invasive and drive away-the local species. Exotic species have proved harmful to both aquatic and terrestrial ecosystems. For example, water hyacinth (Eichhornia crassipes) was introduced in Indian waters to reduce pollution. It was clogged water bodies including wetlands at many places resulting in death of several aquatic plants and animals. (i) Island water ecosystem are the most vulnerable due to

(ii) Which of the following is not an alien species?

(iii) Second major cause of species extinction is

(iv) Assertion: Eichhornia crassipes drains off oxygen from water and can be seen growing in standing water. Reason: Eichhornia crassipes is an indigenous species of India.

Read the following and answer any four questions from (i) to (v) given below: Golden rice was engineered from normal rice by Potrykus and Beyer in the 1990s. The typical golden colour is due to the production of \(\beta\)  carotene a precursor of vitamin - A. Golden rice differs from its parental strain by the addition of three \(\beta\)  carotene genes. These included two genes from daffodil plant and third from a bacterium. The incorporation of these genes allows the rice plant to modify certain metabolic pathways in its cells to produce \(\beta\) -carotene. (i) Due to genetic modification golden rice plants produce and store  \(\beta\)  - carotene in

(ii) Transfer of genes to produce golden rice is achieved by

(iii) In golden rice two genes were taken from

(iv) Golden rice is helpful to fight against disease caused by the deficiency of

(v) Golden rice was genetically engineered by

Read the following and answer any four questions from (i) to (v) given below: Transgenic cows have extra gene or genes inserted into their DNA. Firstly the genes for the desired product is identified and sequenced. Then a gene construct containing this desired gene is introduced into female cow cells. Transgenic bovine cells are selected and fused with bovine oocytes that have had all of their chromosomes removed. Once fused with the oocyte, the transgenic cells chromosomes are reprogrammed to direct development into an embryo which can be implanted into a recipient cow. The resulting transgenic cow only express the trans gene in her milk. This is because expression of the trans gene is controlled by a promoter specific to lactating mammary cells. The first transgenic cow was 'Rosie: (i) The gene construct with desired gene is introduced into female cow cells by

(ii) Production of transgenic cow fulfill the objective of

(iii) The name of first transgenic cow is

(iv) Transgenic cow is produced through the implantation of _____containing transgene into recipient cow.

(v) Assertion : Transgenes only express in the mammary glands of transgenic cow. Reason : Transgenes are present in chromosomes of every cell in transgenic cow

(ii) Equation for relationship (A) between species richness and area is

(iii) What is the value of slope of line or regression coefficient Z for frugivorous birds?

(iv) The shape of curve for relationship between species richness and areas for wide variety of taxa is

(v) Who gave this concept of increase in species richness with increasing offered area?

(ii) The following is a list of some stages involved in producing human insulin from genetically engineered bacteria. 1. The bacteria are cultured in a fermenter for large scale production. 2. Recombinant insulin is extracted from the bacterial cells that expresses insulin gene. 3. The same restriction enzyme is used again to cut the bacterial plasmid for insertion of the human insulin gene. 4. Bacteria take up the plasmid carrying the insulin gene. 5. A restriction enzyme is used to cut human DNA to extract the insulin gene. Select the correct order of these stages.

(iii) To insert the insulin gene into bacterial DNA, both the bacterial plasmid and the human chromosome containing the insulin gene are treated with the same restriction enzyme. Using the same restriction enzyme ensures that

(iv) Why is the fermentor important for the production of human insulin by transgenic bacteria

(v) A bacteriologist carries out his first attempt at engineering E.coli with the gene for human insulin. During the process, he realises that his stock of DNA ligase has depleted but decides to continue anyway. What is a likely consequence of his decision?

*****************************************

Cbse 12th standard biology subject case study questions with solution 2021 part - ii answer keys.

(i) (c) : Artificial Insemination (AI) is done in infertility cases either due to inability of male partner to copulate the female or due to very low sperm count in the semen of male partner. (ii) (b) : Oligospermia is very low sperm count. (iii) (d): ICSI is intra cytoplasmic sperm injection. (iv) (a) (v) (a)

(i) (b) : Riya is suffering from polio that is caused by an Enterovirus, called Poliovirus. (ii) (a) (iii) (c) : Polio virus enters the body via alimentary canal (faecal oral route) (iv) (a): Riya has contracted polio which is transmitted through faecal oral route, as urine and faeces of the patient contain polio virus. (v) (b)

(i) (c) : Blood sugar level fluctuations in person X indicate that sugar level never exceed the normal limit and sufficient secretion of insulin at required times removes any extra sugar from blood and converts it into glycogen for future use. This implies that person X is normal and healthy. (ii) (a) : Elevated blood sugar levels in person Y indicate that he is suffering from diabetes mellitus. (iii) (d): (iv) (d): (v) (d) : Type I diabetes or insulin dependent diabetes mellitus or juvenile diabetes is an autoimmune disorder caused by failure of beta cells to produce adequate amount of insulin. Type II diabetes or non insulin dependent diabetes mellitus involves failure of insulin to facilitate the movement of glucose into body cells.

(i) (a) : Barr body is a structure consisting of a condensed X chromosome that is found in nondividing nuclei of female mammals. The presence of Barr body is used to confirm the sex of athletes in sex determination tests. It is named after the Canadian anatomist M.L. Barr, who identified it. The number of Barr bodies is one less than total number of X chromosomes. In Turner's syndrome genotype is 45 + X0,so, the number of Barr body is O. (ii) (a) : Failure of segregation of chromatids during cell division result in the gain or loss of a chromosomes called aneuploidy. For example, Turner's syndrome results due to loss of X chromosome in human females. (iii) (d) : Turner's syndrome is a chromosomal disorder that occurs due to absence of one chromosome. (iv) (c) : In Turner's syndrome individual lacks one X chromosome. This situation is known as monosomy. (v) (d): Turner's syndrome occurs due to absence of X chromosome. Individuals having a single X chromosome 22A + X0 (45) have female sexual differentiation but ovaries are rudimentary. Other associated phenotypes of this condition are short stature, webbed-neck, broad chest, lack of secondary sexual characteristics and sterility. Thus, any imbalance in the copies of the sex chromosomes may disrupt the genetic information necessary for normal sexual development.

(i) (a) : Aditya most probably had developed some sort of allergy due to pollens of grasses, trees and other plants. (ii) (a) : Allergies mainly involve IgE antibodies and chemicals like histamine and serotonin from mast cells. IgE antibodies are produced in response to an antigen, coat mast cells and basophils. (iii) (a) : The allergy which Aditya developed is characterised by inflammation of membrane lining the nose and conjunctiva leading to running nose, watering eyes and constant sneezing. (iv) (c) (v) (b)

(i) (d) : Every year, December 1 is designated as World AIDS Day. (ii) (d) (iii) (a) : ELISA test, also called EIA for enzyme immunoassay is used to detect HIV antibody. It checks for certain proteins that the body makes in response to HIY. (iv) (d) (v) (c) : HIV is spherical with a diameter of 90-120 nm. Its genome consists of single stranded RNA. The envelope consists of a lipid bilayer derived from host cell membrane and projection knob like glycoproteins. It contains two protein coats.

(i) (c) : Kangaroo rat is a regulator that performs homeostasis through thermoregulation osmoregulation by physiological adjustments and behavioural changes. (ii) (c) (iii) (d) (iv) (d) : Organisms that can tolerate and thrive in wide temperature range are known as eurythermal. Kangaroo rats do not go into hibernation rather, they stay if}cool moist burrows during summer days. (v) (d): Adaptation is an attribute of an organism (morphological, physiological and behavioural) that enables it to survive and reproduce in its habitat. Adaptations lead to the formation of some specialised and peculiar features which have evolved over a long period of time through natural selection.

(i) (b) (ii) (b) : Population density is the number of individual present per unit area at a given time. (iii) (d) : A represents nearly stable population whereas B represents rapidly growing population. (iv) (c) : A population with large number of older individuals than younger ones is likely to decline since older individuals do not take part in reproduction. (v) (c): In a bell-shaped age pyramid, the number of pre-reproductive and reproductive individuals is almost equal. Post-reproductive individuals are comparatively fewer. It represents a stable population.

(i) (b): Competition is a sort of rivalry among two or more organisms for obtaining the same resources. The competition among individuals of the same species is called intraspecific competition and among members of different species is called interspecific competition. Intraspecific competition is more severe than interspecific competition due to similar needs. Now, according to the given graph, competition for water in a population leads to more root weight (mg) per leaf area (crrr'). This is because competition causes more root growth so that each sapling can derive more water from the pot. (ii) (b) : The association or interactions of Cuscuta and hedge plant is parasitism, cactus and moth is predation and orchid and mango is commensalism. (iii) (b) (iv) (d) : Intraspecific competition is more severe because of common resource, similar needs and similar adaptations. (v) (d)

(i) (d) : Since the Kakapo is nocturnal, it was active only in the night when its potential predators would not be out for hunting. With its greenish plumage, the Kakapo could likely be well camouflaged among the forest foliage in the daytime when it is resting hence evading detection by its predators. It was able to effectively hunt for food in the night given its ability to climb trees and travel significant distances over land despite lacking the ability to fly. (ii) (d): As humans settled in New Zealand, they would have cleared the land to make way for their own needs e.g., farmland, hence shrinking the natural habitats of the Kakapo. The new mammals that were introduced into the Kakapos habitats might have out-competed the Kakapo for the limited food resources available. The new mammals that were introduced might also have easily preyed on the Kakapo (e.g., by using their sense of smell), as the KakapoIikely lacked the necessary adaptations to defend itself given that such predators were never present in the past. For instance, many mammals such as cats are nocturnal and hence would prey on Kakapo when the latter are also active at night. (iii) (d) : The small populations results in a yery small gene pool, i.e., a very limited variety of alleles / traits among surviving individuals of the species. Even if the existing birds manage to breed and multiply significantly, there would be very limited genetic diversity among the resulting offspring. This would lead to reduce capacity of the species to adapt to and survive changes in the environment. There may also be reduced fitness in the offspring given increased likelihood of homozygosity of recessive harmful! deleterious alleles, which would result in these alleles being expressed to bring about unfavourable phenotypes. (iv) (d) : We should conserve biodiversity. The reason for this can be broadly divided into three categories: (i) Narrowly utilitarian (Humans derive a major part of their requirement from organisms). (ii) Broadly utilitarian (Biodiversity is fundamental to ecosystem services of nature). (iii) Ethical (Every living species has an intrinsic value, it is our moral duty not to destroy them). (v) (c): Ex situ (off site) conservation is conservation of selected rare plants/animals in places outside their natural homes. It is a desirable approach to save threatened or endangered plant or animal species from extinction. Ex situ conservation includes offsite collections, gene banks, in vitro fertilisation, cryopreservation techniques and tissue culture.

(i) (d) (ii) (d) : Pronuba yuccasella shows obligatory mutualistic relationships with Yucca. (iii) (c) : Alien species invasion is considered to be second major cause of extinction of species. (iv) (c): Eichhornia crassipes is an aquatic plant, native to Amazon basin. This plant was introduced into India for its beautiful flowers and shape ofleaves. (v) (a)

(i) (b) : Golden rice is a transgenic variety of rice (Oryza sativa) which contains good quantities of \(\beta\) -carotene (provitamin A - inactive state of vitamin A). \(\beta\) -carotene is a principal source of vitamin A. Since the grains (seeds) of the rice are yellow in colour due to \(\beta\) -carotene, the rice is commonly called golden rice. (ii) (a) : Foreign genes were inserted into the genome of a tempera,te rice variety by using Agrobacterium tumefaciens as the vector. (iii) (a) : In golden rice, two genes for \(\beta\) -carotene were taken from daffodil (Narcissus sp.) and one gene from a bacterium Erwinia. (iv) (c) : Golden rice is rich in \(\beta\) -carotene which is a precursor of vitamin A. (v) (b) : Prof. Ingo Potrykus and Peter Beyer produced genetically engineered rice by introducing three gene associated with synthesis of carotene. The grains (seeds) of transgenic rice are rich in provitamin.

(i) (c) (ii) (d) : The two chief objectives of transgenic cow production are as follows: (i) increased milk and meat production and (ii) molecular farming. (iii) (c) ( iv) (b) : Transgenic bovine cells are selected and fused with bovine oocytes that have had all its chromosomes removed. Once fused with oocyte, the transgenic cells chromosomes are reprogrammed to direct development into embryo which is implanted into recipient cow. (v) (b)

(i) (b) (ii) (a) : On a logarithmic scale, the relationship between species richness and area is a straight line. (iii) (b) : The regression coefficient Z have a value of 1.15 for frugivorous birds and mammals of tropical forests of different continents. (iv) (c) (v) (b) : While exploring the wilderness South American jungles, Alexander von Humboldt found that within a region, the species richness increased with increasing area but upto a certain limit

(i) (c) :  A represents polypeptide chain C which is removed prior to insulin formation. (ii) (d) (iii) (d) : Each particular restriction enzyme produces unique sticky ends. Using the same enzyme for both the bacterial and human DNA will produce complementary sticky ends that can bind together by complementary base pairing. This would allow the human insulin gene to be inserted into the plasmid. (iv) (a) : The optimal temperature, pH, oxygen and nutrient conditions in the fermenter allow the bacteria containing the insulin gene to reproduce quickly and produce large quantities of it. (v) (c) : DNA ligase forms strong hydrogen bonds between the DNA bases on the human insulin gene and the bacterial plasmid, producing a continuous double stranded DNA loop. Without DNA ligase, the human insulin gene, despite being able to undergo complementary base pairing with the bacterial DNA at the sticky ends would not be securely inserted into the plasmid. Thus, the resulting E.coli bacteria would receive plasm ids that lack the human insulin gene.

Related 12th Standard CBSE Biology Materials

12th standard cbse syllabus & materials, cbse 12th physics wave optics chapter case study question with answers, cbse 12th physics ray optics and optical instruments chapter case study question with answers, cbse 12th physics nuclei chapter case study question with answers, cbse 12th physics moving charges and magnetism chapter case study question with answers, cbse 12th physics electromagnetic induction chapter case study question with answers, cbse 12th physics atoms chapter case study question with answers, 12th physics alternating current chapter case study question with answers cbse, 12th maths vector algebra chapter case study question with answers cbse, 12th maths three dimensional geometry chapter case study question with answers cbse, 12th maths probability chapter case study question with answers cbse, 12th maths linear programming chapter case study question with answers cbse, 12th maths differential equations chapter case study question with answers cbse, 12th maths continuity and differentiability chapter case study question with answers cbse, 12th maths application of integrals chapter case study question with answers cbse, 12th chemistry the d and f block elements chapter case study question with answers cbse.

Class VI to XII

Tn state board / cbse, 3000+ q&a's per subject, score high marks.

12th Standard CBSE Study Materials

12th Standard CBSE Subjects

• Andhra Pradesh
• Chhattisgarh
• West Bengal
• Madhya Pradesh
• Maharashtra
• Jammu & Kashmir
• NCERT Books 2022-23
• NCERT Solutions
• NCERT Notes
• NCERT Exemplar Books
• NCERT Exemplar Solution
• States UT Book
• School Kits & Lab Manual
• NCERT Books 2021-22
• NCERT Books 2020-21
• NCERT Book 2019-2020
• NCERT Book 2015-2016
• RD Sharma Solution
• TS Grewal Solution
• TR Jain Solution
• Selina Solution
• Frank Solution
• ML Aggarwal Solution
• Lakhmir Singh and Manjit Kaur Solution
• I.E.Irodov solutions
• ICSE - Goyal Brothers Park
• ICSE - Dorothy M. Noronhe
• Sandeep Garg Textbook Solution
• Micheal Vaz Solution
• S.S. Krotov Solution
• Evergreen Science
• KC Sinha Solution
• ICSE - ISC Jayanti Sengupta, Oxford
• ICSE Focus on History
• ICSE GeoGraphy Voyage
• ICSE Hindi Solution
• ICSE Treasure Trove Solution
• Thomas & Finney Solution
• SL Loney Solution
• SB Mathur Solution
• P Bahadur Solution
• Narendra Awasthi Solution
• MS Chauhan Solution
• LA Sena Solution
• Integral Calculus Amit Agarwal Solution
• IA Maron Solution
• Hall & Knight Solution
• Errorless Solution
• Pradeep's KL Gogia Solution
• OP Tandon Solutions
• Sample Papers
• Previous Year Question Paper
• Value Based Questions
• CBSE Syllabus
• CBSE MCQs PDF
• Assertion & Reason
• New Revision Notes
• Revision Notes
• HOTS Question
• Marks Wise Question
• Toppers Answer Sheets
• Exam Paper Aalysis
• Concept Map
• CBSE Text Book
• Additional Practice Questions
• Vocational Book
• CBSE - Concept
• KVS NCERT CBSE Worksheets
• Formula Class Wise
• Formula Chapter Wise
• JEE Crash Course
• JEE Previous Year Paper
• Important Info
• JEE Mock Test
• JEE Sample Papers
• SRM-JEEE Mock Test
• VITEEE Mock Test
• BITSAT Mock Test
• Manipal Engineering Mock Test
• AP EAMCET Previous Year Paper
• COMEDK Previous Year Paper
• GUJCET Previous Year Paper
• KCET Previous Year Paper
• KEAM Previous Year Paper
• Manipal Previous Year Paper
• MHT CET Previous Year Paper
• WBJEE Previous Year Paper
• AMU Previous Year Paper
• TS EAMCET Previous Year Paper
• SRM-JEEE Previous Year Paper
• VITEEE Previous Year Paper
• BITSAT Previous Year Paper
• UPSEE Previous Year Paper
• CGPET Previous Year Paper
• CUSAT Previous Year Paper
• AEEE Previous Year Paper
• Crash Course
• Previous Year Paper
• NCERT Based Short Notes
• NCERT Based Tests
• NEET Sample Paper
• Previous Year Papers
• Quantitative Aptitude
• Numerical Aptitude Data Interpretation
• General Knowledge
• Mathematics
• Agriculture
• Accountancy
• Business Studies
• Political science
• Enviromental Studies
• Mass Media Communication
• Teaching Aptitude
• NAVODAYA VIDYALAYA
• SAINIK SCHOOL (AISSEE)
• Mechanical Engineering
• Electrical Engineering
• Electronics & Communication Engineering
• Civil Engineering
• Computer Science Engineering
• CBSE Board News
• Scholarship Olympiad
• School Admissions
• Entrance Exams
• All Board Updates
• Miscellaneous
• State Wise Books
• Engineering Exam

SHARING IS CARING If our Website helped you a little, then kindly spread our voice using Social Networks. Spread our word to your readers, friends, teachers, students & all those close ones who deserve to know what you know now.

CBSE Class 12th - BIOLOGY : Chapterwise Case Study Question & Solution

CBSE will ask two Case Study Questions in the CBSE class 12 Biology questions paper. Question numbers 15 and 16 are case-based questions where 5 MCQs will be asked based on a paragraph. Each theme will have five questions and students will have a choice to attempt any four of them.

• NCERT Solutions for Class 12 Maths
• NCERT Solutions for Class 10 Maths
• CBSE Syllabus 2023-24
• Social Media Channels
• Login Customize Your Notification Preferences
• CBSE Board Class 12 Computer Science Answer Key 2024 and Question Papers, Download PDF All SETs 2 April, 2024, 1:51 pm
• CBSE Class 12 Computer Science Exam 2024 : Important MCQs with Answers For Last Minute Revision 1 April, 2024, 5:42 pm
• CBSE Board Class 12 History Answer Key 2024 and Question Papers, Download PDF All SETs 28 March, 2024, 1:18 pm
• CBSE Board 12th History Exam 2024 : Chapterwise Most Important Question with Answers 27 March, 2024, 4:57 pm
• CBSE Board Class 12 Business Studies Answer Key 2024 and Question Papers, Download PDF All SETs 27 March, 2024, 1:05 pm
• CBSE Class 12th Exam 2024: Business Studies Important MCQs & Assertion-Reason Questions 26 March, 2024, 3:39 pm
• CBSE Board Class 12 Political Science Answer Key 2024 and Question Papers, Download PDF All SETs 22 March, 2024, 1:36 pm
• CBSE Class 12th Accountancy Exam 2024 : Most Important Questions for Last Minute Revision; Download PDF 22 March, 2024, 12:58 pm
• CBSE Class 12th Political Science Exam 2024 : Most Important Questions for Last Minute Revision; Download PDF 21 March, 2024, 4:33 pm

• Second click on the toggle icon

Provide prime members with unlimited access to all study materials in PDF format.

Allow prime members to attempt MCQ tests multiple times to enhance their learning and understanding.

Provide prime users with access to exclusive PDF study materials that are not available to regular users.

Gurukul of Excellence

Classes for Physics, Chemistry and Mathematics by IITians

Join our Telegram Channel for Free PDF Download

Case Study and Passage Based Questions for Class 12 Biology Chapter 2 Sexual Reproduction in Flowering Plants

• Last modified on: 2 years ago
• Reading Time: 4 Minutes

In CBSE Class 12 Biology Paper, Students will have to answer some questions based on Assertion and Reason . There will be a few questions based on case studies and passage based as well. In that, a paragraph will be given, and then the MCQ questions based on it will be asked.

Here, we have provided case based/passage based questions for Class 12 Biology Chapter 2 Sexual Reproduction in Flowering Plants .

Case Study/Passage Based Questions for Class 12 Biology

Question 1:

A biology student Advik, read an article on apple being a false fruit. He asked his teacher about how fruit can be called false fruit and was explained about the development of fruits.

(i) A true fruit is formed from (a) ovary (b) ovary and thalamus (c) ovary and calyx (d) ovary and receptacle

(ii) Fruit is a (a) post fertilisation product of pistel (b) product of flower (c) body having seeds (d) product of ovary

(iii) Parthenocarp is a fruit (a) formed from superior ovary (b) formed from inferior ovary (c) consisting of ripened ovary and thalamus (d) which does not possess seeds

(iv) A fruit when is constricted in between the seeds is (a) Regma (b) Samara (c) lomantium (d) Frllicle

(v) Schizocarpic fruit splits up into (a) Achenial fruit (b) Capsular (c) Schizocarpic (d) Drupe

You may also like:

Last modified on:2 years agoReading Time:4MinutesIn CBSE Class 12 Biology Paper, Students will have to answer some questions based on Assertion and Reason. There will be a few questions based on case studies and passage based as well. In that, a paragraph will be given, and then the MCQ questions based on it will be asked.…

Case Study and Passage Based Questions for Class 12 Biology Chapter 3 Human Reproduction

Last modified on:2 years agoReading Time:4MinutesIn CBSE Class 12 Biology Paper, Students will have to answer some questions based on Assertion and Reason. There will be a few questions based on case studies and passage based as well. In that, a paragraph will be given, and then the MCQ questions based on it will be asked. Here,…

Case Study Questions for Class 12 Biology Chapter 8 Human Health and Diseases

Last modified on:2 years agoReading Time:6MinutesCase Study Questions for Class 12 Biology Chapter 8 Human Health and Diseases Question 1: In a study to test a new vaccine against a viral disease, mouse model testing is done. In this process, mice are vaccinated and their blood samples were tested. Mice developed mild disease symptom. After few…

Case Study Questions for Class 12 Biology Chapter 10 Microbes in Human Welfare

Last modified on:2 years agoReading Time:3MinutesCase Study Questions for Class 12 Biology Chapter 10 Microbes in Human Welfare Question 1: Villagers in a place near Chambur started planning to make power supply for agricultural purposes from cow dung. They have started a biogas plant for the purpose. Study the flow chart for biogas production given below…

Case Study Questions for Class 12 Biology Chapter 11 Biotechnology – Principles and Techniques

Last modified on:2 years agoReading Time:4MinutesCase Study Questions for Class 12 Biology Chapter 11 Biotechnology – Principles and Techniques Question 1: The DNA, which is transferred from one organism into another by joining it with the vehicle DNA is called passenger or foreign DNA. Generally three types of passenger DNAs are used. These are complementary DNA…

Case Study Questions for Class 12 Biology Chapter 12 Biotechnology and Its Applications

Last modified on:2 years agoReading Time:5MinutesCase Study Questions for Class 12 Biology Chapter 12 Biotechnology and Its Applications Question 1: Transgenic cows have extra gene or genes inserted into their DNA. Firstly the genes for the desired product is identified and sequenced. Then a gene construct containing this desired gene is introduced into female cow cells.…

Download CBSE Books

Exam Special Series:

• Sample Question Paper for CBSE Class 10 Science (for 2024)
• Sample Question Paper for CBSE Class 10 Maths (for 2024)
• CBSE Most Repeated Questions for Class 10 Science Board Exams
• CBSE Important Diagram Based Questions Class 10 Physics Board Exams
• CBSE Important Numericals Class 10 Physics Board Exams
• CBSE Practical Based Questions for Class 10 Science Board Exams
• CBSE Important “Differentiate Between” Based Questions Class 10 Social Science
• Sample Question Papers for CBSE Class 12 Physics (for 2024)
• Sample Question Papers for CBSE Class 12 Chemistry (for 2024)
• Sample Question Papers for CBSE Class 12 Maths (for 2024)
• Sample Question Papers for CBSE Class 12 Biology (for 2024)
• CBSE Important Diagrams & Graphs Asked in Board Exams Class 12 Physics
• Master Organic Conversions CBSE Class 12 Chemistry Board Exams
• CBSE Important Numericals Class 12 Physics Board Exams
• CBSE Important Definitions Class 12 Physics Board Exams
• CBSE Important Laws & Principles Class 12 Physics Board Exams
• 10 Years CBSE Class 12 Chemistry Previous Year-Wise Solved Papers (2023-2024)
• 10 Years CBSE Class 12 Physics Previous Year-Wise Solved Papers (2023-2024)
• 10 Years CBSE Class 12 Maths Previous Year-Wise Solved Papers (2023-2024)
• 10 Years CBSE Class 12 Biology Previous Year-Wise Solved Papers (2023-2024)
• ICSE Important Numericals Class 10 Physics BOARD Exams (215 Numericals)
• ICSE Important Figure Based Questions Class 10 Physics BOARD Exams (230 Questions)
• ICSE Mole Concept and Stoichiometry Numericals Class 10 Chemistry (65 Numericals)
• ICSE Reasoning Based Questions Class 10 Chemistry BOARD Exams (150 Qs)
• ICSE Important Functions and Locations Based Questions Class 10 Biology
• ICSE Reasoning Based Questions Class 10 Biology BOARD Exams (100 Qs)

✨ Join our Online JEE Test Series for 499/- Only (Web + App) for 1 Year

✨ Join our Online NEET Test Series for 499/- Only for 1 Year

Leave a Reply Cancel reply

Join our Online Test Series for CBSE, ICSE, JEE, NEET and Other Exams

Editable Study Materials for Your Institute - CBSE, ICSE, State Boards (Maharashtra & Karnataka), JEE, NEET, FOUNDATION, OLYMPIADS, PPTs

Discover more from Gurukul of Excellence

Subscribe now to keep reading and get access to the full archive.

Type your email…

Continue reading

Case Based Questions – Class 12 Biology

As per the CBSE sample papers released this year, there will be one case based question in the section-C. There will be a total of 6 questions based on the given case. This post Case Based Questions – Class 12 Biology has the links to chapter wise case based questions.

Share this:

• Click to print (Opens in new window)
• Click to share on WhatsApp (Opens in new window)
• Click to share on Twitter (Opens in new window)
• Click to share on Facebook (Opens in new window)
• Click to share on LinkedIn (Opens in new window)
• Click to share on Pinterest (Opens in new window)
• Click to share on Telegram (Opens in new window)

Leave a Reply Cancel reply

Not Able To Find Desired Paper or Worksheet SEARCH

Find papers & worksheets search, class 12 biology case study questions chapter 14 ecosystem.

• (0) Comments
• 3 Downloads

Related Papers

Click to view more related papers, display_name = "class 11" && $paper->display_name = "class 12") { // echo $paper->display_name." questions papers and worksheets"; } //else { // echo $paper->display_name." sample papers and previous year papers"; //} //>, important questions for class 12 biology chapter wise with answers.

Get here all the Important questions for Class 12 Biology chapter wise as free PDF download. Here you will get Extra Important Questions with answers, assertion reasoning and Multiple Choice Questions (MCQ's) chapter wise in Printable format. Class 12 Biology has 16 important chapters covering various important topics related to human physiology evolution, diseases, genetics, organisms, populations, etc.Solving Chapter wise questions is one of the best ways to prepare for the examination. Students are advised to understand the concepts and theories of Biology properly before the exam. You can easily find 1 Mark, 2 marks, 3 marks, and 5 marks questions from each chapter of Class 12 Biology and prepare for exam more effectively. These preparation material for Class 12 Biology , shared by teachers, parents and students, are as per latest NCERT and CBSE Pattern syllabus and assure great success in achieving high score in Final CBSE Board Examinations.

Latest MCQ's and Important Questions for CBSE Class 12 Biology

Reproduction in Organisms class 12 important questions pdf Sexual Reproduction in Flowering Plants class 12 important questions pdf Human Reproduction class 12 important questions pdf Reproductive Health class 12 important questions pdf Principles of Inheritance and Variation class 12 important questions pdf Molecular Basis of Inheritance class 12 important questions pdf Evolution class 12 important questions pdf Human Health and Diseases class 12 important questions pdf Strategies for Enhancement in Food Production class 12 important questions pdf Microbes in Human Welfare class 12 important questions pdf Biotechnology Principles and Processes class 12 important questions pdf Organisms and Populations class 12 important questions pdf Ecosystem class 12 important questions pdf Biodiversity and Conservation class 12 important questions pdf Environmental Issues class 12 important questions pdf important questions of chapter 1 biology class 12 important questions of chapter 2 biology class 12 important questions of chapter 3 biology class 12 important questions of chapter 4 biology class 12 important questions of chapter 5 biology class 12 important questions of chapter 6 biology class 12 important questions of chapter 7 biology class 12 important questions of chapter 8 biology class 12 important questions of chapter 9 biology class 12 important questions of chapter 10 biology class 12 important questions of chapter 11 biology class 12 important questions of chapter 12 biology class 12 important questions of chapter 13 biology class 12 important questions of chapter 14 biology class 12 important questions of chapter 15 biology class 12 important questions of chapter 16 biology class 12 Reproduction in Organisms class 12 mcq Sexual Reproduction in Flowering Plants class 12 mcq Human Reproduction class 12 mcq Reproductive Health class 12 mcq Principles of Inheritance and Variation class 12 mcq Molecular Basis of Inheritance class 12 mcq Evolution class 12 mcq Human Health and Diseases class 12 mcq Strategies for Enhancement in Food Production class 12 mcq Microbes in Human Welfare class 12 mcq Biotechnology Principles and Processes class 12 mcq Biotechnology: and its Application class 12 mcq Organisms and Populations class 12 mcq Ecosystem class 12 mcq Biodiversity and Conservation class 12 mcq Environmental Issues class 12 mcq case based questions class 12 biology chapter 1 case based questions class 12 biology chapter 2 case based questions class 12 biology chapter 3 case based questions class 12 biology chapter 4 case based questions class 12 biology chapter 5 case based questions class 12 biology chapter 6 case based questions class 12 biology chapter 7 case based questions class 12 biology chapter 8 case based questions class 12 biology chapter 9 case based questions class 12 biology chapter 10 case based questions class 12 biology chapter 11 case based questions class 12 biology chapter 12 case based questions class 12 biology chapter 13 case based questions class 12 biology chapter 14 case based questions class 12 biology chapter 15 case based questions class 12 biology chapter 16 Assertion Reason questions Biology Class 12 Chapter 1 Assertion Reason questions Biology Class 12 Chapter 2 Assertion Reason questions Biology Class 12 Chapter 3 Assertion Reason questions Biology Class 12 Chapter 4 Assertion Reason questions Biology Class 12 Chapter 5 Assertion Reason questions Biology Class 12 Chapter 6 Assertion Reason questions Biology Class 12 Chapter 7 Assertion Reason questions Biology Class 12 Chapter 8 Assertion Reason questions Biology Class 12 Chapter 9 Assertion Reason questions Biology Class 12 Chapter 10 Assertion Reason questions Biology Class 12 Chapter 11 Assertion Reason questions Biology Class 12 Chapter 12 Assertion Reason questions Biology Class 12 Chapter 13 Assertion Reason questions Biology Class 12 Chapter 14 Assertion Reason questions Biology Class 12 Chapter 15 Assertion Reason questions Biology Class 12 Chapter 16

Total Papers :

CBSE Class 12 Biology Syllabus

• Reproduction in Organisms
• Sexual Reproduction in Flowering Plants
• Human Reproduction
• Reproductive Health
• Principles of Inheritance and Variation
• Molecular Basis of Inheritance
• Human Health and Diseases
• Strategies for Enhancement in Food Production
• Microbes in Human Welfare
• Biotechnology - Principles and Processes
• Biotechnology and its Application
• Organisms and Populations
• Biodiversity and its Conservation
• Environmental Issues

Course Syllabus Details

Unit vi. reproduction.

Chapter 1: Reproduction in Organisms

• A characteristic feature of all organisms for continuation of species
• Asexual reproduction
• Sexual reproduction
• Modes-Binary fission
• Sporulation
• Fragmentation
• vegetative propagation in plants

Chapter 2: Sexual Reproduction in Flowering Plants

• Flower structure
• Development of male and female gametophytes
• Outbreeding devices
• Pollen-Pistil interaction
• Double fertilization
• Post fertilization Events-Development of endosperm and embryo
• Development of seed and formation of fruit
• Parthenocarpy
• Polyembryony
• Significance of seed and fruit formation

Chapter 3: Human Reproduction

• Male and female reproductive systems
• Microscopic anatomy of testis and ovary
• Spermatogenesis
• Menstrual cycle
• Fertilisation embryo development up to blastocyst formation, implantation pregnancy and placenta formation (Elementary idea)
• Parturition (Elementary idea)
• Lactation (Elementary idea)

Chapter 4: Reproductive Health

• Need for reproductive health and prevention of sexually transmitted diseases (STD)
• Need and Methods
• Contraception
• Medical Termination of Pregnancy (MTP)
• Amniocentesis
• GIFT (Elementary idea for general awareness)

Unit VII. Genetics and Evolution

Chapter 5: Principles of Inheritance and Variation

• Mendelian Inheritance
• Incomplete dominance
• Co-dominance
• Multiple alleles
• Inheritance of blood groups
• Elementary idea of polygenic inheritance
• Chromosome theory of inheritance
• Chromosomes and genes
• Linkage and crossing over
• Haemophilia
• Colour blindness
• Thalassemia
• Down's syndrome
• Klinefelter's syndromes

Chapter 6: Molecular Basis of Inheritance

• Search for genetic material and DNA as genetic material
• Structure of DNA and RNA
• DNA packaging
• DNA replication
• Central dogma
• Transcription, genetic code, translation
• Genome and human ganeome project
• DNA fingerprinting

Chapter 7: Evolution

• Origin of life
• Biological evolution and evidences for biological evolution (Paleontological, comparative anatomy, embryology and molecular evidence)
• Darwin's contribution
• Modern Synthetic theory of Evolution
• Variation (Mutation and Recombination)
• Natural Selection with examples
• Types of natural selection
• Gene flow and genetic drift
• Hardy - Weinberg's principle
• Adaptive Radiation
• Human evolution

Unit VIII. Biology and Human Welfare

Chapter 8: Human Health and Diseases

• Common cold
• Adolescence, drug and alcohol abuse

Chapter 9: Strategies for Enhancement in Food Production

• Plant breeding
• Tissue culture
• Single cell protein
• Biofortification
• Apiculature
• Animal husbandry

Chapter-10: Microbes in Human Welfare

• In household food processing
• Industrial production
• Sewage treatment
• Energy generation and as biocontrol agents
• Biofertilizers
• Production and judicious use

Unit IX. Biotechnology and Its Applications

Chapter 11: Biotechnology - Principles and Processes

• Genetic engineering (Recombinant DNA technology).

Chapter 12: Biotechnology and its Application

• Human insulin and vaccine production, gene therapy
• Genetically modified organisms - Bt crops
• Transgenic Animals; biosafety issues, biopiracy and patents

Unit X. Ecology and Environment

Chapter 13: Organisms and Populations

• Ecological adaptations
• Competition
• Age distribution

Chapter 14: Ecosystem

• Productivity
• Decomposition
• Energy flow
• Pyramids of number, biomass, energy
• Nutrient cycles (carbon and phosphorous)
• Ecological succession
• Carbon fixation
• Pollination
• Seed dispersal
• Oxygen release (in brief)

Chapter-15: Biodiversity and its Conservation

• Concept of biodiversity
• Patterns of biodiversity
• Importance of biodiversity
• Loss of biodiversity
• Endangered organisms
• Red data book
• Biosphere reserves
• National parks
• Sanctuaries
• Ramsar sites

Chapter-16: Environmental Issues

• Air pollution and its control
• Water pollution and its control
• Agrochemicals and their effects
• Solid waste management
• Radioactive waste management
• Greenhouse effect and climate change
• Ozone layer depletion
• Deforestation
• Any one case study as success story addressing environmental issue(s).

Practical Works

Part A: List of Experiments

• Study pollen germination on a slide.
• Collect and study soil from at least two different sites and study them for texture, moisture content, pH and water holding capacity. Correlate with the kinds of plants found in them.
• Collect water from two different water bodies around you and study them for pH, clarity and presence of any living organisms.
• Study the presence of suspended particulate matter in air at two widely different sites.
• Study of plant population density by quadrat method.
• Study of plant population frequency by quadrat method.
• Prepare a temporary mount of onion root tip to study mitosis.
• Study the effect of different temperatures and three different pH on the activity of salivary amylase on starch.
• Isolation of DNA from available plant material such as spinach, green pea seeds, papaya, etc.

Part B: Study/observation of the following (Spotting)

• Flowers adapted to pollination by different agencies (wind, insect, bird).
• Pollen germination on stigma through a permanent slide.
• Identification of stages of gamete development, i.e., T.S. of testis and T.S. of ovary through permanent slides (from grasshopper/mice).
• Meiosis in onion bud cell or grasshopper testis through permanent slides.
• T.S. of blastula through permanent slides.
• Mendelian inheritance using seeds of different colour/sizes of any plant.
• Prepared pedigree charts of any one of the genetic traits such as rolling of tongue, blood groups, ear lobes, widow's peak and colour blindness.
• Controlled pollination - emasculation, tagging and bagging.
• Common disease causing organisms like Ascaris, Entamoeba, Plasmodium, Roundworm through permanent slides or specimens. Comment on symptoms of disease that they cause.
• Two plants and two animals (models/virtual images) found in xeric conditions. Comment upon their morphological adaptations.
• Two plants and two animals (models/virtual images) found in aquatic conditions. Comment upon their morphological adaptations.

Structure of CBSE Biology Sample Paper for Class 12 Science is

For Preparation of exams students can also check out other resource material

CBSE Class 12 Biology Sample Papers

CBSE Class 12 Biology Worksheets

CBSE Class 12 Biology Question Papers

CBSE Class 12 Biology Test Papers

CBSE Class 12 Biology Revision Notes

Question Bank of Other Subjects of Class 12

Importance of Question Bank for Exam Preparation?

There are many ways to ascertain whether a student has understood the important points and topics of a particular chapter and is he or she well prepared for exams and tests of that particular chapter. Apart from reference books and notes, Question Banks are very effective study materials for exam preparation. When a student tries to attempt and solve all the important questions of any particular subject , it becomes very easy to gauge how much well the topics have been understood and what kind of questions are asked in exams related to that chapter.. Some of the other advantaging factors of Question Banks are as follows

• Since Important questions included in question bank are collections of questions that were asked in previous exams and tests thus when a student tries to attempt them they get a complete idea about what type of questions are usually asked and whether they have learned the topics well enough. This gives them an edge to prepare well for the exam.Students get the clear idea whether the questions framed from any particular chapter are mostly either short or long answer type questions or multiple choice based and also marks weightage of any particular chapter in final exams.
• CBSE Question Banks are great tools to help in analysis for Exams. As it has a collection of important questions that were asked previously in exams thereby it covers every question from most of the important topics. Thus solving questions from the question bank helps students in analysing their preparation levels for the exam. However the practice should be done in a way that first the set of questions on any particular chapter are solved and then solutions should be consulted to get an analysis of their strong and weak points. This ensures that they are more clear about what to answer and what can be avoided on the day of the exam.
• Solving a lot of different types of important questions gives students a clear idea of what are the main important topics of any particular chapter that needs to focussed on from examination perspective and should be emphasised on for revision before attempting the final paper. So attempting most frequently asked questions and important questions helps students to prepare well for almost everything in that subject.
• Although students cover up all the chapters included in the course syllabus by the end of the session, sometimes revision becomes a time consuming and difficult process. Thus, practicing important questions from Question Bank allows students to check the preparation status of each and every small topic in a chapter. Doing that ensures quick and easy insight into all the important questions and topics in each and every individual. Solving the important questions also acts as the revision process.

Question Bank of Other Classes

To Prepare better for CBSE paperclass; ?> " title="Download Free CBSE Papers">Ribblu.com brings to you all the previous years papers & worksheets of subject; ?//> for CBSE paperclass; ?>. This CBSE paper and worksheet can be instrumental in students achieving maximum marks in their exams. These Papers and worksheets help students gain confidence and make them ready to face their school examinations. These Papers and worksheets school wise, covers important concepts from an examination perspective. Students and parents can download all the available papers & worksheets directly in the form of PDF. One can use these papers and worksheets to get extensive practice and familiarise themselves with the format of the question paper.

You can help other users

Be the first to write comment .

Upload papers and the more your paper get downloaded the more you earn the points

You may send papers on email [email protected] along with userid

• Downloaded by: Poornima Hegde
• Downloaded by: sabari giri
• Downloaded by: Subhomoy Kundu

Rules and regulations for uploads

Write your comment, report this paper, how to earn points.

Upload Papers / Worksheets and Earn 50 Points.

The uploaded material should be original paper or worksheet of any school. Check out some videos on how to upload papers on ribblu

Rate & Review your school and Earn 25 Points.

Review any school that you may be knowing and once your review is approved, you will be credited with 25 points.

Answer on question posted on JustAsk and earn 15 points.

JustAsk is a platform where you can help others to find answers of any question. Share your Knowledge. Answer questions and once approved you will earn 15 points

Complete your profile and earn upto 25 Points.

Edit and complete your user profile and earn points. The more details you submit, the more points you will earn.

Download Ribblu Mobile App and you will (Earn 20 Points) (one time only)

CBSE Schools

• CBSE Schools In Delhi
• CBSE Schools In Noida
• CBSE Schools In Greater Noida
• CBSE Schools In Faridabad
• CBSE Schools In Ghaziabad
• CBSE Schools In Gurgaon
• CBSE Schools In Mumbai
• CBSE Schools In Pune
• CBSE Schools In Bangalore
• CBSE Schools In Hyderabad
• CBSE Schools In Kolkata
• CBSE Schools In Chennai
• CBSE Schools In Patna
• CBSE Schools In Meerut
• CBSE Schools In Kanpur
• CBSE Schools In Indore
• CBSE Schools In Ludhiana
• CBSE Schools In Dehradun

Top Schools

• Schools In Delhi
• Schools In Noida
• Schools In Greater Noida
• Schools In Faridabad
• Schools In Ghaziabad
• Schools In Gurgaon
• Schools In Mumbai
• Schools In Pune
• Schools In Bangalore
• Schools In Hyderabad
• Schools In Kolkata
• Schools In Chennai
• Schools In Patna
• Schools In Meerut
• Schools In Kanpur
• Schools In Indore
• Schools In Ludhiana
• Schools In Dehradun

Other Schools

• Pre Nursery Schools In Noida
• Day Boarding Schools In Noida
• Pre Nursery Schools In Gurgaon
• Pre Nursery Schools In Delhi
• Play Schools In Delhi
• Day Boarding Schools In Delhi

CBSE Papers

• CBSE Class 1 Sample Papers
• CBSE Class 2 Sample Papers
• CBSE Class 3 Sample Papers
• CBSE Class 4 Sample Papers
• CBSE Class 5 Sample Papers
• CBSE Class 6 Sample Papers
• CBSE Class 7 Sample Papers
• CBSE Class 8 Sample Papers

Paper Categories

• Question Bank
• Question Papers
• Revision Notes
• Sample Papers
• Test Papers
• CBSE Class 9 Sample Papers
• CBSE Class 10 Sample Papers
• CBSE Class 11 Sample Papers
• CBSE Class 12 Sample Papers

No products in the cart.

Due to the festival holidays, please expect a delay in the Physical books order dispatch and delivery process.

• Computer Science Olympiad (ICSO) Books
• English Olympiad (IEO) Books
• GK Olympiad (IGKO) Books
• Maths Olympiad (IMO) Books
• Science Olympiad (NSO) Books
• Olympiads Combo Packs
• SST Olympiad (ISSO) Books
• Hindi Olympiad (IHO) Books
• Maths Olympiad (IMO) Books – 9
• Commerce Olympiad (ICO) Books
• NEET Champion
• NEET Previous Years Paper
• NEET Sample Paper
• NEET Crash Course
• Online Tests
• NCERT Fingertips
• NEET Biology Books
• NEET Physics Books
• NEET Chemistry Books
• Assertion & Reason
• AIIMS Previous Years Paper
• GK & Aptitude
• JIPMER Previous Years Paper
• JEE Main Guide
• JEE PREVIOUS YEARS PAPER
• JEE Sample Papers
• JEE Crash Course
• JEE Champion
• JEE Mathematics Books
• JEE Physics Books
• JEE Chemistry Books
• KCET Books – Karnataka CET
• KEAM Books – Kerala Engineering Exam
• WBJEE Books – West Bengal JEE
• BITSAT Exam Books
• MHT CET Books – Maharashtra CET
• Live Classes
• Recorded Classes
• Monthly Magazine – Single Issue
• Monthly Magazines – Subscription
• Monthly Magazine: Older Volumes
• Foundation Course Class 6
• Foundation Course Class 7
• Foundation Course Class 8
• Foundation Course Class 9
• Foundation Course Class 10
• NCERT Solutions Class 6
• NCERT Solutions Class 7
• NCERT Solutions Class 8
• NCERT Solutions Class 9
• NCERT Solutions Class 10
• NCERT Solutions Class 11
• NCERT Solutions Class 12
• CBSE Class 9 Books
• CBSE Class 10 Reference Books
• CBSE Class 10 Sample Paper Books
• CBSE Class 10 Previous Year Solved Paper Books
• CBSE Class 11 Books
• CBSE Reference Books for Class 12
• CBSE Previous Year Papers class 12 Books
• CBSE Sample Papers for Class 12
• Competitive Books
• Olympiad Books
• Govt. Exams
• 21 Science Crossword Puzzles
• 51 English Grammar Worksheets
• IGKO Online Test Programme
• Literature Books
• Vedic Mathematics
• Science Skill Development
• Mathematics Skill Development
• English Skill Development
• Summer Programme Combo
• Psychometric Online Test
• General ebooks

Click on the image to zoom in

Read reviews (0)

Write a review

Score More Case Study Chapter wise Practice Questions Biology Class-12

₹ 125.00 ₹ 93.75 (25% Off)

Discount offer on this book in a bundle, click to view

ScoreMore Case Study Chapter-wise Practice Questions Biology Class-12 is curated with 750+ Chapter-wise MCQs related to Case study/ Passage based and Assertion & Reason with hints and explanations based on latest pattern of CBSE (2020-2021).

67 in stock

Your security guaranteed

• Description
• Table of content
• Additional information
• Reviews (0)

MTG ScoreMore Case Study Based Sample Questions Biology Class 12 is specially designed to help students get familiar with solving these new patterns of questions. The book covers 750 + sample questions for practice with detailed explanations to each question. Practising these questions will definitely help students to get an edge in their CBSE preparations.

For the academic year 2020-21 CBSE has incorporated more Objective type/MCQ based questions which will focus on measuring critical thinking ability of students.

The new pattern of questions includes Case study based questions, Passage based questions, Assertion and Reason type questions. In Case study based/ Passage based questions, students will be expected to answer questions after reading a given paragraph or a passage. Assertion and Reason type question is just another way of checking the clarity of one’s concept.

• 1. Reproduction in Organisms*
• 2. Sexual Reproduction in Flowering Plants
• 3. Human Reproduction
• 4. Reproductive Health
• 5. Principles of Inheritance and Variation
• 6. Molecular Basis of Inheritance
• 7. Evolution*
• 8. Human Health and Diseases
• 9. Strategies for Enhancement in Food Production*
• 10. Microbes in Human Welfare
• 11. Biotechnology : Principles and Processes
• 12. Biotechnology and its Applications
• 13. Organisms and Populations
• 14. Ecosystem*
• 15. Biodiversity and its Conservation
• 16. Environmental Issues*
• *This chapter is not a part of the Board Examination 2020-21 syllabus

There are no reviews yet.

Your email address will not be published. Required fields are marked *

Your review  *

Name  *

Email  *

Save my name, email, and website in this browser for the next time I comment.

Customers prefer to buy this combination offer...

Score More Case Study Chapter wise Practice Questions Combo-Phy,Chem, Bio,Maths Class-12

Total Price = ₹ 500.00

Combo Price = ₹ 375.00

Score More Case Study Chapter wise Practice Questions Chemistry Class-12

Score More Case Study Chapter wise Practice Questions Maths Class-12

Score More Case Study Chapter wise Practice Questions Physics Class-12

• Notifications
• Institutional Queries

Username or Email Address

Class Select Class Class 1 Class 2 Class 3 Class 4 Class 5 Class 6 Class 7 Class 8 Class 9 Class 10 Class 11 Class 12

Phone number

Class Select Class Class 1 Class 2 Class 3 Class 4 Class 5 Class 6 Class 7 Class 8 Class 9 Class 10 Class 11 Class 12 Others

Country  * Afghanistan Åland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belau Belgium Belize Benin Bermuda Bhutan Bolivia Bonaire, Saint Eustatius and Saba Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo (Brazzaville) Congo (Kinshasa) Cook Islands Costa Rica Croatia Cuba Curaçao Cyprus Czech Republic Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Eswatini Ethiopia Falkland Islands Faroe Islands Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Gambia Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and McDonald Islands Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Isle of Man Israel Italy Ivory Coast Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kuwait Kyrgyzstan Laos Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Micronesia Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russia Rwanda São Tomé and Príncipe Saint Barthélemy Saint Helena Saint Kitts and Nevis Saint Lucia Saint Martin (Dutch part) Saint Martin (French part) Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia/Sandwich Islands South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu Uganda Ukraine United Arab Emirates United Kingdom (UK) United States (US) United States (US) Minor Outlying Islands Uruguay Uzbekistan Vanuatu Vatican Venezuela Vietnam Virgin Islands (British) Virgin Islands (US) Wallis and Futuna Western Sahara Yemen Zambia Zimbabwe

Mobile number *

Email address  *

Password  *

Lost your password? Please enter your username or email address. You will receive a link to create a new password via email.

Username or email

Reset password

Just remembered? Log In Instead

Don’t have an account? Register with us

• School Guide
• CBSE Notes for Class 8
• CBSE Notes for Class 9
• CBSE Notes for Class 10
• CBSE Notes for Class 11
• CBSE Notes for Class 12

NCERT Solutions

• English Grammar
• Basic Maths Formulas

NCERT Class 12 Biology - Latest Syllabus Based Study Material

This study material provides an in-depth look at ncert class 12 biology, offering practical advice and resources to help students score high in their class 12 biology board exam. it is an invaluable resource for anyone looking to gain a better understanding of the fundamentals of biology..

Discover a smoother learning journey through our effortless roadmap

Chapter 1- Sexual Reproduction In Flowering Plants

Sexual Reproduction in Flowering Plants - Class 10 Notes

Parts of a Flower and their Functions

Pollen Grains

The Structure and Functions of Pistil

Pollination

Double Fertilization: Process & Significance

Post Fertilization

Apomixis and Polyembryony: Differences, Types, Significance

Chapter 2- Human Reproduction

Male Reproductive System - Structure, Organs, Functions

Female Reproductive System

Gametogenesis - Spermatogenesis and Oogenesis

Menstrual Cycle

Fertilizations And Implantation

Embryo Development - Development Process of Fetus

Parturition And Lactation - Biology Notes Class 12

Chapter 3- Reproductive Health

Notes on NCERT for Class 12 Biology Chapter 3 Reproductive Health

Population Stabilization And Birth Control - Class 12

Medical Termination of Pregnancy (MTP)

Sexually Transmitted Infections (STIS) of Reproductive Health Class 12

Infertility of Reproductive Health Biology Class 12

Chapter 4- Principles Of Inheritance And Variation

14 articles

Principles of Inheritance and Variation CBSE Notes for Chapter 4

Mendel's Laws of Inheritance | Mendel's Experiments

Inheritance of One Gene Notes

Gregor Mendel and the Principles of Inheritance

Law of Segregation And Law of Dominance

Chromosomal Theory of Inheritance

Linkage And Recombination - Principles Of Inheritance And Variation Class 12 NCERT

What is Polygenic Inheritance?

Pleiotropy - An Overview and Related Disorders

Sex Determination

Pedigree Analysis

Mendelian Disorder in Human

Chromosomal Disorders: Principles of Inheritance And Variation Class12

Chapter 5- Molecular Basis Of Inheritance

16 articles

Molecular Basis of Inheritance Notes Class 12

DNA: Structure, Types, and Functions

Packaging of DNA Helix: Histones & Importance

Search For Genetic Material - Molecular Basis Of Inheritance

Difference Between DNA and RNA

RNA - Definition, Structure, Types and Functions

DNA Replication

The Experimental Proof Of DNA Replication

Transcription of DNA

Genetic Code - Molecular Basis of Inheritance

Genetic Code and Mutations

tRNA - the Adapter Molecule

RNA Translation

Human Genome Project

What is DNA Fingerprinting?

Chapter 6- Evolution

Origin of Life

Evolution Of Life Forms – A Theory

What is Adaptive Radiation?

Hardy-Weinberg Principle

Evolution Of Humans - History, Stages, Characteristics, FAQs

Chapter 7- Human Health And Diseases

10 articles

NCERT Notes on Class 12 Biology Chapter 7 - Human Health and Disease

Common Diseases In Humans

Immunity - Definition, Types and Vaccination

Innate And Acquired Immunity

What are HIV and AIDS?

Difference Between Vaccination And Immunization

What is Cancer? Introduction, Types, Stages, Treatment

Alcohol and Drug Abuse Prevention Control

Adolescence and Drug Abuse

Addiction And Dependence

Chapter 8- Microbes In Human Welfare

Microbes in Human Welfare Notes

Microbes In Human Welfare

Biofertilizers

Chapter 9- Biotechnology - Principles And Processes

NCERT Notes Biology Class 12 Chapter 9 Biotechnology: Principles and Processes

Restriction Enzymes

Competent Host in Recombinant DNA

Recombinant DNA Technology

Chapter 10- Biotechnology And Its Application

CBSE Class 12 Biology Biotechnology And Its Application Revision Notes

Application of Biotechnology

Genetically Engineered Insulin

Biotechnology And Its Application- Gene Therapy

Molecular Diagnosis

Transgenic Animals Notes - Biotechnology And Its Application

Ethical Issues Related to Genetically Modified Organisms

Chapter 11- Organisms And Populations

13 articles

Organism and Population Notes Class 12 Biology Chapter 11

Components of Ecosystem - Biotic and Abiotic

Abiotic Components

Responses To Abiotic Factors - Organisms And Populations

What is Adaptation?

Population Attributes - Overview Notes- Class 12

Population Growth - CBSE Class 12

Population Interactions

Competition Interaction Notes Class 12

What Is Parasitism? Definition, Types and Examples

Commensalism

Chapter 12- Ecosystem

11 articles

Ecosystem Notes Class 12 Biology Chapter 12

What is Ecosystem? Definition, Structure, Types, and Functions

Productivity in Ecosystem: Definition, Types & Diagram

Decomposition - CBSE Class 12

Energy Flow of Ecosystem

Ecological Pyramid - Definition, Types, Importance, Limitations

Ecological Succession - Definition, Types, Characteristics, Causes

What is Nutrient Cycling?

Carbon Cycle

Phosphorus Cycle

Types of Ecosystem Services - CBSE Class 12- Ecosystem

Chapter 13 - Biodiversity And Its Conservation

Biodiversity and Conservation Notes Class 12 Chapter 13

How Many Species Are There On Earth And How Many In India?

Pattern of Biodiversity

Biodiversity Conservation

NCERT Solution of Class 12 Biology

Sexual Reproduction in Flowering Plants NCERT Solutions

NCERT Solutions for Class 12 Chapter 2 Human Reproduction

NCERT Solutions for Class 12 Biology Chapter 3 Reproductive Health

NCERT Solutions Class 12 Biology Chapter 4 Principles of Inheritance and Variation

NCERT Solutions Class 12 Biology Chapter 5 Molecular Basis of Inheritance

NCERT Solutions for Class 12 Biology Chapter 6 Evolution

NCERT Solutions for Class 12 Biology Chapter 7 Human Health and Disease

NCERT Solutions for Class 12 Biology Chapter 8

NCERT Solutions Class-12 Chapter 9 Biotechnology: Principles and Processes

NCERT Solutions for Class 12 Biology Chapter 10 Biotechnology and Its Applications

CBSE Solutions for Class 12 Biology Chapter 11 Organisms and Populations

CBSE Solutions for Class 12 Biology Chapter 13 Biodiversity and Conservation

Class 12 Paper Set

CBSE Class 12 Biology Previous Year Question Paper - 2023

CBSE Class 12 Previous Year Question Paper for Biology (2022)

CBSE Class 12 Previous Year Question Papers

The Class 12 Biology materials are made by expert mentors to help you learn both book stuff and real experiments. You'll get to mix solutions, look at tiny cells under a microscope, and find out how sound bounces off things. It's all about making science fun and easy to get. It will help Students to encourage hands-on learning and a deeper understanding of the concepts.

What do we offer?

Our focus goes beyond memorization, helping students apply concepts and success for the students who want to make their career in the medical field. Here, We provide in-depth chapter-wise explanations, solved NCERT problems, and quizzes to ensure a well-rounded learning experience.

Key Highlights of this Study Material:

• Comprehensive Coverage: We cover the entire NCERT syllabus with in-depth explanations, making sure you understand every concept.
• Expert Guidance: Learn from experienced educators who break down complex topics into easy-to-grasp modules.
• Exam-Oriented Approach: Focus on mastering key concepts and practicing with questions aligned with the CBSE exam format.
• Engaging Learning: Interactive tools, quizzes, and practice tests make learning fun and effective.

Preparation Tips

• Know what to study and how much weightage each topic holds.
• Allocate time effectively for each subject based on difficulty.
• Build a strong foundation with the official CBSE material.
• Utilize reference books, online tutorials, and video lectures.
• Solve previous years' papers to understand the exam format and manage time.
• Go beyond memorization and aim for true comprehension.
• Organize your study materials for efficient review.
• Believe in yourself and keep a positive attitude throughout the preparation.

Sapna Singh

Your content is exemplary, making complex concepts understandable. It's a valuable resource for students preparing for exams. Thank you for your exceptional work!

Ankita Sharma

Great Class 12 Biology content! Well-designed, informative, aids learning. Thank you for dedication to quality resources.

Sandeep Garg

Wow! Your Class 12 Biology study material is awesome! It explains everything so clearly, and the diagrams really help me understand complex topics. Thanks a bunch!

Abhishek Haldar

I just wanted to say a big thank you for your Class 12 Biology study material. It's been a lifesaver for me. The way you explain things makes it so much easier to study.

Q. Which chapter is most important in biology class 12?

There's no single most important chapter. Genetics, cell biology, and human health are foundational for many topics. Understanding reproduction is crucial, and biotechnology and ecology have real-world applications. A strong grasp across all chapters is most beneficial.

Q. Which book is best for Class 12 Biology?

NCERT Biology Textbook is the best book for Class 12 exams as it follows the CBSE curriculum and provides a base for preparing for board exams.

Q. Is the class 12 biology paper tough?

Conquering Class 12 Biology? Difficulty varies! The March 2024 CBSE exam was moderate, with a mix of question styles testing your knowledge, analysis, and application of concepts. Mostly NCERT-based, it emphasized understanding over memorization.

Q. Which is the most easy chapter in biology class 12?

Class 12 Biology has beginner-friendly chapters like Reproduction in Organisms and Human Health and Disease. Focus on understanding core concepts for a strong foundation.

Q. Can I fail in 1 subject in class 12 CBSE Board?

Yes, failing one subject in Class 12 CBSE can lead to failing the entire exam. To pass, you need a minimum of 33% in each of your five main subjects. If you fail one, you'll likely need to retake it in a supplementary exam to pass Class 12.

Improve your Coding Skills with Practice

What kind of Experience do you want to share?

• Book Solutions
• State Boards

Case Study Questions Class 12 Biology Biodiversity and Conservation

Case study questions class 12 biology chapter 15 biodiversity and conservation.

CBSE Class 12 Case Study Questions Biology Biodiversity and Conservation. Term 2 Important Case Study Questions for Class 12 Board Exam Students. Here we have arranged some Important Case Base Questions for students who are searching for Paragraph Based Questions Biodiversity and Conservation.

At Case Study Questions there will given a Paragraph. In where some Important Questions will made on that respective Case Based Study. There will various types of marks will given 1 marks, 2 marks, 3 marks, 4 marks.

CBSE Case Study Questions Class 12 Biology Biodiversity and Conservation

Case study 1

In our biosphere immense diversity (or heterogeneity) exists not only at the species level but at all levels of biological organisation ranging from macromolecules within cells to biomes. Biodiversity is the term popularised by the sociobiologist Edward Wilson to describe the combined diversity at all the levels of biological organisation. The most important of them are– (i) Genetic diversity: A single species might show high diversity at the genetic level over its distributional range. The genetic variation shown by the medicinal plant Rauwolfia vomitoria growing in different Himalayan ranges might be in terms of the potency and concentration of the active chemical (reserpine) that the plant produces. India has more than 50,000 genetically different strains of rice, and 1,000 varieties of mango. (ii) Species diversity: The diversity at the species level, for example, the Western Ghats have a greater amphibian species diversity than the Eastern Ghats. (iii) Ecological diversity: At the ecosystem level, India, for instance, with its deserts, rain forests, mangroves, coral reefs, wetlands, estuaries, and alpine meadows has a greater ecosystem diversity than a Scandinavian country like Norway.

It has taken millions of years of evolution, to accumulate this rich diversity in nature, but we could lose all that wealth in less than two centuries if the present rates of species losses continue. Biodiversity and its conservation are now vital environmental issues of international concern as more and more people around the world begin to realise the critical importance of biodiversity for our survival and well- being on this planet.

Que. 1) ……………………………………………………………………………….. was the one who popularized ‘Biodiversity’ term.

(a) Edward Wilson

(b) Jack Wilson

(c) Albert William

(d) John William

Que. 2) The ………………………………………………………………….. medicinal plant shows genetic variation.

(a) Hypera postia

(b) Nicrophorus aloinis

(c) Oecanthus allardi

(d) Rauwolfia vomitoria

Que. 3) How many levels are there in the diversity?

Que. 4) Which species shows more species diversity in Western Ghats?

Que. 5) Give examples of ecological diversity in India.

Que. 1)(a) Edward Wilson.

Que. 2) (d) Rauwolfia vomitoria.

Que. 3) (c) Three.

Que. 4) Answer: Species of amphibians show more species diversity in Western Ghats.

Que. 5) Answer: In India, rain forests, coral reefs, deserts, estuaries and wetlands all show ecological diversity.

Case study 2

Let us look at some interesting aspects about earth’s biodiversity based on the currently available species inventories. More than 70 per cent of all the species recorded are animals, while plants (including algae, fungi, bryophytes, gymnosperms and angiosperms) comprise no more than 22 per cent of the total. Among animals, insects are the most species-rich taxonomic group, making up more than 70 per cent of the total. That means, out of every 10 animals on this planet, 7 are insects. Again, how do we explain this enormous diversification of insects? The number of fungi species in the world is more than the combined total of the species of fishes, amphibians, reptiles and mammals. Biodiversity is depicted showing species number of major taxa. It should be noted that these estimates do not give any figures for prokaryotes. Biologists are not sure about how many prokaryotic species there might be. The problem is that conventional taxonomic methods are not suitable for identifying microbial species and many species are simply not culturable under laboratory conditions. If we accept biochemical or molecular criteria for delineating species for this group, then their diversity alone might run into millions.

Que. 1) More than 70% ………………………………………………………………………………… species are recorded in the biodiversity.

(b) Animals

(d) None of these

Que. 2) 22% of total is occupied by ……………………………………………………………………………………….. in the biodiversity.

(b) Reptile

Que. 3) In the given estimation, ………………………………………………………………………………… do not have any figures.

(a) Insects

(b) Gymnosperms

(c) Prokaryotes

Que. 4) Which is the most species rich taxonomic group in the animals?

Que. 5) Why biologist are not sure about prokaryotic species when it comes to estimate?

Que. 1)(b) Animals.

Que. 2) (a) Plants.

Que. 3) (c) Prokaryotes.

Que. 4) Answer: Insects species are the most species rich group in the animals.

Que. 5) Answer: The issue which biologists are facing is conventional taxonomic methods. These are not suitable for the identification of microbial species. They might think that if they will consider these species then their diversity alone run into millions. Even the species are not culturable in the laboratories. Hence, the biologist are not sure about prokaryotic species when it comes to estimate.

Case study 3

During his pioneering and extensive explorations in the wilderness of South American jungles, the great German naturalist and geographer Alexander von Humboldt observed that within a region species richness increased with increasing explored area, but only up to a limit. In fact, the relation between species richness and area for a wide variety of taxa (angiosperm plants, birds, bats, freshwater fishes) turns out to be a rectangular hyperbola. On a logarithmic scale, the relationship is a straight line described by the equation log S = log C + Z log A where S= Species richness A= Area Z = slope of the line (regression coefficient) C = Y-intercept Ecologists have discovered that the value of Z lies in the range of 0.1 to 0.2, regardless of the taxonomic group or the region (whether it is the plants in Britain, birds in California or molluscs in New York state, the slopes of the regression line are amazingly similar). But, if you analyse the species-area relationships among very large areas like the entire continents, you will find that the slope of the line to be much steeper (Z values in the range of 0.6 to 1.2). For example, for frugivorous (fruit-eating) birds and mammals in the tropical forests of different continents.

Que. 1) In the species-area relationship equation, species richness is shown by ……………………………………………………………………………… .

Que. 2) According to the ecologist, the value of Z ranges between ………………………………………………………………………………………… .

(a) 0 to 10

(b) 0.1 to 10

(c) 0.1 to 0.2

Que. 3) In the above equation, Z is a …………………………………………………………………………………… .

(a) Y intercept.

(b) Regression coefficient

(c) Slop of the line

(d) Both (b) and (c)

Que. 4) What does Alexander von Humboldt’s observed?

Que. 5) Write an equation which shows Species-area relationship.

Que. 1)(a) S.

Que. 2) (c) 0.1 to 0.2.

Que. 3) (d) Both (b) and (c).

Que. 4) Answer: The Alexander von Humboldt was a geographer and German naturalist. Alexander von Humboldt observed that species richness within an area increases with increasing explored area. But, this happens only up to a limit. This was his observation.

Que. 5)Answer: log S = log C + Z log A. This is equation of Species-area relationship.

Case study 4

The accelerated rates of species extinctions that the world is facing now are largely due to human activities. There are four major causes (‘The Evil Quartet’ is the sobriquet used to describe them). (i) Habitat loss and fragmentation: This is the most important cause driving animals and plants to extinction. The most dramatic examples of habitat loss come from tropical rain forests. Once covering more than 14 per cent of the earth’s land surface, these rain forests now cover no more than 6 per cent. They are being destroyed fast. By the time you finish reading this chapter, 1000 more hectares of rain forest would have been lost. The Amazon rain forest (it is so huge that it is called the ‘lungs of the planet’) harbouring probably millions of species is being cut and cleared for cultivating soya beans or for conversion to grasslands for raising beef cattle. Besides total loss, the degradation of many habitats by pollution also threatens the survival of many species. When large habitats are broken up into small fragments due to various human activities, mammals and birds requiring large territories and certain animals with migratory habits are badly affected, leading to population declines.

Que. 1) ………………………………………………………….……. Is the main reason behind plants and animals extinction.

(a) Crop yield

(b) Soil cultivation

(c) Species

(d) Habitat loss

Que. 2) Which of the following causes loss of biodiversity?

(a) Fragmentation

(b) Gametogenesis

(c) Fermentation

(d) Budding

Que. 3) ……………………………………………………………….. used to covers more than 14% of earth’s land before biodiversity loss.

(b) Forests

(c) Animals

Que. 4) What was the other name of Amazon rain forest?

Que. 5) What is the main reason behind biodiversity loss?

Que. 1)(d) Habitat loss.

Que. 2) (a) Fragmentation.

Que. 3) (b) Forests.

Que. 4) Answer: Amazon rain forest was also known for ‘lungs of the planet’.

Que. 5) Answer: Biodiversity loss mainly causes due to human activities.

Case study 5

Humans have always depended on nature for food and shelter, but when ‘need’ turns to ‘greed’, it leads to over -exploitation of natural resources. Many species extinctions in the last 500 years (Steller’s sea cow, passenger pigeon) were due to overexploitation by humans. Presently many marine fish populations around the world are over harvested, endangering the continued existence of some commercially important species. Co-extinctions: When a species becomes extinct, the plant and animal species associated with it in an obligatory way also become extinct. When a host fish species becomes extinct, its unique assemblage of parasites also meets the same fate. Another example is the case of a coevolved plant-pollinator mutualism where extinction of one invariably leads to the extinction of the other.

The narrowly utilitarian arguments for conserving biodiversity are obvious; humans derive countless direct economic benefits from nature food (cereals, pulses, fruits), firewood, fibre, construction material, industrial products (tannins, lubricants, dyes, resins, perfumes ) and products of medicinal importance. More than 25 per cent of the drugs currently sold in the market worldwide are derived from plants and 25,000 species of plants contribute to the traditional medicines used by native peoples around the world.

Que. 1) When certain species undergoes extinction, then other related species of animals and plants undergo ………………………………………………………………………………… .

(a) Decomposition.

(b) Reproduction

(c) Extinction

(d) Migration

Que. 2) In the biodiversity, species are ………………………………………………………………………………. due to co-extinctions.

(a) Decreased

(b) Increased

(c) Remain the same

(d) Constant

Que. 3) Over-exploitation is done by the …………………………………………………………………………………… .

(b) Insects

Que. 4) What is narrowly utilitarian argument?

Que. 5) Give an example of co-extinction.

Que. 1)(c) Extinction.

Que. 2) (a) Decreased.

Que. 3) (d) Humans.

Que. 4) Answer: Main reason behind narrowly utilitarian argument is the conservation of biodiversity. This argument is about economic benefits that human gets from the plants and other animals. The cereals, pulses and fruits gives us food. Medicinal plants are also important for the diseases. The whole argument is about why to conserve biodiversity. 

Que. 5) Answer: If a fish species will extinct then the parasite which lives in fish body will also extinct. This is an example of co-extinction.

Leave a Reply Cancel reply

Your email address will not be published. Required fields are marked *

Save my name, email, and website in this browser for the next time I comment.

We have a strong team of experienced Teachers who are here to solve all your exam preparation doubts

Manipur board class 6 social science chapter 15 the first empire, rs aggarwal class 8 test paper 4 solutions of cube and cube roots.

Duff and Dutt question bunch class 10 My Own True Family Page 207, 208

New learning composite mathematics class 5 s.k. gupta anubhuti gangal perimeter and area chapter 17a solution.

Sign in to your account

Username or Email Address

Remember Me

Class 12 Biology Case Study Questions Chapter 2 Sexual Reproduction in Flowering Plants

• Post author: studyrate
• Post published:
• Post category: Class 12 / 12 board
• Post comments: 0 Comments

In Class 12 Boards there will be Case studies and Passage Based Questions will be asked, So practice these types of questions. Study Rate is always there to help you. Free PDF Download of CBSE Class 12 Biology Chapter 2 Sexual Reproduction in Flowering Plants Case Study and Passage Based Questions with Answers were Prepared Based on the Latest Exam Pattern. Students can solve NCERT Case Study Questions Sexual Reproduction in Flowering Plants  to know their preparation level.

Join our Telegram Channel, there you will get various e-books for CBSE 2024 Boards exams for Class 9th, 10th, 11th, and 12th.

In CBSE Class 12 Biology Paper, There will be a few questions based on case studies and passage-based as well. In that, a paragraph will be given, and then the MCQ questions based on it will be asked.

Sexual Reproduction in Flowering Plants Case Study Questions With Answers

Here, we have provided case-based/passage-based questions for Class 12 Biology  Chapter 2 Sexual Reproduction in Flowering Plants

Case Study/Passage-Based Questions

Answer: (b) Pollen

(ii) Which of the following statements is correct regarding processes P, Q, and R? (a) Processes P, Q, and R introduce genetic variability in the offspring of sexually reproducing plants X andY. (b) Wind serves as an agent for process Q if plants X and Y belong to Genus Salvia. (c) Flowers of plants X and Y need to produce odor and nectar for completion of processes P and Q if they-are entomophilous. (d) If plants X and Y belong to Genus Cannabis, then their flowers need to produce sticky and heavy pollens in very small amounts for the accomplishment of process Q.

Answer: (c) Flowers of plants X and Y need to produce odor and nectar for completion of processes P and Q if they-are entomophilous.

(iii) Identify the processes P, Q, and R.

Answer: (a)

(iv) In Catharanthus, the growth of style brings the stigma in contact with ripe anthers present on the mouth of corolla tube. This is an example of

Answer: (a) homogamy

(v) Which of the given processes represents a type of pollination that would result in greater adaptability of the particular species to potential environmental changes?

Answer: (b) Q

Case Study 2: The endosperm makes the main source of food for the embryo. Generally, the endosperm nucleus divides after the division of the oospore, but in several cases, the endosperm is formed to a great extent even before the first division of the oospore. There are three general types of endosperm formation: (a) nuclear type, (b) cellular type, and (c) global type. The endosperm is usually triploid but haploid endosperm is also found. Endosperm may either be completely consumed by the developing embryo before seed maturation or it may persist in the mature seed.

(i) Haploid endosperm is found in

Answer: (a) Pinus

(ii) Persistent endosperm is found in P. Pea  Q. Castor  R. Bean  S. Coconut    T. Groundnut 

Answer: (a) Q and S

(iii) If an endosperm cell of a gymnosperm contains 12 chromosomes, the number of chromosomes in each cell of the root will be

Answer: (b) 24

(iv) In angiosperms, normally after fertilization

Answer: (b) the primary endosperm nucleus divides earlier than the zygote

Hope the information shed above regarding Case Study and Passage Based Questions for Class 12 Biology Chapter 2 Sexual Reproduction in Flowering Plants with Answers Pdf free download has been useful to an extent. If you have any other queries about CBSE Class 12 Biolog y Sexual Reproduction in Flowering Plants Case Study and Passage-Based Questions with Answers, feel free to comment below so that we can revert back to us at the earliest possible. By Team Study Rate

You Might Also Like

Class 12 physics assertion reason questions chapter 7 alternating current, class 12 physics case study questions chapter 13 nuclei, mcq class 12 english indigo questions with answers english chapter 5, leave a reply cancel reply.

Save my name, email, and website in this browser for the next time I comment.

This site uses Akismet to reduce spam. Learn how your comment data is processed .

The Topper Combo Flashcards

• Contains the Latest NCERT in just 350 flashcards.
• Colourful and Interactive
• Summarised Important reactions according to the latest PYQs of NEET(UG) and JEE

No thanks, I’m not interested!