The Ultimate Guide to Qualitative Research - Part 1: The Basics
- Introduction and overview
- What is qualitative research?
- What is qualitative data?
- Examples of qualitative data
- Qualitative vs. quantitative research
- Mixed methods
- Qualitative research preparation
- Theoretical perspective
- Theoretical framework
- Literature reviews
Research question
- Conceptual framework
- Conceptual vs. theoretical framework
Data collection
- Qualitative research methods
- Focus groups
- Observational research
What is a case study?
Applications for case study research, what is a good case study, process of case study design, benefits and limitations of case studies.
- Ethnographical research
- Ethical considerations
- Confidentiality and privacy
- Power dynamics
- Reflexivity
Case studies
Case studies are essential to qualitative research , offering a lens through which researchers can investigate complex phenomena within their real-life contexts. This chapter explores the concept, purpose, applications, examples, and types of case studies and provides guidance on how to conduct case study research effectively.
Whereas quantitative methods look at phenomena at scale, case study research looks at a concept or phenomenon in considerable detail. While analyzing a single case can help understand one perspective regarding the object of research inquiry, analyzing multiple cases can help obtain a more holistic sense of the topic or issue. Let's provide a basic definition of a case study, then explore its characteristics and role in the qualitative research process.
Definition of a case study
A case study in qualitative research is a strategy of inquiry that involves an in-depth investigation of a phenomenon within its real-world context. It provides researchers with the opportunity to acquire an in-depth understanding of intricate details that might not be as apparent or accessible through other methods of research. The specific case or cases being studied can be a single person, group, or organization – demarcating what constitutes a relevant case worth studying depends on the researcher and their research question .
Among qualitative research methods , a case study relies on multiple sources of evidence, such as documents, artifacts, interviews , or observations , to present a complete and nuanced understanding of the phenomenon under investigation. The objective is to illuminate the readers' understanding of the phenomenon beyond its abstract statistical or theoretical explanations.
Characteristics of case studies
Case studies typically possess a number of distinct characteristics that set them apart from other research methods. These characteristics include a focus on holistic description and explanation, flexibility in the design and data collection methods, reliance on multiple sources of evidence, and emphasis on the context in which the phenomenon occurs.
Furthermore, case studies can often involve a longitudinal examination of the case, meaning they study the case over a period of time. These characteristics allow case studies to yield comprehensive, in-depth, and richly contextualized insights about the phenomenon of interest.
The role of case studies in research
Case studies hold a unique position in the broader landscape of research methods aimed at theory development. They are instrumental when the primary research interest is to gain an intensive, detailed understanding of a phenomenon in its real-life context.
In addition, case studies can serve different purposes within research - they can be used for exploratory, descriptive, or explanatory purposes, depending on the research question and objectives. This flexibility and depth make case studies a valuable tool in the toolkit of qualitative researchers.
Remember, a well-conducted case study can offer a rich, insightful contribution to both academic and practical knowledge through theory development or theory verification, thus enhancing our understanding of complex phenomena in their real-world contexts.
What is the purpose of a case study?
Case study research aims for a more comprehensive understanding of phenomena, requiring various research methods to gather information for qualitative analysis . Ultimately, a case study can allow the researcher to gain insight into a particular object of inquiry and develop a theoretical framework relevant to the research inquiry.
Why use case studies in qualitative research?
Using case studies as a research strategy depends mainly on the nature of the research question and the researcher's access to the data.
Conducting case study research provides a level of detail and contextual richness that other research methods might not offer. They are beneficial when there's a need to understand complex social phenomena within their natural contexts.
The explanatory, exploratory, and descriptive roles of case studies
Case studies can take on various roles depending on the research objectives. They can be exploratory when the research aims to discover new phenomena or define new research questions; they are descriptive when the objective is to depict a phenomenon within its context in a detailed manner; and they can be explanatory if the goal is to understand specific relationships within the studied context. Thus, the versatility of case studies allows researchers to approach their topic from different angles, offering multiple ways to uncover and interpret the data .
The impact of case studies on knowledge development
Case studies play a significant role in knowledge development across various disciplines. Analysis of cases provides an avenue for researchers to explore phenomena within their context based on the collected data.
This can result in the production of rich, practical insights that can be instrumental in both theory-building and practice. Case studies allow researchers to delve into the intricacies and complexities of real-life situations, uncovering insights that might otherwise remain hidden.
Types of case studies
In qualitative research , a case study is not a one-size-fits-all approach. Depending on the nature of the research question and the specific objectives of the study, researchers might choose to use different types of case studies. These types differ in their focus, methodology, and the level of detail they provide about the phenomenon under investigation.
Understanding these types is crucial for selecting the most appropriate approach for your research project and effectively achieving your research goals. Let's briefly look at the main types of case studies.
Exploratory case studies
Exploratory case studies are typically conducted to develop a theory or framework around an understudied phenomenon. They can also serve as a precursor to a larger-scale research project. Exploratory case studies are useful when a researcher wants to identify the key issues or questions which can spur more extensive study or be used to develop propositions for further research. These case studies are characterized by flexibility, allowing researchers to explore various aspects of a phenomenon as they emerge, which can also form the foundation for subsequent studies.
Descriptive case studies
Descriptive case studies aim to provide a complete and accurate representation of a phenomenon or event within its context. These case studies are often based on an established theoretical framework, which guides how data is collected and analyzed. The researcher is concerned with describing the phenomenon in detail, as it occurs naturally, without trying to influence or manipulate it.
Explanatory case studies
Explanatory case studies are focused on explanation - they seek to clarify how or why certain phenomena occur. Often used in complex, real-life situations, they can be particularly valuable in clarifying causal relationships among concepts and understanding the interplay between different factors within a specific context.
Intrinsic, instrumental, and collective case studies
These three categories of case studies focus on the nature and purpose of the study. An intrinsic case study is conducted when a researcher has an inherent interest in the case itself. Instrumental case studies are employed when the case is used to provide insight into a particular issue or phenomenon. A collective case study, on the other hand, involves studying multiple cases simultaneously to investigate some general phenomena.
Each type of case study serves a different purpose and has its own strengths and challenges. The selection of the type should be guided by the research question and objectives, as well as the context and constraints of the research.
The flexibility, depth, and contextual richness offered by case studies make this approach an excellent research method for various fields of study. They enable researchers to investigate real-world phenomena within their specific contexts, capturing nuances that other research methods might miss. Across numerous fields, case studies provide valuable insights into complex issues.
Critical information systems research
Case studies provide a detailed understanding of the role and impact of information systems in different contexts. They offer a platform to explore how information systems are designed, implemented, and used and how they interact with various social, economic, and political factors. Case studies in this field often focus on examining the intricate relationship between technology, organizational processes, and user behavior, helping to uncover insights that can inform better system design and implementation.
Health research
Health research is another field where case studies are highly valuable. They offer a way to explore patient experiences, healthcare delivery processes, and the impact of various interventions in a real-world context.
Case studies can provide a deep understanding of a patient's journey, giving insights into the intricacies of disease progression, treatment effects, and the psychosocial aspects of health and illness.
Asthma research studies
Specifically within medical research, studies on asthma often employ case studies to explore the individual and environmental factors that influence asthma development, management, and outcomes. A case study can provide rich, detailed data about individual patients' experiences, from the triggers and symptoms they experience to the effectiveness of various management strategies. This can be crucial for developing patient-centered asthma care approaches.
Other fields
Apart from the fields mentioned, case studies are also extensively used in business and management research, education research, and political sciences, among many others. They provide an opportunity to delve into the intricacies of real-world situations, allowing for a comprehensive understanding of various phenomena.
Case studies, with their depth and contextual focus, offer unique insights across these varied fields. They allow researchers to illuminate the complexities of real-life situations, contributing to both theory and practice.
Whatever field you're in, ATLAS.ti puts your data to work for you
Download a free trial of ATLAS.ti to turn your data into insights.
Understanding the key elements of case study design is crucial for conducting rigorous and impactful case study research. A well-structured design guides the researcher through the process, ensuring that the study is methodologically sound and its findings are reliable and valid. The main elements of case study design include the research question , propositions, units of analysis, and the logic linking the data to the propositions.
The research question is the foundation of any research study. A good research question guides the direction of the study and informs the selection of the case, the methods of collecting data, and the analysis techniques. A well-formulated research question in case study research is typically clear, focused, and complex enough to merit further detailed examination of the relevant case(s).
Propositions
Propositions, though not necessary in every case study, provide a direction by stating what we might expect to find in the data collected. They guide how data is collected and analyzed by helping researchers focus on specific aspects of the case. They are particularly important in explanatory case studies, which seek to understand the relationships among concepts within the studied phenomenon.
Units of analysis
The unit of analysis refers to the case, or the main entity or entities that are being analyzed in the study. In case study research, the unit of analysis can be an individual, a group, an organization, a decision, an event, or even a time period. It's crucial to clearly define the unit of analysis, as it shapes the qualitative data analysis process by allowing the researcher to analyze a particular case and synthesize analysis across multiple case studies to draw conclusions.
Argumentation
This refers to the inferential model that allows researchers to draw conclusions from the data. The researcher needs to ensure that there is a clear link between the data, the propositions (if any), and the conclusions drawn. This argumentation is what enables the researcher to make valid and credible inferences about the phenomenon under study.
Understanding and carefully considering these elements in the design phase of a case study can significantly enhance the quality of the research. It can help ensure that the study is methodologically sound and its findings contribute meaningful insights about the case.
Ready to jumpstart your research with ATLAS.ti?
Conceptualize your research project with our intuitive data analysis interface. Download a free trial today.
Conducting a case study involves several steps, from defining the research question and selecting the case to collecting and analyzing data . This section outlines these key stages, providing a practical guide on how to conduct case study research.
Defining the research question
The first step in case study research is defining a clear, focused research question. This question should guide the entire research process, from case selection to analysis. It's crucial to ensure that the research question is suitable for a case study approach. Typically, such questions are exploratory or descriptive in nature and focus on understanding a phenomenon within its real-life context.
Selecting and defining the case
The selection of the case should be based on the research question and the objectives of the study. It involves choosing a unique example or a set of examples that provide rich, in-depth data about the phenomenon under investigation. After selecting the case, it's crucial to define it clearly, setting the boundaries of the case, including the time period and the specific context.
Previous research can help guide the case study design. When considering a case study, an example of a case could be taken from previous case study research and used to define cases in a new research inquiry. Considering recently published examples can help understand how to select and define cases effectively.
Developing a detailed case study protocol
A case study protocol outlines the procedures and general rules to be followed during the case study. This includes the data collection methods to be used, the sources of data, and the procedures for analysis. Having a detailed case study protocol ensures consistency and reliability in the study.
The protocol should also consider how to work with the people involved in the research context to grant the research team access to collecting data. As mentioned in previous sections of this guide, establishing rapport is an essential component of qualitative research as it shapes the overall potential for collecting and analyzing data.
Collecting data
Gathering data in case study research often involves multiple sources of evidence, including documents, archival records, interviews, observations, and physical artifacts. This allows for a comprehensive understanding of the case. The process for gathering data should be systematic and carefully documented to ensure the reliability and validity of the study.
Analyzing and interpreting data
The next step is analyzing the data. This involves organizing the data , categorizing it into themes or patterns , and interpreting these patterns to answer the research question. The analysis might also involve comparing the findings with prior research or theoretical propositions.
Writing the case study report
The final step is writing the case study report . This should provide a detailed description of the case, the data, the analysis process, and the findings. The report should be clear, organized, and carefully written to ensure that the reader can understand the case and the conclusions drawn from it.
Each of these steps is crucial in ensuring that the case study research is rigorous, reliable, and provides valuable insights about the case.
The type, depth, and quality of data in your study can significantly influence the validity and utility of the study. In case study research, data is usually collected from multiple sources to provide a comprehensive and nuanced understanding of the case. This section will outline the various methods of collecting data used in case study research and discuss considerations for ensuring the quality of the data.
Interviews are a common method of gathering data in case study research. They can provide rich, in-depth data about the perspectives, experiences, and interpretations of the individuals involved in the case. Interviews can be structured , semi-structured , or unstructured , depending on the research question and the degree of flexibility needed.
Observations
Observations involve the researcher observing the case in its natural setting, providing first-hand information about the case and its context. Observations can provide data that might not be revealed in interviews or documents, such as non-verbal cues or contextual information.
Documents and artifacts
Documents and archival records provide a valuable source of data in case study research. They can include reports, letters, memos, meeting minutes, email correspondence, and various public and private documents related to the case.
These records can provide historical context, corroborate evidence from other sources, and offer insights into the case that might not be apparent from interviews or observations.
Physical artifacts refer to any physical evidence related to the case, such as tools, products, or physical environments. These artifacts can provide tangible insights into the case, complementing the data gathered from other sources.
Ensuring the quality of data collection
Determining the quality of data in case study research requires careful planning and execution. It's crucial to ensure that the data is reliable, accurate, and relevant to the research question. This involves selecting appropriate methods of collecting data, properly training interviewers or observers, and systematically recording and storing the data. It also includes considering ethical issues related to collecting and handling data, such as obtaining informed consent and ensuring the privacy and confidentiality of the participants.
Data analysis
Analyzing case study research involves making sense of the rich, detailed data to answer the research question. This process can be challenging due to the volume and complexity of case study data. However, a systematic and rigorous approach to analysis can ensure that the findings are credible and meaningful. This section outlines the main steps and considerations in analyzing data in case study research.
Organizing the data
The first step in the analysis is organizing the data. This involves sorting the data into manageable sections, often according to the data source or the theme. This step can also involve transcribing interviews, digitizing physical artifacts, or organizing observational data.
Categorizing and coding the data
Once the data is organized, the next step is to categorize or code the data. This involves identifying common themes, patterns, or concepts in the data and assigning codes to relevant data segments. Coding can be done manually or with the help of software tools, and in either case, qualitative analysis software can greatly facilitate the entire coding process. Coding helps to reduce the data to a set of themes or categories that can be more easily analyzed.
Identifying patterns and themes
After coding the data, the researcher looks for patterns or themes in the coded data. This involves comparing and contrasting the codes and looking for relationships or patterns among them. The identified patterns and themes should help answer the research question.
Interpreting the data
Once patterns and themes have been identified, the next step is to interpret these findings. This involves explaining what the patterns or themes mean in the context of the research question and the case. This interpretation should be grounded in the data, but it can also involve drawing on theoretical concepts or prior research.
Verification of the data
The last step in the analysis is verification. This involves checking the accuracy and consistency of the analysis process and confirming that the findings are supported by the data. This can involve re-checking the original data, checking the consistency of codes, or seeking feedback from research participants or peers.
Like any research method , case study research has its strengths and limitations. Researchers must be aware of these, as they can influence the design, conduct, and interpretation of the study.
Understanding the strengths and limitations of case study research can also guide researchers in deciding whether this approach is suitable for their research question . This section outlines some of the key strengths and limitations of case study research.
Benefits include the following:
- Rich, detailed data: One of the main strengths of case study research is that it can generate rich, detailed data about the case. This can provide a deep understanding of the case and its context, which can be valuable in exploring complex phenomena.
- Flexibility: Case study research is flexible in terms of design , data collection , and analysis . A sufficient degree of flexibility allows the researcher to adapt the study according to the case and the emerging findings.
- Real-world context: Case study research involves studying the case in its real-world context, which can provide valuable insights into the interplay between the case and its context.
- Multiple sources of evidence: Case study research often involves collecting data from multiple sources , which can enhance the robustness and validity of the findings.
On the other hand, researchers should consider the following limitations:
- Generalizability: A common criticism of case study research is that its findings might not be generalizable to other cases due to the specificity and uniqueness of each case.
- Time and resource intensive: Case study research can be time and resource intensive due to the depth of the investigation and the amount of collected data.
- Complexity of analysis: The rich, detailed data generated in case study research can make analyzing the data challenging.
- Subjectivity: Given the nature of case study research, there may be a higher degree of subjectivity in interpreting the data , so researchers need to reflect on this and transparently convey to audiences how the research was conducted.
Being aware of these strengths and limitations can help researchers design and conduct case study research effectively and interpret and report the findings appropriately.
Ready to analyze your data with ATLAS.ti?
See how our intuitive software can draw key insights from your data with a free trial today.
- Privacy Policy
Home » Case Study – Methods, Examples and Guide
Case Study – Methods, Examples and Guide
Table of Contents
A case study is a research method that involves an in-depth examination and analysis of a particular phenomenon or case, such as an individual, organization, community, event, or situation.
It is a qualitative research approach that aims to provide a detailed and comprehensive understanding of the case being studied. Case studies typically involve multiple sources of data, including interviews, observations, documents, and artifacts, which are analyzed using various techniques, such as content analysis, thematic analysis, and grounded theory. The findings of a case study are often used to develop theories, inform policy or practice, or generate new research questions.
Types of Case Study
Types and Methods of Case Study are as follows:
Single-Case Study
A single-case study is an in-depth analysis of a single case. This type of case study is useful when the researcher wants to understand a specific phenomenon in detail.
For Example , A researcher might conduct a single-case study on a particular individual to understand their experiences with a particular health condition or a specific organization to explore their management practices. The researcher collects data from multiple sources, such as interviews, observations, and documents, and uses various techniques to analyze the data, such as content analysis or thematic analysis. The findings of a single-case study are often used to generate new research questions, develop theories, or inform policy or practice.
Multiple-Case Study
A multiple-case study involves the analysis of several cases that are similar in nature. This type of case study is useful when the researcher wants to identify similarities and differences between the cases.
For Example, a researcher might conduct a multiple-case study on several companies to explore the factors that contribute to their success or failure. The researcher collects data from each case, compares and contrasts the findings, and uses various techniques to analyze the data, such as comparative analysis or pattern-matching. The findings of a multiple-case study can be used to develop theories, inform policy or practice, or generate new research questions.
Exploratory Case Study
An exploratory case study is used to explore a new or understudied phenomenon. This type of case study is useful when the researcher wants to generate hypotheses or theories about the phenomenon.
For Example, a researcher might conduct an exploratory case study on a new technology to understand its potential impact on society. The researcher collects data from multiple sources, such as interviews, observations, and documents, and uses various techniques to analyze the data, such as grounded theory or content analysis. The findings of an exploratory case study can be used to generate new research questions, develop theories, or inform policy or practice.
Descriptive Case Study
A descriptive case study is used to describe a particular phenomenon in detail. This type of case study is useful when the researcher wants to provide a comprehensive account of the phenomenon.
For Example, a researcher might conduct a descriptive case study on a particular community to understand its social and economic characteristics. The researcher collects data from multiple sources, such as interviews, observations, and documents, and uses various techniques to analyze the data, such as content analysis or thematic analysis. The findings of a descriptive case study can be used to inform policy or practice or generate new research questions.
Instrumental Case Study
An instrumental case study is used to understand a particular phenomenon that is instrumental in achieving a particular goal. This type of case study is useful when the researcher wants to understand the role of the phenomenon in achieving the goal.
For Example, a researcher might conduct an instrumental case study on a particular policy to understand its impact on achieving a particular goal, such as reducing poverty. The researcher collects data from multiple sources, such as interviews, observations, and documents, and uses various techniques to analyze the data, such as content analysis or thematic analysis. The findings of an instrumental case study can be used to inform policy or practice or generate new research questions.
Case Study Data Collection Methods
Here are some common data collection methods for case studies:
Interviews involve asking questions to individuals who have knowledge or experience relevant to the case study. Interviews can be structured (where the same questions are asked to all participants) or unstructured (where the interviewer follows up on the responses with further questions). Interviews can be conducted in person, over the phone, or through video conferencing.
Observations
Observations involve watching and recording the behavior and activities of individuals or groups relevant to the case study. Observations can be participant (where the researcher actively participates in the activities) or non-participant (where the researcher observes from a distance). Observations can be recorded using notes, audio or video recordings, or photographs.
Documents can be used as a source of information for case studies. Documents can include reports, memos, emails, letters, and other written materials related to the case study. Documents can be collected from the case study participants or from public sources.
Surveys involve asking a set of questions to a sample of individuals relevant to the case study. Surveys can be administered in person, over the phone, through mail or email, or online. Surveys can be used to gather information on attitudes, opinions, or behaviors related to the case study.
Artifacts are physical objects relevant to the case study. Artifacts can include tools, equipment, products, or other objects that provide insights into the case study phenomenon.
How to conduct Case Study Research
Conducting a case study research involves several steps that need to be followed to ensure the quality and rigor of the study. Here are the steps to conduct case study research:
- Define the research questions: The first step in conducting a case study research is to define the research questions. The research questions should be specific, measurable, and relevant to the case study phenomenon under investigation.
- Select the case: The next step is to select the case or cases to be studied. The case should be relevant to the research questions and should provide rich and diverse data that can be used to answer the research questions.
- Collect data: Data can be collected using various methods, such as interviews, observations, documents, surveys, and artifacts. The data collection method should be selected based on the research questions and the nature of the case study phenomenon.
- Analyze the data: The data collected from the case study should be analyzed using various techniques, such as content analysis, thematic analysis, or grounded theory. The analysis should be guided by the research questions and should aim to provide insights and conclusions relevant to the research questions.
- Draw conclusions: The conclusions drawn from the case study should be based on the data analysis and should be relevant to the research questions. The conclusions should be supported by evidence and should be clearly stated.
- Validate the findings: The findings of the case study should be validated by reviewing the data and the analysis with participants or other experts in the field. This helps to ensure the validity and reliability of the findings.
- Write the report: The final step is to write the report of the case study research. The report should provide a clear description of the case study phenomenon, the research questions, the data collection methods, the data analysis, the findings, and the conclusions. The report should be written in a clear and concise manner and should follow the guidelines for academic writing.
Examples of Case Study
Here are some examples of case study research:
- The Hawthorne Studies : Conducted between 1924 and 1932, the Hawthorne Studies were a series of case studies conducted by Elton Mayo and his colleagues to examine the impact of work environment on employee productivity. The studies were conducted at the Hawthorne Works plant of the Western Electric Company in Chicago and included interviews, observations, and experiments.
- The Stanford Prison Experiment: Conducted in 1971, the Stanford Prison Experiment was a case study conducted by Philip Zimbardo to examine the psychological effects of power and authority. The study involved simulating a prison environment and assigning participants to the role of guards or prisoners. The study was controversial due to the ethical issues it raised.
- The Challenger Disaster: The Challenger Disaster was a case study conducted to examine the causes of the Space Shuttle Challenger explosion in 1986. The study included interviews, observations, and analysis of data to identify the technical, organizational, and cultural factors that contributed to the disaster.
- The Enron Scandal: The Enron Scandal was a case study conducted to examine the causes of the Enron Corporation’s bankruptcy in 2001. The study included interviews, analysis of financial data, and review of documents to identify the accounting practices, corporate culture, and ethical issues that led to the company’s downfall.
- The Fukushima Nuclear Disaster : The Fukushima Nuclear Disaster was a case study conducted to examine the causes of the nuclear accident that occurred at the Fukushima Daiichi Nuclear Power Plant in Japan in 2011. The study included interviews, analysis of data, and review of documents to identify the technical, organizational, and cultural factors that contributed to the disaster.
Application of Case Study
Case studies have a wide range of applications across various fields and industries. Here are some examples:
Business and Management
Case studies are widely used in business and management to examine real-life situations and develop problem-solving skills. Case studies can help students and professionals to develop a deep understanding of business concepts, theories, and best practices.
Case studies are used in healthcare to examine patient care, treatment options, and outcomes. Case studies can help healthcare professionals to develop critical thinking skills, diagnose complex medical conditions, and develop effective treatment plans.
Case studies are used in education to examine teaching and learning practices. Case studies can help educators to develop effective teaching strategies, evaluate student progress, and identify areas for improvement.
Social Sciences
Case studies are widely used in social sciences to examine human behavior, social phenomena, and cultural practices. Case studies can help researchers to develop theories, test hypotheses, and gain insights into complex social issues.
Law and Ethics
Case studies are used in law and ethics to examine legal and ethical dilemmas. Case studies can help lawyers, policymakers, and ethical professionals to develop critical thinking skills, analyze complex cases, and make informed decisions.
Purpose of Case Study
The purpose of a case study is to provide a detailed analysis of a specific phenomenon, issue, or problem in its real-life context. A case study is a qualitative research method that involves the in-depth exploration and analysis of a particular case, which can be an individual, group, organization, event, or community.
The primary purpose of a case study is to generate a comprehensive and nuanced understanding of the case, including its history, context, and dynamics. Case studies can help researchers to identify and examine the underlying factors, processes, and mechanisms that contribute to the case and its outcomes. This can help to develop a more accurate and detailed understanding of the case, which can inform future research, practice, or policy.
Case studies can also serve other purposes, including:
- Illustrating a theory or concept: Case studies can be used to illustrate and explain theoretical concepts and frameworks, providing concrete examples of how they can be applied in real-life situations.
- Developing hypotheses: Case studies can help to generate hypotheses about the causal relationships between different factors and outcomes, which can be tested through further research.
- Providing insight into complex issues: Case studies can provide insights into complex and multifaceted issues, which may be difficult to understand through other research methods.
- Informing practice or policy: Case studies can be used to inform practice or policy by identifying best practices, lessons learned, or areas for improvement.
Advantages of Case Study Research
There are several advantages of case study research, including:
- In-depth exploration: Case study research allows for a detailed exploration and analysis of a specific phenomenon, issue, or problem in its real-life context. This can provide a comprehensive understanding of the case and its dynamics, which may not be possible through other research methods.
- Rich data: Case study research can generate rich and detailed data, including qualitative data such as interviews, observations, and documents. This can provide a nuanced understanding of the case and its complexity.
- Holistic perspective: Case study research allows for a holistic perspective of the case, taking into account the various factors, processes, and mechanisms that contribute to the case and its outcomes. This can help to develop a more accurate and comprehensive understanding of the case.
- Theory development: Case study research can help to develop and refine theories and concepts by providing empirical evidence and concrete examples of how they can be applied in real-life situations.
- Practical application: Case study research can inform practice or policy by identifying best practices, lessons learned, or areas for improvement.
- Contextualization: Case study research takes into account the specific context in which the case is situated, which can help to understand how the case is influenced by the social, cultural, and historical factors of its environment.
Limitations of Case Study Research
There are several limitations of case study research, including:
- Limited generalizability : Case studies are typically focused on a single case or a small number of cases, which limits the generalizability of the findings. The unique characteristics of the case may not be applicable to other contexts or populations, which may limit the external validity of the research.
- Biased sampling: Case studies may rely on purposive or convenience sampling, which can introduce bias into the sample selection process. This may limit the representativeness of the sample and the generalizability of the findings.
- Subjectivity: Case studies rely on the interpretation of the researcher, which can introduce subjectivity into the analysis. The researcher’s own biases, assumptions, and perspectives may influence the findings, which may limit the objectivity of the research.
- Limited control: Case studies are typically conducted in naturalistic settings, which limits the control that the researcher has over the environment and the variables being studied. This may limit the ability to establish causal relationships between variables.
- Time-consuming: Case studies can be time-consuming to conduct, as they typically involve a detailed exploration and analysis of a specific case. This may limit the feasibility of conducting multiple case studies or conducting case studies in a timely manner.
- Resource-intensive: Case studies may require significant resources, including time, funding, and expertise. This may limit the ability of researchers to conduct case studies in resource-constrained settings.
About the author
Muhammad Hassan
Researcher, Academic Writer, Web developer
You may also like
Questionnaire – Definition, Types, and Examples
Observational Research – Methods and Guide
Quantitative Research – Methods, Types and...
Qualitative Research Methods
Explanatory Research – Types, Methods, Guide
Survey Research – Types, Methods, Examples
- More from M-W
- To save this word, you'll need to log in. Log In
Definition of case study
Examples of case study in a sentence.
These examples are programmatically compiled from various online sources to illustrate current usage of the word 'case study.' Any opinions expressed in the examples do not represent those of Merriam-Webster or its editors. Send us feedback about these examples.
Word History
1914, in the meaning defined at sense 1
Dictionary Entries Near case study
case spring
case study method
Cite this Entry
“Case study.” Merriam-Webster.com Dictionary , Merriam-Webster, https://www.merriam-webster.com/dictionary/case%20study. Accessed 29 Apr. 2024.
More from Merriam-Webster on case study
Thesaurus: All synonyms and antonyms for case study
Britannica.com: Encyclopedia article about case study
Subscribe to America's largest dictionary and get thousands more definitions and advanced search—ad free!
Can you solve 4 words at once?
Word of the day.
See Definitions and Examples »
Get Word of the Day daily email!
Popular in Grammar & Usage
More commonly misspelled words, commonly misspelled words, how to use em dashes (—), en dashes (–) , and hyphens (-), absent letters that are heard anyway, how to use accents and diacritical marks, popular in wordplay, the words of the week - apr. 26, 9 superb owl words, 'gaslighting,' 'woke,' 'democracy,' and other top lookups, fan favorites: your most liked words of the day 2023, 10 words for lesser-known games and sports, games & quizzes.
- Cambridge Dictionary +Plus
Meaning of case study in English
Your browser doesn't support HTML5 audio
- anti-narrative
- be another story idiom
- bodice-ripper
- cautionary tale
- misdescription
- multi-stranded
- running commentary phrase
- semi-legendary
- shaggy-dog story
- short story
- write something up
case study | American Dictionary
Case study | business english, examples of case study, translations of case study.
Get a quick, free translation!
Word of the Day
under lock and key
locked away safely
Dead ringers and peas in pods (Talking about similarities, Part 2)
Learn more with +Plus
- Recent and Recommended {{#preferredDictionaries}} {{name}} {{/preferredDictionaries}}
- Definitions Clear explanations of natural written and spoken English English Learner’s Dictionary Essential British English Essential American English
- Grammar and thesaurus Usage explanations of natural written and spoken English Grammar Thesaurus
- Pronunciation British and American pronunciations with audio English Pronunciation
- English–Chinese (Simplified) Chinese (Simplified)–English
- English–Chinese (Traditional) Chinese (Traditional)–English
- English–Dutch Dutch–English
- English–French French–English
- English–German German–English
- English–Indonesian Indonesian–English
- English–Italian Italian–English
- English–Japanese Japanese–English
- English–Norwegian Norwegian–English
- English–Polish Polish–English
- English–Portuguese Portuguese–English
- English–Spanish Spanish–English
- English–Swedish Swedish–English
- Dictionary +Plus Word Lists
- English Noun
- American Noun
- Business Noun
- Translations
- All translations
Add case study to one of your lists below, or create a new one.
{{message}}
Something went wrong.
There was a problem sending your report.
- Bipolar Disorder
- Therapy Center
- When To See a Therapist
- Types of Therapy
- Best Online Therapy
- Best Couples Therapy
- Best Family Therapy
- Managing Stress
- Sleep and Dreaming
- Understanding Emotions
- Self-Improvement
- Healthy Relationships
- Student Resources
- Personality Types
- Guided Meditations
- Verywell Mind Insights
- 2023 Verywell Mind 25
- Mental Health in the Classroom
- Editorial Process
- Meet Our Review Board
- Crisis Support
What Is a Case Study?
Weighing the pros and cons of this method of research
Kendra Cherry, MS, is a psychosocial rehabilitation specialist, psychology educator, and author of the "Everything Psychology Book."
Cara Lustik is a fact-checker and copywriter.
Verywell / Colleen Tighe
- Pros and Cons
What Types of Case Studies Are Out There?
Where do you find data for a case study, how do i write a psychology case study.
A case study is an in-depth study of one person, group, or event. In a case study, nearly every aspect of the subject's life and history is analyzed to seek patterns and causes of behavior. Case studies can be used in many different fields, including psychology, medicine, education, anthropology, political science, and social work.
The point of a case study is to learn as much as possible about an individual or group so that the information can be generalized to many others. Unfortunately, case studies tend to be highly subjective, and it is sometimes difficult to generalize results to a larger population.
While case studies focus on a single individual or group, they follow a format similar to other types of psychology writing. If you are writing a case study, we got you—here are some rules of APA format to reference.
At a Glance
A case study, or an in-depth study of a person, group, or event, can be a useful research tool when used wisely. In many cases, case studies are best used in situations where it would be difficult or impossible for you to conduct an experiment. They are helpful for looking at unique situations and allow researchers to gather a lot of˜ information about a specific individual or group of people. However, it's important to be cautious of any bias we draw from them as they are highly subjective.
What Are the Benefits and Limitations of Case Studies?
A case study can have its strengths and weaknesses. Researchers must consider these pros and cons before deciding if this type of study is appropriate for their needs.
One of the greatest advantages of a case study is that it allows researchers to investigate things that are often difficult or impossible to replicate in a lab. Some other benefits of a case study:
- Allows researchers to capture information on the 'how,' 'what,' and 'why,' of something that's implemented
- Gives researchers the chance to collect information on why one strategy might be chosen over another
- Permits researchers to develop hypotheses that can be explored in experimental research
On the other hand, a case study can have some drawbacks:
- It cannot necessarily be generalized to the larger population
- Cannot demonstrate cause and effect
- It may not be scientifically rigorous
- It can lead to bias
Researchers may choose to perform a case study if they want to explore a unique or recently discovered phenomenon. Through their insights, researchers develop additional ideas and study questions that might be explored in future studies.
It's important to remember that the insights from case studies cannot be used to determine cause-and-effect relationships between variables. However, case studies may be used to develop hypotheses that can then be addressed in experimental research.
Case Study Examples
There have been a number of notable case studies in the history of psychology. Much of Freud's work and theories were developed through individual case studies. Some great examples of case studies in psychology include:
- Anna O : Anna O. was a pseudonym of a woman named Bertha Pappenheim, a patient of a physician named Josef Breuer. While she was never a patient of Freud's, Freud and Breuer discussed her case extensively. The woman was experiencing symptoms of a condition that was then known as hysteria and found that talking about her problems helped relieve her symptoms. Her case played an important part in the development of talk therapy as an approach to mental health treatment.
- Phineas Gage : Phineas Gage was a railroad employee who experienced a terrible accident in which an explosion sent a metal rod through his skull, damaging important portions of his brain. Gage recovered from his accident but was left with serious changes in both personality and behavior.
- Genie : Genie was a young girl subjected to horrific abuse and isolation. The case study of Genie allowed researchers to study whether language learning was possible, even after missing critical periods for language development. Her case also served as an example of how scientific research may interfere with treatment and lead to further abuse of vulnerable individuals.
Such cases demonstrate how case research can be used to study things that researchers could not replicate in experimental settings. In Genie's case, her horrific abuse denied her the opportunity to learn a language at critical points in her development.
This is clearly not something researchers could ethically replicate, but conducting a case study on Genie allowed researchers to study phenomena that are otherwise impossible to reproduce.
There are a few different types of case studies that psychologists and other researchers might use:
- Collective case studies : These involve studying a group of individuals. Researchers might study a group of people in a certain setting or look at an entire community. For example, psychologists might explore how access to resources in a community has affected the collective mental well-being of those who live there.
- Descriptive case studies : These involve starting with a descriptive theory. The subjects are then observed, and the information gathered is compared to the pre-existing theory.
- Explanatory case studies : These are often used to do causal investigations. In other words, researchers are interested in looking at factors that may have caused certain things to occur.
- Exploratory case studies : These are sometimes used as a prelude to further, more in-depth research. This allows researchers to gather more information before developing their research questions and hypotheses .
- Instrumental case studies : These occur when the individual or group allows researchers to understand more than what is initially obvious to observers.
- Intrinsic case studies : This type of case study is when the researcher has a personal interest in the case. Jean Piaget's observations of his own children are good examples of how an intrinsic case study can contribute to the development of a psychological theory.
The three main case study types often used are intrinsic, instrumental, and collective. Intrinsic case studies are useful for learning about unique cases. Instrumental case studies help look at an individual to learn more about a broader issue. A collective case study can be useful for looking at several cases simultaneously.
The type of case study that psychology researchers use depends on the unique characteristics of the situation and the case itself.
There are a number of different sources and methods that researchers can use to gather information about an individual or group. Six major sources that have been identified by researchers are:
- Archival records : Census records, survey records, and name lists are examples of archival records.
- Direct observation : This strategy involves observing the subject, often in a natural setting . While an individual observer is sometimes used, it is more common to utilize a group of observers.
- Documents : Letters, newspaper articles, administrative records, etc., are the types of documents often used as sources.
- Interviews : Interviews are one of the most important methods for gathering information in case studies. An interview can involve structured survey questions or more open-ended questions.
- Participant observation : When the researcher serves as a participant in events and observes the actions and outcomes, it is called participant observation.
- Physical artifacts : Tools, objects, instruments, and other artifacts are often observed during a direct observation of the subject.
If you have been directed to write a case study for a psychology course, be sure to check with your instructor for any specific guidelines you need to follow. If you are writing your case study for a professional publication, check with the publisher for their specific guidelines for submitting a case study.
Here is a general outline of what should be included in a case study.
Section 1: A Case History
This section will have the following structure and content:
Background information : The first section of your paper will present your client's background. Include factors such as age, gender, work, health status, family mental health history, family and social relationships, drug and alcohol history, life difficulties, goals, and coping skills and weaknesses.
Description of the presenting problem : In the next section of your case study, you will describe the problem or symptoms that the client presented with.
Describe any physical, emotional, or sensory symptoms reported by the client. Thoughts, feelings, and perceptions related to the symptoms should also be noted. Any screening or diagnostic assessments that are used should also be described in detail and all scores reported.
Your diagnosis : Provide your diagnosis and give the appropriate Diagnostic and Statistical Manual code. Explain how you reached your diagnosis, how the client's symptoms fit the diagnostic criteria for the disorder(s), or any possible difficulties in reaching a diagnosis.
Section 2: Treatment Plan
This portion of the paper will address the chosen treatment for the condition. This might also include the theoretical basis for the chosen treatment or any other evidence that might exist to support why this approach was chosen.
- Cognitive behavioral approach : Explain how a cognitive behavioral therapist would approach treatment. Offer background information on cognitive behavioral therapy and describe the treatment sessions, client response, and outcome of this type of treatment. Make note of any difficulties or successes encountered by your client during treatment.
- Humanistic approach : Describe a humanistic approach that could be used to treat your client, such as client-centered therapy . Provide information on the type of treatment you chose, the client's reaction to the treatment, and the end result of this approach. Explain why the treatment was successful or unsuccessful.
- Psychoanalytic approach : Describe how a psychoanalytic therapist would view the client's problem. Provide some background on the psychoanalytic approach and cite relevant references. Explain how psychoanalytic therapy would be used to treat the client, how the client would respond to therapy, and the effectiveness of this treatment approach.
- Pharmacological approach : If treatment primarily involves the use of medications, explain which medications were used and why. Provide background on the effectiveness of these medications and how monotherapy may compare with an approach that combines medications with therapy or other treatments.
This section of a case study should also include information about the treatment goals, process, and outcomes.
When you are writing a case study, you should also include a section where you discuss the case study itself, including the strengths and limitiations of the study. You should note how the findings of your case study might support previous research.
In your discussion section, you should also describe some of the implications of your case study. What ideas or findings might require further exploration? How might researchers go about exploring some of these questions in additional studies?
Need More Tips?
Here are a few additional pointers to keep in mind when formatting your case study:
- Never refer to the subject of your case study as "the client." Instead, use their name or a pseudonym.
- Read examples of case studies to gain an idea about the style and format.
- Remember to use APA format when citing references .
Crowe S, Cresswell K, Robertson A, Huby G, Avery A, Sheikh A. The case study approach . BMC Med Res Methodol . 2011;11:100.
Crowe S, Cresswell K, Robertson A, Huby G, Avery A, Sheikh A. The case study approach . BMC Med Res Methodol . 2011 Jun 27;11:100. doi:10.1186/1471-2288-11-100
Gagnon, Yves-Chantal. The Case Study as Research Method: A Practical Handbook . Canada, Chicago Review Press Incorporated DBA Independent Pub Group, 2010.
Yin, Robert K. Case Study Research and Applications: Design and Methods . United States, SAGE Publications, 2017.
By Kendra Cherry, MSEd Kendra Cherry, MS, is a psychosocial rehabilitation specialist, psychology educator, and author of the "Everything Psychology Book."
- Dictionaries home
- American English
- Collocations
- German-English
- Grammar home
- Practical English Usage
- Learn & Practise Grammar (Beta)
- Word Lists home
- My Word Lists
- Recent additions
- Resources home
- Text Checker
Definition of case study noun from the Oxford Advanced Learner's Dictionary
- She co-authored a case study on urban development.
Questions about grammar and vocabulary?
Find the answers with Practical English Usage online, your indispensable guide to problems in English.
- Athletes make an interesting case study for doctors.
Nearby words
Have a language expert improve your writing
Run a free plagiarism check in 10 minutes, automatically generate references for free.
- Knowledge Base
- Methodology
- Case Study | Definition, Examples & Methods
Case Study | Definition, Examples & Methods
Published on 5 May 2022 by Shona McCombes . Revised on 30 January 2023.
A case study is a detailed study of a specific subject, such as a person, group, place, event, organisation, or phenomenon. Case studies are commonly used in social, educational, clinical, and business research.
A case study research design usually involves qualitative methods , but quantitative methods are sometimes also used. Case studies are good for describing , comparing, evaluating, and understanding different aspects of a research problem .
Table of contents
When to do a case study, step 1: select a case, step 2: build a theoretical framework, step 3: collect your data, step 4: describe and analyse the case.
A case study is an appropriate research design when you want to gain concrete, contextual, in-depth knowledge about a specific real-world subject. It allows you to explore the key characteristics, meanings, and implications of the case.
Case studies are often a good choice in a thesis or dissertation . They keep your project focused and manageable when you don’t have the time or resources to do large-scale research.
You might use just one complex case study where you explore a single subject in depth, or conduct multiple case studies to compare and illuminate different aspects of your research problem.
Prevent plagiarism, run a free check.
Once you have developed your problem statement and research questions , you should be ready to choose the specific case that you want to focus on. A good case study should have the potential to:
- Provide new or unexpected insights into the subject
- Challenge or complicate existing assumptions and theories
- Propose practical courses of action to resolve a problem
- Open up new directions for future research
Unlike quantitative or experimental research, a strong case study does not require a random or representative sample. In fact, case studies often deliberately focus on unusual, neglected, or outlying cases which may shed new light on the research problem.
If you find yourself aiming to simultaneously investigate and solve an issue, consider conducting action research . As its name suggests, action research conducts research and takes action at the same time, and is highly iterative and flexible.
However, you can also choose a more common or representative case to exemplify a particular category, experience, or phenomenon.
While case studies focus more on concrete details than general theories, they should usually have some connection with theory in the field. This way the case study is not just an isolated description, but is integrated into existing knowledge about the topic. It might aim to:
- Exemplify a theory by showing how it explains the case under investigation
- Expand on a theory by uncovering new concepts and ideas that need to be incorporated
- Challenge a theory by exploring an outlier case that doesn’t fit with established assumptions
To ensure that your analysis of the case has a solid academic grounding, you should conduct a literature review of sources related to the topic and develop a theoretical framework . This means identifying key concepts and theories to guide your analysis and interpretation.
There are many different research methods you can use to collect data on your subject. Case studies tend to focus on qualitative data using methods such as interviews, observations, and analysis of primary and secondary sources (e.g., newspaper articles, photographs, official records). Sometimes a case study will also collect quantitative data .
The aim is to gain as thorough an understanding as possible of the case and its context.
In writing up the case study, you need to bring together all the relevant aspects to give as complete a picture as possible of the subject.
How you report your findings depends on the type of research you are doing. Some case studies are structured like a standard scientific paper or thesis, with separate sections or chapters for the methods , results , and discussion .
Others are written in a more narrative style, aiming to explore the case from various angles and analyse its meanings and implications (for example, by using textual analysis or discourse analysis ).
In all cases, though, make sure to give contextual details about the case, connect it back to the literature and theory, and discuss how it fits into wider patterns or debates.
Cite this Scribbr article
If you want to cite this source, you can copy and paste the citation or click the ‘Cite this Scribbr article’ button to automatically add the citation to our free Reference Generator.
McCombes, S. (2023, January 30). Case Study | Definition, Examples & Methods. Scribbr. Retrieved 22 April 2024, from https://www.scribbr.co.uk/research-methods/case-studies/
Is this article helpful?
Shona McCombes
Other students also liked, correlational research | guide, design & examples, a quick guide to experimental design | 5 steps & examples, descriptive research design | definition, methods & examples.
Research Writing and Analysis
- NVivo Group and Study Sessions
- SPSS This link opens in a new window
- Statistical Analysis Group sessions
- Using Qualtrics
- Dissertation and Data Analysis Group Sessions
- Defense Schedule - Commons Calendar This link opens in a new window
- Research Process Flow Chart
- Research Alignment Chapter 1 This link opens in a new window
- Step 1: Seek Out Evidence
- Step 2: Explain
- Step 3: The Big Picture
- Step 4: Own It
- Step 5: Illustrate
- Annotated Bibliography
- Literature Review This link opens in a new window
- Systematic Reviews & Meta-Analyses
- How to Synthesize and Analyze
- Synthesis and Analysis Practice
- Synthesis and Analysis Group Sessions
- Problem Statement
- Purpose Statement
- Conceptual Framework
- Theoretical Framework
- Quantitative Research Questions
- Qualitative Research Questions
- Trustworthiness of Qualitative Data
- Analysis and Coding Example- Qualitative Data
- Thematic Data Analysis in Qualitative Design
- Dissertation to Journal Article This link opens in a new window
- International Journal of Online Graduate Education (IJOGE) This link opens in a new window
- Journal of Research in Innovative Teaching & Learning (JRIT&L) This link opens in a new window
Writing a Case Study
What is a case study?
A Case study is:
- An in-depth research design that primarily uses a qualitative methodology but sometimes includes quantitative methodology.
- Used to examine an identifiable problem confirmed through research.
- Used to investigate an individual, group of people, organization, or event.
- Used to mostly answer "how" and "why" questions.
What are the different types of case studies?
Note: These are the primary case studies. As you continue to research and learn
about case studies you will begin to find a robust list of different types.
Who are your case study participants?
What is triangulation ?
Validity and credibility are an essential part of the case study. Therefore, the researcher should include triangulation to ensure trustworthiness while accurately reflecting what the researcher seeks to investigate.
How to write a Case Study?
When developing a case study, there are different ways you could present the information, but remember to include the five parts for your case study.
Was this resource helpful?
- << Previous: Thematic Data Analysis in Qualitative Design
- Next: Journal Article Reporting Standards (JARS) >>
- Last Updated: Apr 28, 2024 10:57 AM
- URL: https://resources.nu.edu/researchtools
Case Studies
This guide examines case studies, a form of qualitative descriptive research that is used to look at individuals, a small group of participants, or a group as a whole. Researchers collect data about participants using participant and direct observations, interviews, protocols, tests, examinations of records, and collections of writing samples. Starting with a definition of the case study, the guide moves to a brief history of this research method. Using several well documented case studies, the guide then looks at applications and methods including data collection and analysis. A discussion of ways to handle validity, reliability, and generalizability follows, with special attention to case studies as they are applied to composition studies. Finally, this guide examines the strengths and weaknesses of case studies.
Definition and Overview
Case study refers to the collection and presentation of detailed information about a particular participant or small group, frequently including the accounts of subjects themselves. A form of qualitative descriptive research, the case study looks intensely at an individual or small participant pool, drawing conclusions only about that participant or group and only in that specific context. Researchers do not focus on the discovery of a universal, generalizable truth, nor do they typically look for cause-effect relationships; instead, emphasis is placed on exploration and description.
Case studies typically examine the interplay of all variables in order to provide as complete an understanding of an event or situation as possible. This type of comprehensive understanding is arrived at through a process known as thick description, which involves an in-depth description of the entity being evaluated, the circumstances under which it is used, the characteristics of the people involved in it, and the nature of the community in which it is located. Thick description also involves interpreting the meaning of demographic and descriptive data such as cultural norms and mores, community values, ingrained attitudes, and motives.
Unlike quantitative methods of research, like the survey, which focus on the questions of who, what, where, how much, and how many, and archival analysis, which often situates the participant in some form of historical context, case studies are the preferred strategy when how or why questions are asked. Likewise, they are the preferred method when the researcher has little control over the events, and when there is a contemporary focus within a real life context. In addition, unlike more specifically directed experiments, case studies require a problem that seeks a holistic understanding of the event or situation in question using inductive logic--reasoning from specific to more general terms.
In scholarly circles, case studies are frequently discussed within the context of qualitative research and naturalistic inquiry. Case studies are often referred to interchangeably with ethnography, field study, and participant observation. The underlying philosophical assumptions in the case are similar to these types of qualitative research because each takes place in a natural setting (such as a classroom, neighborhood, or private home), and strives for a more holistic interpretation of the event or situation under study.
Unlike more statistically-based studies which search for quantifiable data, the goal of a case study is to offer new variables and questions for further research. F.H. Giddings, a sociologist in the early part of the century, compares statistical methods to the case study on the basis that the former are concerned with the distribution of a particular trait, or a small number of traits, in a population, whereas the case study is concerned with the whole variety of traits to be found in a particular instance" (Hammersley 95).
Case studies are not a new form of research; naturalistic inquiry was the primary research tool until the development of the scientific method. The fields of sociology and anthropology are credited with the primary shaping of the concept as we know it today. However, case study research has drawn from a number of other areas as well: the clinical methods of doctors; the casework technique being developed by social workers; the methods of historians and anthropologists, plus the qualitative descriptions provided by quantitative researchers like LePlay; and, in the case of Robert Park, the techniques of newspaper reporters and novelists.
Park was an ex-newspaper reporter and editor who became very influential in developing sociological case studies at the University of Chicago in the 1920s. As a newspaper professional he coined the term "scientific" or "depth" reporting: the description of local events in a way that pointed to major social trends. Park viewed the sociologist as "merely a more accurate, responsible, and scientific reporter." Park stressed the variety and value of human experience. He believed that sociology sought to arrive at natural, but fluid, laws and generalizations in regard to human nature and society. These laws weren't static laws of the kind sought by many positivists and natural law theorists, but rather, they were laws of becoming--with a constant possibility of change. Park encouraged students to get out of the library, to quit looking at papers and books, and to view the constant experiment of human experience. He writes, "Go and sit in the lounges of the luxury hotels and on the doorsteps of the flophouses; sit on the Gold Coast settees and on the slum shakedowns; sit in the Orchestra Hall and in the Star and Garter Burlesque. In short, gentlemen [sic], go get the seats of your pants dirty in real research."
But over the years, case studies have drawn their share of criticism. In fact, the method had its detractors from the start. In the 1920s, the debate between pro-qualitative and pro-quantitative became quite heated. Case studies, when compared to statistics, were considered by many to be unscientific. From the 1930's on, the rise of positivism had a growing influence on quantitative methods in sociology. People wanted static, generalizable laws in science. The sociological positivists were looking for stable laws of social phenomena. They criticized case study research because it failed to provide evidence of inter subjective agreement. Also, they condemned it because of the few number of cases studied and that the under-standardized character of their descriptions made generalization impossible. By the 1950s, quantitative methods, in the form of survey research, had become the dominant sociological approach and case study had become a minority practice.
Educational Applications
The 1950's marked the dawning of a new era in case study research, namely that of the utilization of the case study as a teaching method. "Instituted at Harvard Business School in the 1950s as a primary method of teaching, cases have since been used in classrooms and lecture halls alike, either as part of a course of study or as the main focus of the course to which other teaching material is added" (Armisted 1984). The basic purpose of instituting the case method as a teaching strategy was "to transfer much of the responsibility for learning from the teacher on to the student, whose role, as a result, shifts away from passive absorption toward active construction" (Boehrer 1990). Through careful examination and discussion of various cases, "students learn to identify actual problems, to recognize key players and their agendas, and to become aware of those aspects of the situation that contribute to the problem" (Merseth 1991). In addition, students are encouraged to "generate their own analysis of the problems under consideration, to develop their own solutions, and to practically apply their own knowledge of theory to these problems" (Boyce 1993). Along the way, students also develop "the power to analyze and to master a tangled circumstance by identifying and delineating important factors; the ability to utilize ideas, to test them against facts, and to throw them into fresh combinations" (Merseth 1991).
In addition to the practical application and testing of scholarly knowledge, case discussions can also help students prepare for real-world problems, situations and crises by providing an approximation of various professional environments (i.e. classroom, board room, courtroom, or hospital). Thus, through the examination of specific cases, students are given the opportunity to work out their own professional issues through the trials, tribulations, experiences, and research findings of others. An obvious advantage to this mode of instruction is that it allows students the exposure to settings and contexts that they might not otherwise experience. For example, a student interested in studying the effects of poverty on minority secondary student's grade point averages and S.A.T. scores could access and analyze information from schools as geographically diverse as Los Angeles, New York City, Miami, and New Mexico without ever having to leave the classroom.
The case study method also incorporates the idea that students can learn from one another "by engaging with each other and with each other's ideas, by asserting something and then having it questioned, challenged and thrown back at them so that they can reflect on what they hear, and then refine what they say" (Boehrer 1990). In summary, students can direct their own learning by formulating questions and taking responsibility for the study.
Types and Design Concerns
Researchers use multiple methods and approaches to conduct case studies.
Types of Case Studies
Under the more generalized category of case study exist several subdivisions, each of which is custom selected for use depending upon the goals and/or objectives of the investigator. These types of case study include the following:
Illustrative Case Studies These are primarily descriptive studies. They typically utilize one or two instances of an event to show what a situation is like. Illustrative case studies serve primarily to make the unfamiliar familiar and to give readers a common language about the topic in question.
Exploratory (or pilot) Case Studies These are condensed case studies performed before implementing a large scale investigation. Their basic function is to help identify questions and select types of measurement prior to the main investigation. The primary pitfall of this type of study is that initial findings may seem convincing enough to be released prematurely as conclusions.
Cumulative Case Studies These serve to aggregate information from several sites collected at different times. The idea behind these studies is the collection of past studies will allow for greater generalization without additional cost or time being expended on new, possibly repetitive studies.
Critical Instance Case Studies These examine one or more sites for either the purpose of examining a situation of unique interest with little to no interest in generalizability, or to call into question or challenge a highly generalized or universal assertion. This method is useful for answering cause and effect questions.
Identifying a Theoretical Perspective
Much of the case study's design is inherently determined for researchers, depending on the field from which they are working. In composition studies, researchers are typically working from a qualitative, descriptive standpoint. In contrast, physicists will approach their research from a more quantitative perspective. Still, in designing the study, researchers need to make explicit the questions to be explored and the theoretical perspective from which they will approach the case. The three most commonly adopted theories are listed below:
Individual Theories These focus primarily on the individual development, cognitive behavior, personality, learning and disability, and interpersonal interactions of a particular subject.
Organizational Theories These focus on bureaucracies, institutions, organizational structure and functions, or excellence in organizational performance.
Social Theories These focus on urban development, group behavior, cultural institutions, or marketplace functions.
Two examples of case studies are used consistently throughout this chapter. The first, a study produced by Berkenkotter, Huckin, and Ackerman (1988), looks at a first year graduate student's initiation into an academic writing program. The study uses participant-observer and linguistic data collecting techniques to assess the student's knowledge of appropriate discourse conventions. Using the pseudonym Nate to refer to the subject, the study sought to illuminate the particular experience rather than to generalize about the experience of fledgling academic writers collectively.
For example, in Berkenkotter, Huckin, and Ackerman's (1988) study we are told that the researchers are interested in disciplinary communities. In the first paragraph, they ask what constitutes membership in a disciplinary community and how achieving membership might affect a writer's understanding and production of texts. In the third paragraph they state that researchers must negotiate their claims "within the context of his sub specialty's accepted knowledge and methodology." In the next paragraph they ask, "How is literacy acquired? What is the process through which novices gain community membership? And what factors either aid or hinder students learning the requisite linguistic behaviors?" This introductory section ends with a paragraph in which the study's authors claim that during the course of the study, the subject, Nate, successfully makes the transition from "skilled novice" to become an initiated member of the academic discourse community and that his texts exhibit linguistic changes which indicate this transition. In the next section the authors make explicit the sociolinguistic theoretical and methodological assumptions on which the study is based (1988). Thus the reader has a good understanding of the authors' theoretical background and purpose in conducting the study even before it is explicitly stated on the fourth page of the study. "Our purpose was to examine the effects of the educational context on one graduate student's production of texts as he wrote in different courses and for different faculty members over the academic year 1984-85." The goal of the study then, was to explore the idea that writers must be initiated into a writing community, and that this initiation will change the way one writes.
The second example is Janet Emig's (1971) study of the composing process of a group of twelfth graders. In this study, Emig seeks to answer the question of what happens to the self as a result educational stimuli in terms of academic writing. The case study used methods such as protocol analysis, tape-recorded interviews, and discourse analysis.
In the case of Janet Emig's (1971) study of the composing process of eight twelfth graders, four specific hypotheses were made:
- Twelfth grade writers engage in two modes of composing: reflexive and extensive.
- These differences can be ascertained and characterized through having the writers compose aloud their composition process.
- A set of implied stylistic principles governs the writing process.
- For twelfth grade writers, extensive writing occurs chiefly as a school-sponsored activity, or reflexive, as a self-sponsored activity.
In this study, the chief distinction is between the two dominant modes of composing among older, secondary school students. The distinctions are:
- The reflexive mode, which focuses on the writer's thoughts and feelings.
- The extensive mode, which focuses on conveying a message.
Emig also outlines the specific questions which guided the research in the opening pages of her Review of Literature , preceding the report.
Designing a Case Study
After considering the different sub categories of case study and identifying a theoretical perspective, researchers can begin to design their study. Research design is the string of logic that ultimately links the data to be collected and the conclusions to be drawn to the initial questions of the study. Typically, research designs deal with at least four problems:
- What questions to study
- What data are relevant
- What data to collect
- How to analyze that data
In other words, a research design is basically a blueprint for getting from the beginning to the end of a study. The beginning is an initial set of questions to be answered, and the end is some set of conclusions about those questions.
Because case studies are conducted on topics as diverse as Anglo-Saxon Literature (Thrane 1986) and AIDS prevention (Van Vugt 1994), it is virtually impossible to outline any strict or universal method or design for conducting the case study. However, Robert K. Yin (1993) does offer five basic components of a research design:
- A study's questions.
- A study's propositions (if any).
- A study's units of analysis.
- The logic that links the data to the propositions.
- The criteria for interpreting the findings.
In addition to these five basic components, Yin also stresses the importance of clearly articulating one's theoretical perspective, determining the goals of the study, selecting one's subject(s), selecting the appropriate method(s) of collecting data, and providing some considerations to the composition of the final report.
Conducting Case Studies
To obtain as complete a picture of the participant as possible, case study researchers can employ a variety of approaches and methods. These approaches, methods, and related issues are discussed in depth in this section.
Method: Single or Multi-modal?
To obtain as complete a picture of the participant as possible, case study researchers can employ a variety of methods. Some common methods include interviews , protocol analyses, field studies, and participant-observations. Emig (1971) chose to use several methods of data collection. Her sources included conversations with the students, protocol analysis, discrete observations of actual composition, writing samples from each student, and school records (Lauer and Asher 1988).
Berkenkotter, Huckin, and Ackerman (1988) collected data by observing classrooms, conducting faculty and student interviews, collecting self reports from the subject, and by looking at the subject's written work.
A study that was criticized for using a single method model was done by Flower and Hayes (1984). In this study that explores the ways in which writers use different forms of knowing to create space, the authors used only protocol analysis to gather data. The study came under heavy fire because of their decision to use only one method.
Participant Selection
Case studies can use one participant, or a small group of participants. However, it is important that the participant pool remain relatively small. The participants can represent a diverse cross section of society, but this isn't necessary.
For example, the Berkenkotter, Huckin, and Ackerman (1988) study looked at just one participant, Nate. By contrast, in Janet Emig's (1971) study of the composition process of twelfth graders, eight participants were selected representing a diverse cross section of the community, with volunteers from an all-white upper-middle-class suburban school, an all-black inner-city school, a racially mixed lower-middle-class school, an economically and racially mixed school, and a university school.
Often, a brief "case history" is done on the participants of the study in order to provide researchers with a clearer understanding of their participants, as well as some insight as to how their own personal histories might affect the outcome of the study. For instance, in Emig's study, the investigator had access to the school records of five of the participants, and to standardized test scores for the remaining three. Also made available to the researcher was the information that three of the eight students were selected as NCTE Achievement Award winners. These personal histories can be useful in later stages of the study when data are being analyzed and conclusions drawn.
Data Collection
There are six types of data collected in case studies:
- Archival records.
- Interviews.
- Direct observation.
- Participant observation.
In the field of composition research, these six sources might be:
- A writer's drafts.
- School records of student writers.
- Transcripts of interviews with a writer.
- Transcripts of conversations between writers (and protocols).
- Videotapes and notes from direct field observations.
- Hard copies of a writer's work on computer.
Depending on whether researchers have chosen to use a single or multi-modal approach for the case study, they may choose to collect data from one or any combination of these sources.
Protocols, that is, transcriptions of participants talking aloud about what they are doing as they do it, have been particularly common in composition case studies. For example, in Emig's (1971) study, the students were asked, in four different sessions, to give oral autobiographies of their writing experiences and to compose aloud three themes in the presence of a tape recorder and the investigator.
In some studies, only one method of data collection is conducted. For example, the Flower and Hayes (1981) report on the cognitive process theory of writing depends on protocol analysis alone. However, using multiple sources of evidence to increase the reliability and validity of the data can be advantageous.
Case studies are likely to be much more convincing and accurate if they are based on several different sources of information, following a corroborating mode. This conclusion is echoed among many composition researchers. For example, in her study of predrafting processes of high and low-apprehensive writers, Cynthia Selfe (1985) argues that because "methods of indirect observation provide only an incomplete reflection of the complex set of processes involved in composing, a combination of several such methods should be used to gather data in any one study." Thus, in this study, Selfe collected her data from protocols, observations of students role playing their writing processes, audio taped interviews with the students, and videotaped observations of the students in the process of composing.
It can be said then, that cross checking data from multiple sources can help provide a multidimensional profile of composing activities in a particular setting. Sharan Merriam (1985) suggests "checking, verifying, testing, probing, and confirming collected data as you go, arguing that this process will follow in a funnel-like design resulting in less data gathering in later phases of the study along with a congruent increase in analysis checking, verifying, and confirming."
It is important to note that in case studies, as in any qualitative descriptive research, while researchers begin their studies with one or several questions driving the inquiry (which influence the key factors the researcher will be looking for during data collection), a researcher may find new key factors emerging during data collection. These might be unexpected patterns or linguistic features which become evident only during the course of the research. While not bearing directly on the researcher's guiding questions, these variables may become the basis for new questions asked at the end of the report, thus linking to the possibility of further research.
Data Analysis
As the information is collected, researchers strive to make sense of their data. Generally, researchers interpret their data in one of two ways: holistically or through coding. Holistic analysis does not attempt to break the evidence into parts, but rather to draw conclusions based on the text as a whole. Flower and Hayes (1981), for example, make inferences from entire sections of their students' protocols, rather than searching through the transcripts to look for isolatable characteristics.
However, composition researchers commonly interpret their data by coding, that is by systematically searching data to identify and/or categorize specific observable actions or characteristics. These observable actions then become the key variables in the study. Sharan Merriam (1988) suggests seven analytic frameworks for the organization and presentation of data:
- The role of participants.
- The network analysis of formal and informal exchanges among groups.
- Historical.
- Thematical.
- Ritual and symbolism.
- Critical incidents that challenge or reinforce fundamental beliefs, practices, and values.
There are two purposes of these frameworks: to look for patterns among the data and to look for patterns that give meaning to the case study.
As stated above, while most researchers begin their case studies expecting to look for particular observable characteristics, it is not unusual for key variables to emerge during data collection. Typical variables coded in case studies of writers include pauses writers make in the production of a text, the use of specific linguistic units (such as nouns or verbs), and writing processes (planning, drafting, revising, and editing). In the Berkenkotter, Huckin, and Ackerman (1988) study, for example, researchers coded the participant's texts for use of connectives, discourse demonstratives, average sentence length, off-register words, use of the first person pronoun, and the ratio of definite articles to indefinite articles.
Since coding is inherently subjective, more than one coder is usually employed. In the Berkenkotter, Huckin, and Ackerman (1988) study, for example, three rhetoricians were employed to code the participant's texts for off-register phrases. The researchers established the agreement among the coders before concluding that the participant used fewer off-register words as the graduate program progressed.
Composing the Case Study Report
In the many forms it can take, "a case study is generically a story; it presents the concrete narrative detail of actual, or at least realistic events, it has a plot, exposition, characters, and sometimes even dialogue" (Boehrer 1990). Generally, case study reports are extensively descriptive, with "the most problematic issue often referred to as being the determination of the right combination of description and analysis" (1990). Typically, authors address each step of the research process, and attempt to give the reader as much context as possible for the decisions made in the research design and for the conclusions drawn.
This contextualization usually includes a detailed explanation of the researchers' theoretical positions, of how those theories drove the inquiry or led to the guiding research questions, of the participants' backgrounds, of the processes of data collection, of the training and limitations of the coders, along with a strong attempt to make connections between the data and the conclusions evident.
Although the Berkenkotter, Huckin, and Ackerman (1988) study does not, case study reports often include the reactions of the participants to the study or to the researchers' conclusions. Because case studies tend to be exploratory, most end with implications for further study. Here researchers may identify significant variables that emerged during the research and suggest studies related to these, or the authors may suggest further general questions that their case study generated.
For example, Emig's (1971) study concludes with a section dedicated solely to the topic of implications for further research, in which she suggests several means by which this particular study could have been improved, as well as questions and ideas raised by this study which other researchers might like to address, such as: is there a correlation between a certain personality and a certain composing process profile (e.g. is there a positive correlation between ego strength and persistence in revising)?
Also included in Emig's study is a section dedicated to implications for teaching, which outlines the pedagogical ramifications of the study's findings for teachers currently involved in high school writing programs.
Sharan Merriam (1985) also offers several suggestions for alternative presentations of data:
- Prepare specialized condensations for appropriate groups.
- Replace narrative sections with a series of answers to open-ended questions.
- Present "skimmer's" summaries at beginning of each section.
- Incorporate headlines that encapsulate information from text.
- Prepare analytic summaries with supporting data appendixes.
- Present data in colorful and/or unique graphic representations.
Issues of Validity and Reliability
Once key variables have been identified, they can be analyzed. Reliability becomes a key concern at this stage, and many case study researchers go to great lengths to ensure that their interpretations of the data will be both reliable and valid. Because issues of validity and reliability are an important part of any study in the social sciences, it is important to identify some ways of dealing with results.
Multi-modal case study researchers often balance the results of their coding with data from interviews or writer's reflections upon their own work. Consequently, the researchers' conclusions become highly contextualized. For example, in a case study which looked at the time spent in different stages of the writing process, Berkenkotter concluded that her participant, Donald Murray, spent more time planning his essays than in other writing stages. The report of this case study is followed by Murray's reply, wherein he agrees with some of Berkenkotter's conclusions and disagrees with others.
As is the case with other research methodologies, issues of external validity, construct validity, and reliability need to be carefully considered.
Commentary on Case Studies
Researchers often debate the relative merits of particular methods, among them case study. In this section, we comment on two key issues. To read the commentaries, choose any of the items below:
Strengths and Weaknesses of Case Studies
Most case study advocates point out that case studies produce much more detailed information than what is available through a statistical analysis. Advocates will also hold that while statistical methods might be able to deal with situations where behavior is homogeneous and routine, case studies are needed to deal with creativity, innovation, and context. Detractors argue that case studies are difficult to generalize because of inherent subjectivity and because they are based on qualitative subjective data, generalizable only to a particular context.
Flexibility
The case study approach is a comparatively flexible method of scientific research. Because its project designs seem to emphasize exploration rather than prescription or prediction, researchers are comparatively freer to discover and address issues as they arise in their experiments. In addition, the looser format of case studies allows researchers to begin with broad questions and narrow their focus as their experiment progresses rather than attempt to predict every possible outcome before the experiment is conducted.
Emphasis on Context
By seeking to understand as much as possible about a single subject or small group of subjects, case studies specialize in "deep data," or "thick description"--information based on particular contexts that can give research results a more human face. This emphasis can help bridge the gap between abstract research and concrete practice by allowing researchers to compare their firsthand observations with the quantitative results obtained through other methods of research.
Inherent Subjectivity
"The case study has long been stereotyped as the weak sibling among social science methods," and is often criticized as being too subjective and even pseudo-scientific. Likewise, "investigators who do case studies are often regarded as having deviated from their academic disciplines, and their investigations as having insufficient precision (that is, quantification), objectivity and rigor" (Yin 1989). Opponents cite opportunities for subjectivity in the implementation, presentation, and evaluation of case study research. The approach relies on personal interpretation of data and inferences. Results may not be generalizable, are difficult to test for validity, and rarely offer a problem-solving prescription. Simply put, relying on one or a few subjects as a basis for cognitive extrapolations runs the risk of inferring too much from what might be circumstance.
High Investment
Case studies can involve learning more about the subjects being tested than most researchers would care to know--their educational background, emotional background, perceptions of themselves and their surroundings, their likes, dislikes, and so on. Because of its emphasis on "deep data," the case study is out of reach for many large-scale research projects which look at a subject pool in the tens of thousands. A budget request of $10,000 to examine 200 subjects sounds more efficient than a similar request to examine four subjects.
Ethical Considerations
Researchers conducting case studies should consider certain ethical issues. For example, many educational case studies are often financed by people who have, either directly or indirectly, power over both those being studied and those conducting the investigation (1985). This conflict of interests can hinder the credibility of the study.
The personal integrity, sensitivity, and possible prejudices and/or biases of the investigators need to be taken into consideration as well. Personal biases can creep into how the research is conducted, alternative research methods used, and the preparation of surveys and questionnaires.
A common complaint in case study research is that investigators change direction during the course of the study unaware that their original research design was inadequate for the revised investigation. Thus, the researchers leave unknown gaps and biases in the study. To avoid this, researchers should report preliminary findings so that the likelihood of bias will be reduced.
Concerns about Reliability, Validity, and Generalizability
Merriam (1985) offers several suggestions for how case study researchers might actively combat the popular attacks on the validity, reliability, and generalizability of case studies:
- Prolong the Processes of Data Gathering on Site: This will help to insure the accuracy of the findings by providing the researcher with more concrete information upon which to formulate interpretations.
- Employ the Process of "Triangulation": Use a variety of data sources as opposed to relying solely upon one avenue of observation. One example of such a data check would be what McClintock, Brannon, and Maynard (1985) refer to as a "case cluster method," that is, when a single unit within a larger case is randomly sampled, and that data treated quantitatively." For instance, in Emig's (1971) study, the case cluster method was employed, singling out the productivity of a single student named Lynn. This cluster profile included an advanced case history of the subject, specific examination and analysis of individual compositions and protocols, and extensive interview sessions. The seven remaining students were then compared with the case of Lynn, to ascertain if there are any shared, or unique dimensions to the composing process engaged in by these eight students.
- Conduct Member Checks: Initiate and maintain an active corroboration on the interpretation of data between the researcher and those who provided the data. In other words, talk to your subjects.
- Collect Referential Materials: Complement the file of materials from the actual site with additional document support. For example, Emig (1971) supports her initial propositions with historical accounts by writers such as T.S. Eliot, James Joyce, and D.H. Lawrence. Emig also cites examples of theoretical research done with regards to the creative process, as well as examples of empirical research dealing with the writing of adolescents. Specific attention is then given to the four stages description of the composing process delineated by Helmoltz, Wallas, and Cowley, as it serves as the focal point in this study.
- Engage in Peer Consultation: Prior to composing the final draft of the report, researchers should consult with colleagues in order to establish validity through pooled judgment.
Although little can be done to combat challenges concerning the generalizability of case studies, "most writers suggest that qualitative research should be judged as credible and confirmable as opposed to valid and reliable" (Merriam 1985). Likewise, it has been argued that "rather than transplanting statistical, quantitative notions of generalizability and thus finding qualitative research inadequate, it makes more sense to develop an understanding of generalization that is congruent with the basic characteristics of qualitative inquiry" (1985). After all, criticizing the case study method for being ungeneralizable is comparable to criticizing a washing machine for not being able to tell the correct time. In other words, it is unjust to criticize a method for not being able to do something which it was never originally designed to do in the first place.
Annotated Bibliography
Armisted, C. (1984). How Useful are Case Studies. Training and Development Journal, 38 (2), 75-77.
This article looks at eight types of case studies, offers pros and cons of using case studies in the classroom, and gives suggestions for successfully writing and using case studies.
Bardovi-Harlig, K. (1997). Beyond Methods: Components of Second Language Teacher Education . New York: McGraw-Hill.
A compilation of various research essays which address issues of language teacher education. Essays included are: "Non-native reading research and theory" by Lee, "The case for Psycholinguistics" by VanPatten, and "Assessment and Second Language Teaching" by Gradman and Reed.
Bartlett, L. (1989). A Question of Good Judgment; Interpretation Theory and Qualitative Enquiry Address. 70th Annual Meeting of the American Educational Research Association. San Francisco.
Bartlett selected "quasi-historical" methodology, which focuses on the "truth" found in case records, as one that will provide "good judgments" in educational inquiry. He argues that although the method is not comprehensive, it can try to connect theory with practice.
Baydere, S. et. al. (1993). Multimedia conferencing as a tool for collaborative writing: a case study in Computer Supported Collaborative Writing. New York: Springer-Verlag.
The case study by Baydere et. al. is just one of the many essays in this book found in the series "Computer Supported Cooperative Work." Denley, Witefield and May explore similar issues in their essay, "A case study in task analysis for the design of a collaborative document production system."
Berkenkotter, C., Huckin, T., N., & Ackerman J. (1988). Conventions, Conversations, and the Writer: Case Study of a Student in a Rhetoric Ph.D. Program. Research in the Teaching of English, 22, 9-44.
The authors focused on how the writing of their subject, Nate or Ackerman, changed as he became more acquainted or familiar with his field's discourse community.
Berninger, V., W., and Gans, B., M. (1986). Language Profiles in Nonspeaking Individuals of Normal Intelligence with Severe Cerebral Palsy. Augmentative and Alternative Communication, 2, 45-50.
Argues that generalizations about language abilities in patients with severe cerebral palsy (CP) should be avoided. Standardized tests of different levels of processing oral language, of processing written language, and of producing written language were administered to 3 male participants (aged 9, 16, and 40 yrs).
Bockman, J., R., and Couture, B. (1984). The Case Method in Technical Communication: Theory and Models. Texas: Association of Teachers of Technical Writing.
Examines the study and teaching of technical writing, communication of technical information, and the case method in terms of those applications.
Boehrer, J. (1990). Teaching With Cases: Learning to Question. New Directions for Teaching and Learning, 42 41-57.
This article discusses the origins of the case method, looks at the question of what is a case, gives ideas about learning in case teaching, the purposes it can serve in the classroom, the ground rules for the case discussion, including the role of the question, and new directions for case teaching.
Bowman, W. R. (1993). Evaluating JTPA Programs for Economically Disadvantaged Adults: A Case Study of Utah and General Findings . Washington: National Commission for Employment Policy.
"To encourage state-level evaluations of JTPA, the Commission and the State of Utah co-sponsored this report on the effectiveness of JTPA Title II programs for adults in Utah. The technique used is non-experimental and the comparison group was selected from registrants with Utah's Employment Security. In a step-by-step approach, the report documents how non-experimental techniques can be applied and several specific technical issues can be addressed."
Boyce, A. (1993) The Case Study Approach for Pedagogists. Annual Meeting of the American Alliance for Health, Physical Education, Recreation and Dance. (Address). Washington DC.
This paper addresses how case studies 1) bridge the gap between teaching theory and application, 2) enable students to analyze problems and develop solutions for situations that will be encountered in the real world of teaching, and 3) helps students to evaluate the feasibility of alternatives and to understand the ramifications of a particular course of action.
Carson, J. (1993) The Case Study: Ideal Home of WAC Quantitative and Qualitative Data. Annual Meeting of the Conference on College Composition and Communication. (Address). San Diego.
"Increasingly, one of the most pressing questions for WAC advocates is how to keep [WAC] programs going in the face of numerous difficulties. Case histories offer the best chance for fashioning rhetorical arguments to keep WAC programs going because they offer the opportunity to provide a coherent narrative that contextualizes all documents and data, including what is generally considered scientific data. A case study of the WAC program, . . . at Robert Morris College in Pittsburgh demonstrates the advantages of this research method. Such studies are ideal homes for both naturalistic and positivistic data as well as both quantitative and qualitative information."
---. (1991). A Cognitive Process Theory of Writing. College Composition and Communication. 32. 365-87.
No abstract available.
Cromer, R. (1994) A Case Study of Dissociations Between Language and Cognition. Constraints on Language Acquisition: Studies of Atypical Children . Hillsdale: Lawrence Erlbaum Associates, 141-153.
Crossley, M. (1983) Case Study in Comparative and International Education: An Approach to Bridging the Theory-Practice Gap. Proceedings of the 11th Annual Conference of the Australian Comparative and International Education Society. Hamilton, NZ.
Case study research, as presented here, helps bridge the theory-practice gap in comparative and international research studies of education because it focuses on the practical, day-to-day context rather than on the national arena. The paper asserts that the case study method can be valuable at all levels of research, formation, and verification of theories in education.
Daillak, R., H., and Alkin, M., C. (1982). Qualitative Studies in Context: Reflections on the CSE Studies of Evaluation Use . California: EDRS
The report shows how the Center of the Study of Evaluation (CSE) applied qualitative techniques to a study of evaluation information use in local, Los Angeles schools. It critiques the effectiveness and the limitations of using case study, evaluation, field study, and user interview survey methodologies.
Davey, L. (1991). The Application of Case Study Evaluations. ERIC/TM Digest.
This article examines six types of case studies, the type of evaluation questions that can be answered, the functions served, some design features, and some pitfalls of the method.
Deutch, C. E. (1996). A course in research ethics for graduate students. College Teaching, 44, 2, 56-60.
This article describes a one-credit discussion course in research ethics for graduate students in biology. Case studies are focused on within the four parts of the course: 1) major issues, 2 )practical issues in scholarly work, 3) ownership of research results, and 4) training and personal decisions.
DeVoss, G. (1981). Ethics in Fieldwork Research. RIE 27p. (ERIC)
This article examines four of the ethical problems that can happen when conducting case study research: acquiring permission to do research, knowing when to stop digging, the pitfalls of doing collaborative research, and preserving the integrity of the participants.
Driscoll, A. (1985). Case Study of a Research Intervention: the University of Utah’s Collaborative Approach . San Francisco: Far West Library for Educational Research Development.
Paper presented at the annual meeting of the American Association of Colleges of Teacher Education, Denver, CO, March 1985. Offers information of in-service training, specifically case studies application.
Ellram, L. M. (1996). The Use of the Case Study Method in Logistics Research. Journal of Business Logistics, 17, 2, 93.
This article discusses the increased use of case study in business research, and the lack of understanding of when and how to use case study methodology in business.
Emig, J. (1971) The Composing Processes of Twelfth Graders . Urbana: NTCE.
This case study uses observation, tape recordings, writing samples, and school records to show that writing in reflexive and extensive situations caused different lengths of discourse and different clusterings of the components of the writing process.
Feagin, J. R. (1991). A Case For the Case Study . Chapel Hill: The University of North Carolina Press.
This book discusses the nature, characteristics, and basic methodological issues of the case study as a research method.
Feldman, H., Holland, A., & Keefe, K. (1989) Language Abilities after Left Hemisphere Brain Injury: A Case Study of Twins. Topics in Early Childhood Special Education, 9, 32-47.
"Describes the language abilities of 2 twin pairs in which 1 twin (the experimental) suffered brain injury to the left cerebral hemisphere around the time of birth and1 twin (the control) did not. One pair of twins was initially assessed at age 23 mo. and the other at about 30 mo.; they were subsequently evaluated in their homes 3 times at about 6-mo intervals."
Fidel, R. (1984). The Case Study Method: A Case Study. Library and Information Science Research, 6.
The article describes the use of case study methodology to systematically develop a model of online searching behavior in which study design is flexible, subject manner determines data gathering and analyses, and procedures adapt to the study's progressive change.
Flower, L., & Hayes, J. R. (1984). Images, Plans and Prose: The Representation of Meaning in Writing. Written Communication, 1, 120-160.
Explores the ways in which writers actually use different forms of knowing to create prose.
Frey, L. R. (1992). Interpreting Communication Research: A Case Study Approach Englewood Cliffs, N.J.: Prentice Hall.
The book discusses research methodologies in the Communication field. It focuses on how case studies bridge the gap between communication research, theory, and practice.
Gilbert, V. K. (1981). The Case Study as a Research Methodology: Difficulties and Advantages of Integrating the Positivistic, Phenomenological and Grounded Theory Approaches . The Annual Meeting of the Canadian Association for the Study of Educational Administration. (Address) Halifax, NS, Can.
This study on an innovative secondary school in England shows how a "low-profile" participant-observer case study was crucial to the initial observation, the testing of hypotheses, the interpretive approach, and the grounded theory.
Gilgun, J. F. (1994). A Case for Case Studies in Social Work Research. Social Work, 39, 4, 371-381.
This article defines case study research, presents guidelines for evaluation of case studies, and shows the relevance of case studies to social work research. It also looks at issues such as evaluation and interpretations of case studies.
Glennan, S. L., Sharp-Bittner, M. A. & Tullos, D. C. (1991). Augmentative and Alternative Communication Training with a Nonspeaking Adult: Lessons from MH. Augmentative and Alternative Communication, 7, 240-7.
"A response-guided case study documented changes in a nonspeaking 36-yr-old man's ability to communicate using 3 trained augmentative communication modes. . . . Data were collected in videotaped interaction sessions between the nonspeaking adult and a series of adult speaking."
Graves, D. (1981). An Examination of the Writing Processes of Seven Year Old Children. Research in the Teaching of English, 15, 113-134.
Hamel, J. (1993). Case Study Methods . Newbury Park: Sage. .
"In a most economical fashion, Hamel provides a practical guide for producing theoretically sharp and empirically sound sociological case studies. A central idea put forth by Hamel is that case studies must "locate the global in the local" thus making the careful selection of the research site the most critical decision in the analytic process."
Karthigesu, R. (1986, July). Television as a Tool for Nation-Building in the Third World: A Post-Colonial Pattern, Using Malaysia as a Case-Study. International Television Studies Conference. (Address). London, 10-12.
"The extent to which Television Malaysia, as a national mass media organization, has been able to play a role in nation building in the post-colonial period is . . . studied in two parts: how the choice of a model of nation building determines the character of the organization; and how the character of the organization influences the output of the organization."
Kenny, R. (1984). Making the Case for the Case Study. Journal of Curriculum Studies, 16, (1), 37-51.
The article looks at how and why the case study is justified as a viable and valuable approach to educational research and program evaluation.
Knirk, F. (1991). Case Materials: Research and Practice. Performance Improvement Quarterly, 4 (1 ), 73-81.
The article addresses the effectiveness of case studies, subject areas where case studies are commonly used, recent examples of their use, and case study design considerations.
Klos, D. (1976). Students as Case Writers. Teaching of Psychology, 3.2, 63-66.
This article reviews a course in which students gather data for an original case study of another person. The task requires the students to design the study, collect the data, write the narrative, and interpret the findings.
Leftwich, A. (1981). The Politics of Case Study: Problems of Innovation in University Education. Higher Education Review, 13.2, 38-64.
The article discusses the use of case studies as a teaching method. Emphasis is on the instructional materials, interdisciplinarity, and the complex relationships within the university that help or hinder the method.
Mabrito, M. (1991, Oct.). Electronic Mail as a Vehicle for Peer Response: Conversations of High and Low Apprehensive Writers. Written Communication, 509-32.
McCarthy, S., J. (1955). The Influence of Classroom Discourse on Student Texts: The Case of Ella . East Lansing: Institute for Research on Teaching.
A look at how students of color become marginalized within traditional classroom discourse. The essay follows the struggles of one black student: Ella.
Matsuhashi, A., ed. (1987). Writing in Real Time: Modeling Production Processes Norwood, NJ: Ablex Publishing Corporation.
Investigates how writers plan to produce discourse for different purposes to report, to generalize, and to persuade, as well as how writers plan for sentence level units of language. To learn about planning, an observational measure of pause time was used" (ERIC).
Merriam, S. B. (1985). The Case Study in Educational Research: A Review of Selected Literature. Journal of Educational Thought, 19.3, 204-17.
The article examines the characteristics of, philosophical assumptions underlying the case study, the mechanics of conducting a case study, and the concerns about the reliability, validity, and generalizability of the method.
---. (1988). Case Study Research in Education: A Qualitative Approach San Francisco: Jossey Bass.
Merry, S. E., & Milner, N. eds. (1993). The Possibility of Popular Justice: A Case Study of Community Mediation in the United States . Ann Arbor: U of Michigan.
". . . this volume presents a case study of one experiment in popular justice, the San Francisco Community Boards. This program has made an explicit claim to create an alternative justice, or new justice, in the midst of a society ordered by state law. The contributors to this volume explore the history and experience of the program and compare it to other versions of popular justice in the United States, Europe, and the Third World."
Merseth, K. K. (1991). The Case for Cases in Teacher Education. RIE. 42p. (ERIC).
This monograph argues that the case method of instruction offers unique potential for revitalizing the field of teacher education.
Michaels, S. (1987). Text and Context: A New Approach to the Study of Classroom Writing. Discourse Processes, 10, 321-346.
"This paper argues for and illustrates an approach to the study of writing that integrates ethnographic analysis of classroom interaction with linguistic analysis of written texts and teacher/student conversational exchanges. The approach is illustrated through a case study of writing in a single sixth grade classroom during a single writing assignment."
Milburn, G. (1995). Deciphering a Code or Unraveling a Riddle: A Case Study in the Application of a Humanistic Metaphor to the Reporting of Social Studies Teaching. Theory and Research in Education, 13.
This citation serves as an example of how case studies document learning procedures in a senior-level economics course.
Milley, J. E. (1979). An Investigation of Case Study as an Approach to Program Evaluation. 19th Annual Forum of the Association for Institutional Research. (Address). San Diego.
The case study method merged a narrative report focusing on the evaluator as participant-observer with document review, interview, content analysis, attitude questionnaire survey, and sociogram analysis. Milley argues that case study program evaluation has great potential for widespread use.
Minnis, J. R. (1985, Sept.). Ethnography, Case Study, Grounded Theory, and Distance Education Research. Distance Education, 6.2.
This article describes and defines the strengths and weaknesses of ethnography, case study, and grounded theory.
Nunan, D. (1992). Collaborative language learning and teaching . New York: Cambridge University Press.
Included in this series of essays is Peter Sturman’s "Team Teaching: a case study from Japan" and David Nunan’s own "Toward a collaborative approach to curriculum development: a case study."
Nystrand, M., ed. (1982). What Writers Know: The Language, Process, and Structure of Written Discourse . New York: Academic Press.
Owenby, P. H. (1992). Making Case Studies Come Alive. Training, 29, (1), 43-46. (ERIC)
This article provides tips for writing more effective case studies.
---. (1981). Pausing and Planning: The Tempo of Writer Discourse Production. Research in the Teaching of English, 15 (2),113-34.
Perl, S. (1979). The Composing Processes of Unskilled College Writers. Research in the Teaching of English, 13, 317-336.
"Summarizes a study of five unskilled college writers, focusing especially on one of the five, and discusses the findings in light of current pedagogical practice and research design."
Pilcher J. and A. Coffey. eds. (1996). Gender and Qualitative Research . Brookfield: Aldershot, Hants, England.
This book provides a series of essays which look at gender identity research, qualitative research and applications of case study to questions of gendered pedagogy.
Pirie, B. S. (1993). The Case of Morty: A Four Year Study. Gifted Education International, 9 (2), 105-109.
This case study describes a boy from kindergarten through third grade with above average intelligence but difficulty in learning to read, write, and spell.
Popkewitz, T. (1993). Changing Patterns of Power: Social Regulation and Teacher Education Reform. Albany: SUNY Press.
Popkewitz edits this series of essays that address case studies on educational change and the training of teachers. The essays vary in terms of discipline and scope. Also, several authors include case studies of educational practices in countries other than the United States.
---. (1984). The Predrafting Processes of Four High- and Four Low Apprehensive Writers. Research in the Teaching of English, 18, (1), 45-64.
Rasmussen, P. (1985, March) A Case Study on the Evaluation of Research at the Technical University of Denmark. International Journal of Institutional Management in Higher Education, 9 (1).
This is an example of a case study methodology used to evaluate the chemistry and chemical engineering departments at the University of Denmark.
Roth, K. J. (1986). Curriculum Materials, Teacher Talk, and Student Learning: Case Studies in Fifth-Grade Science Teaching . East Lansing: Institute for Research on Teaching.
Roth offers case studies on elementary teachers, elementary school teaching, science studies and teaching, and verbal learning.
Selfe, C. L. (1985). An Apprehensive Writer Composes. When a Writer Can't Write: Studies in Writer's Block and Other Composing-Process Problems . (pp. 83-95). Ed. Mike Rose. NMY: Guilford.
Smith-Lewis, M., R. and Ford, A. (1987). A User's Perspective on Augmentative Communication. Augmentative and Alternative Communication, 3, 12-7.
"During a series of in-depth interviews, a 25-yr-old woman with cerebral palsy who utilized augmentative communication reflected on the effectiveness of the devices designed for her during her school career."
St. Pierre, R., G. (1980, April). Follow Through: A Case Study in Metaevaluation Research . 64th Annual Meeting of the American Educational Research Association. (Address).
The three approaches to metaevaluation are evaluation of primary evaluations, integrative meta-analysis with combined primary evaluation results, and re-analysis of the raw data from a primary evaluation.
Stahler, T., M. (1996, Feb.) Early Field Experiences: A Model That Worked. ERIC.
"This case study of a field and theory class examines a model designed to provide meaningful field experiences for preservice teachers while remaining consistent with the instructor's beliefs about the role of teacher education in preparing teachers for the classroom."
Stake, R. E. (1995). The Art of Case Study Research. Thousand Oaks: Sage Publications.
This book examines case study research in education and case study methodology.
Stiegelbauer, S. (1984) Community, Context, and Co-curriculum: Situational Factors Influencing School Improvements in a Study of High Schools. Presented at the annual meeting of the American Educational Research Association, New Orleans, LA.
Discussion of several case studies: one looking at high school environments, another examining educational innovations.
Stolovitch, H. (1990). Case Study Method. Performance And Instruction, 29, (9), 35-37.
This article describes the case study method as a form of simulation and presents guidelines for their use in professional training situations.
Thaller, E. (1994). Bibliography for the Case Method: Using Case Studies in Teacher Education. RIE. 37 p.
This bibliography presents approximately 450 citations on the use of case studies in teacher education from 1921-1993.
Thrane, T. (1986). On Delimiting the Senses of Near-Synonyms in Historical Semantics: A Case Study of Adjectives of 'Moral Sufficiency' in the Old English Andreas. Linguistics Across Historical and Geographical Boundaries: In Honor of Jacek Fisiak on the Occasion of his Fiftieth Birthday . Berlin: Mouton de Gruyter.
United Nations. (1975). Food and Agriculture Organization. Report on the FAO/UNFPA Seminar on Methodology, Research and Country: Case Studies on Population, Employment and Productivity . Rome: United Nations.
This example case study shows how the methodology can be used in a demographic and psychographic evaluation. At the same time, it discusses the formation and instigation of the case study methodology itself.
Van Vugt, J. P., ed. (1994). Aids Prevention and Services: Community Based Research . Westport: Bergin and Garvey.
"This volume has been five years in the making. In the process, some of the policy applications called for have met with limited success, such as free needle exchange programs in a limited number of American cities, providing condoms to prison inmates, and advertisements that depict same-sex couples. Rather than dating our chapters that deal with such subjects, such policy applications are verifications of the type of research demonstrated here. Furthermore, they indicate the critical need to continue community based research in the various communities threatened by acquired immuno-deficiency syndrome (AIDS) . . . "
Welch, W., ed. (1981, May). Case Study Methodology in Educational Evaluation. Proceedings of the Minnesota Evaluation Conference. Minnesota. (Address).
The four papers in these proceedings provide a comprehensive picture of the rationale, methodology, strengths, and limitations of case studies.
Williams, G. (1987). The Case Method: An Approach to Teaching and Learning in Educational Administration. RIE, 31p.
This paper examines the viability of the case method as a teaching and learning strategy in instructional systems geared toward the training of personnel of the administration of various aspects of educational systems.
Yin, R. K. (1993). Advancing Rigorous Methodologies: A Review of 'Towards Rigor in Reviews of Multivocal Literatures.' Review of Educational Research, 61, (3).
"R. T. Ogawa and B. Malen's article does not meet its own recommended standards for rigorous testing and presentation of its own conclusions. Use of the exploratory case study to analyze multivocal literatures is not supported, and the claim of grounded theory to analyze multivocal literatures may be stronger."
---. (1989). Case Study Research: Design and Methods. London: Sage Publications Inc.
This book discusses in great detail, the entire design process of the case study, including entire chapters on collecting evidence, analyzing evidence, composing the case study report, and designing single and multiple case studies.
Related Links
Consider the following list of related Web sites for more information on the topic of case study research. Note: although many of the links cover the general category of qualitative research, all have sections that address issues of case studies.
- Sage Publications on Qualitative Methodology: Search here for a comprehensive list of new books being published about "Qualitative Methodology" http://www.sagepub.co.uk/
- The International Journal of Qualitative Studies in Education: An on-line journal "to enhance the theory and practice of qualitative research in education." On-line submissions are welcome. http://www.tandf.co.uk/journals/tf/09518398.html
- Qualitative Research Resources on the Internet: From syllabi to home pages to bibliographies. All links relate somehow to qualitative research. http://www.nova.edu/ssss/QR/qualres.html
Citation Information
Bronwyn Becker, Patrick Dawson, Karen Devine, Carla Hannum, Steve Hill, Jon Leydens, Debbie Matuskevich, Carol Traver, and Mike Palmquist. (1994-2024). Case Studies. The WAC Clearinghouse. Colorado State University. Available at https://wac.colostate.edu/repository/writing/guides/.
Copyright Information
Copyright © 1994-2024 Colorado State University and/or this site's authors, developers, and contributors . Some material displayed on this site is used with permission.
Log in using your username and password
- Search More Search for this keyword Advanced search
- Latest content
- Current issue
- Write for Us
- BMJ Journals More You are viewing from: Google Indexer
You are here
- Volume 21, Issue 1
- What is a case study?
- Article Text
- Article info
- Citation Tools
- Rapid Responses
- Article metrics
- Roberta Heale 1 ,
- Alison Twycross 2
- 1 School of Nursing , Laurentian University , Sudbury , Ontario , Canada
- 2 School of Health and Social Care , London South Bank University , London , UK
- Correspondence to Dr Roberta Heale, School of Nursing, Laurentian University, Sudbury, ON P3E2C6, Canada; rheale{at}laurentian.ca
https://doi.org/10.1136/eb-2017-102845
Statistics from Altmetric.com
Request permissions.
If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.
What is it?
Case study is a research methodology, typically seen in social and life sciences. There is no one definition of case study research. 1 However, very simply… ‘a case study can be defined as an intensive study about a person, a group of people or a unit, which is aimed to generalize over several units’. 1 A case study has also been described as an intensive, systematic investigation of a single individual, group, community or some other unit in which the researcher examines in-depth data relating to several variables. 2
Often there are several similar cases to consider such as educational or social service programmes that are delivered from a number of locations. Although similar, they are complex and have unique features. In these circumstances, the evaluation of several, similar cases will provide a better answer to a research question than if only one case is examined, hence the multiple-case study. Stake asserts that the cases are grouped and viewed as one entity, called the quintain . 6 ‘We study what is similar and different about the cases to understand the quintain better’. 6
The steps when using case study methodology are the same as for other types of research. 6 The first step is defining the single case or identifying a group of similar cases that can then be incorporated into a multiple-case study. A search to determine what is known about the case(s) is typically conducted. This may include a review of the literature, grey literature, media, reports and more, which serves to establish a basic understanding of the cases and informs the development of research questions. Data in case studies are often, but not exclusively, qualitative in nature. In multiple-case studies, analysis within cases and across cases is conducted. Themes arise from the analyses and assertions about the cases as a whole, or the quintain, emerge. 6
Benefits and limitations of case studies
If a researcher wants to study a specific phenomenon arising from a particular entity, then a single-case study is warranted and will allow for a in-depth understanding of the single phenomenon and, as discussed above, would involve collecting several different types of data. This is illustrated in example 1 below.
Using a multiple-case research study allows for a more in-depth understanding of the cases as a unit, through comparison of similarities and differences of the individual cases embedded within the quintain. Evidence arising from multiple-case studies is often stronger and more reliable than from single-case research. Multiple-case studies allow for more comprehensive exploration of research questions and theory development. 6
Despite the advantages of case studies, there are limitations. The sheer volume of data is difficult to organise and data analysis and integration strategies need to be carefully thought through. There is also sometimes a temptation to veer away from the research focus. 2 Reporting of findings from multiple-case research studies is also challenging at times, 1 particularly in relation to the word limits for some journal papers.
Examples of case studies
Example 1: nurses’ paediatric pain management practices.
One of the authors of this paper (AT) has used a case study approach to explore nurses’ paediatric pain management practices. This involved collecting several datasets:
Observational data to gain a picture about actual pain management practices.
Questionnaire data about nurses’ knowledge about paediatric pain management practices and how well they felt they managed pain in children.
Questionnaire data about how critical nurses perceived pain management tasks to be.
These datasets were analysed separately and then compared 7–9 and demonstrated that nurses’ level of theoretical did not impact on the quality of their pain management practices. 7 Nor did individual nurse’s perceptions of how critical a task was effect the likelihood of them carrying out this task in practice. 8 There was also a difference in self-reported and observed practices 9 ; actual (observed) practices did not confirm to best practice guidelines, whereas self-reported practices tended to.
Example 2: quality of care for complex patients at Nurse Practitioner-Led Clinics (NPLCs)
The other author of this paper (RH) has conducted a multiple-case study to determine the quality of care for patients with complex clinical presentations in NPLCs in Ontario, Canada. 10 Five NPLCs served as individual cases that, together, represented the quatrain. Three types of data were collected including:
Review of documentation related to the NPLC model (media, annual reports, research articles, grey literature and regulatory legislation).
Interviews with nurse practitioners (NPs) practising at the five NPLCs to determine their perceptions of the impact of the NPLC model on the quality of care provided to patients with multimorbidity.
Chart audits conducted at the five NPLCs to determine the extent to which evidence-based guidelines were followed for patients with diabetes and at least one other chronic condition.
The three sources of data collected from the five NPLCs were analysed and themes arose related to the quality of care for complex patients at NPLCs. The multiple-case study confirmed that nurse practitioners are the primary care providers at the NPLCs, and this positively impacts the quality of care for patients with multimorbidity. Healthcare policy, such as lack of an increase in salary for NPs for 10 years, has resulted in issues in recruitment and retention of NPs at NPLCs. This, along with insufficient resources in the communities where NPLCs are located and high patient vulnerability at NPLCs, have a negative impact on the quality of care. 10
These examples illustrate how collecting data about a single case or multiple cases helps us to better understand the phenomenon in question. Case study methodology serves to provide a framework for evaluation and analysis of complex issues. It shines a light on the holistic nature of nursing practice and offers a perspective that informs improved patient care.
- Gustafsson J
- Calanzaro M
- Sandelowski M
Competing interests None declared.
Provenance and peer review Commissioned; internally peer reviewed.
Read the full text or download the PDF:
- Discounts and promotions
- Delivery and payment
Cart is empty!
Case study definition
Case study, a term which some of you may know from the "Case Study of Vanitas" anime and manga, is a thorough examination of a particular subject, such as a person, group, location, occasion, establishment, phenomena, etc. They are most frequently utilized in research of business, medicine, education and social behaviour. There are a different types of case studies that researchers might use:
• Collective case studies
• Descriptive case studies
• Explanatory case studies
• Exploratory case studies
• Instrumental case studies
• Intrinsic case studies
Case studies are usually much more sophisticated and professional than regular essays and courseworks, as they require a lot of verified data, are research-oriented and not necessarily designed to be read by the general public.
How to write a case study?
It very much depends on the topic of your case study, as a medical case study and a coffee business case study have completely different sources, outlines, target demographics, etc. But just for this example, let's outline a coffee roaster case study. Firstly, it's likely going to be a problem-solving case study, like most in the business and economics field are. Here are some tips for these types of case studies:
• Your case scenario should be precisely defined in terms of your unique assessment criteria.
• Determine the primary issues by analyzing the scenario. Think about how they connect to the main ideas and theories in your piece.
• Find and investigate any theories or methods that might be relevant to your case.
• Keep your audience in mind. Exactly who are your stakeholder(s)? If writing a case study on coffee roasters, it's probably gonna be suppliers, landlords, investors, customers, etc.
• Indicate the best solution(s) and how they should be implemented. Make sure your suggestions are grounded in pertinent theories and useful resources, as well as being realistic, practical, and attainable.
• Carefully proofread your case study. Keep in mind these four principles when editing: clarity, honesty, reality and relevance.
Are there any online services that could write a case study for me?
Luckily, there are!
We completely understand and have been ourselves in a position, where we couldn't wrap our head around how to write an effective and useful case study, but don't fear - our service is here.
We are a group that specializes in writing all kinds of case studies and other projects for academic customers and business clients who require assistance with its creation. We require our writers to have a degree in your topic and carefully interview them before they can join our team, as we try to ensure quality above all. We cover a great range of topics, offer perfect quality work, always deliver on time and aim to leave our customers completely satisfied with what they ordered.
The ordering process is fully online, and it goes as follows:
• Select the topic and the deadline of your case study.
• Provide us with any details, requirements, statements that should be emphasized or particular parts of the writing process you struggle with.
• Leave the email address, where your completed order will be sent to.
• Select your payment type, sit back and relax!
With lots of experience on the market, professionally degreed writers, online 24/7 customer support and incredibly low prices, you won't find a service offering a better deal than ours.
- Open supplemental data
- Reference Manager
- Simple TEXT file
People also looked at
Original research article, evaluation of ifnar2 and tyk2 transcripts’ prognostic role in covid-19 patients: a retrospective study.
- 1 Student Research Committee, School of Medicine, Mazandaran University of Medical Sciences, Sari, Iran
- 2 Research Center for Clinical Virology, Tehran University of Medical Science, Tehran, Iran
- 3 Gastrointestinal Cancer Research Center, Non-Communicable Diseases Institute, Mazandaran University of Medical Sciences, Sari, Iran
- 4 Central Human Immunodeficiency Virus Laboratory, Mazandaran University of Medical Sciences, Sari, Iran
- 5 Antimicrobial Resistance Research Center, Department of Infectious Diseases, School of Medicine, Mazandaran University of Medical Sciences, Sari, Iran
- 6 Medical Students Research Committee, Shahed University, Tehran, Iran
- 7 Molecular and Cell Biology Research Center, Faculty of Medicine, Mazandaran University of Medical Sciences, Sari, Iran
- 8 Department of Immunology, Faculty of Medicine, Mazandaran University of Medical Sciences, Sari, Iran
- 9 Department of Psychiatry, Roozbeh Hospital, Tehran University of Medical Sciences, Tehran, Iran
- 10 Department of Clinical Biochemistry and Genetics, Faculty of Medicine, Mazandaran University of Medical Sciences, Sari, Iran
- 11 Medical Research Center, Islamic Azad University, Tehran, Iran
Background and objectives: This study aimed to investigate the possible prognostic significance of interferon alpha–beta receptor subunit 2 (IFNAR2) and tyrosine kinase 2 (TYK2) expressions.
Methods: We conducted a retrospective study including COVID-19 adult patients. All blood samples were collected before any interventions. The expressions of IFNAR2 and TYK2 were assessed using real-time PCR in venous blood samples of 54 cases and 56 controls. The transcript quantities of IFNAR2 and TYK2 genes were assessed using a Delta-Ct method.
Results: Our findings show no significant differences in gene expression levels for IFNAR2 and TYK2 between patients who required oxygen (O2) therapy and those who did not (p-value = 0.732 and p-value = 0.629, respectively). Likewise, there were no significant differences in IFNAR2 and TYK2 expressions between patients hospitalized for less than 7 days and those hospitalized for 7 days or more (p-value = 0.455 and p-value = 0.626, respectively). We also observed a weak correlation between IFNAR2 expression and CRP (p-value = 0.045, r = 0.192). There was a negative correlation between the expression levels of IFNAR2 and TYK2 transcripts in COVID-19 patients (p-value = 0.044; partial correlation coefficient = -0.283). Additionally, IFNAR2 and TYK2 were significantly downregulated in the COVID-19 group compared to healthy subjects (p-value = 0.002 and p-value = 0.028, respectively). However, neither IFNAR2 nor TYK2 expression was significantly different between the case subgroups based on COVID-19 severity. The IFNAR2 ΔΔCt (B = -0.184, 95% CI: -0.524–0.157, p-value = 0.275) and the TYK2 ΔΔCt (B = 0.114, 95% CI: -0.268–0.496, p-value = 0.543) were not found to be significant predictors of hospitalization duration. The area under the curve (AUC) for IFNAR2 expression is 0.655 (p-value = 0.005, 95% CI: 0.554–0.757), suggesting its poor discriminative value.
Conclusion: We were unable to comment definitively on the prognostic power of IFNAR2 and TYK2 expressions in COVID-19 patients, and larger-scale studies are needed. The principal limitations of this study included the lack of longitudinal analysis and limited sample size.
1 Introduction
It is justifiable to assert that the coronavirus disease 2019 (COVID-19), caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), is currently regarded as a substantial global health threat in the 21st century ( Rahimi and Abadi, 2020 ). SARS-CoV-2 leads to a diverse spectrum of clinical outcomes ( Kaser, 2020 ). The development of severe COVID-19 in an infected individual is determined by intricate interactions between host and viral factors ( Shojaei et al., 2023 ). Finding trustworthy biomarkers to forecast disease outcomes in COVID-19 patients has attracted serious attention since the onset of the COVID-19 pandemic. These biomarkers facilitate the prioritization of resources and the triage of patients, both of which are critical when healthcare facilities are faced with the challenge of treating a substantial volume of COVID-19 patients simultaneously ( Shojaei et al., 2023 ). Multiple prognostic indicators have been proposed for COVID-19, including demographic factors, comorbidities, lung computed tomography (CT) findings, coagulation status, white blood cell counts, and inflammatory response biomarkers, such as C-reactive protein (CRP) and cytokines ( Gallo Marin et al., 2021 ). However, these studies have not yet provided a complete understanding of why some patients experience mild or asymptomatic cases of COVID-19 while others develop severe symptoms and, tragically, lose their lives ( Zeberg and Pääbo, 2020 ). In addition to these predisposing factors for the severe form of COVID-19, genetic factors can also play a role ( Zabihi Rizi et al., 2023 ).
A tyrosine kinase (TYK) belonging to the Janus Kinase family (JAK) is encoded by the TYK2 gene. These kinases play critical roles in regulating the immune system and cell growth ( Wallweber et al., 2014 ). The binding sites for type I IFN are interferon-α/β receptors 1 and 2 (IFNAR1 and IFNAR2, respectively), which are linked to the Janus Kinases TYK2 and JAK1, respectively. IFN-stimulated gene factor 3 (ISGF3) transcription factor and IRF-9, a member of the IRF family, form a heterotrimer as a result of the activation of these kinases, which results in the tyrosine phosphorylation of STAT1 and STAT2 ( Yaugel-Novoa et al., 2023 ).
The root cause of respiratory failure in SARS-CoV-2 patients is exacerbated lung inflammation brought on by dysregulated cytokines. IFN (IFN-I and IFN-II) production was impeded in COVID-19 patients with severe illness, and IFN-stimulated genes were downregulated ( Blanco-Melo et al., 2020 ; Hadjadj et al., 2020 ). Pattern recognition receptors (PRRs), including the Toll-like receptors (TLR3, TLR7, and TLR8), retinoic acid-inducible gene 1 (RIG-1), melanoma differentiation-associated protein (MDA5), and protein kinase C (PKC), interact with virus-associated molecular patterns when the virus interacts with the host cells ( Kawasaki and Kawai, 2014 ). Triggering these PRRs leads to the initiation of cellular signaling pathways that ultimately culminate in the production of IFN-I ( Fitzgerald et al., 2003 ; Thiel and Weber, 2008 ).
Some evidence showed that there was no difference in IFNAR1 concentrations between groups isolated by the severity of COVID-19, although IFNAR1 levels appeared to be inversely associated with the severity of COVID-19 ( Zhang et al., 2022 ; Yaugel-Novoa et al., 2023 ). A separate study reported that higher levels of the soluble receptor (sIFNAR2) were observed in survivors of COVID-19 compared to the group of non-survivors, which was not associated with the scrutinized IFNAR2 genetic variants ( Fricke-Galindo et al., 2022 ). According to recent research, severe instances of COVID-19 were associated with decreased expression of IFNAR2 at 21q22.1 and increased expression of a gene near TYK2 at 19p13.2 ( Pairo-Castineira et al., 2021 ).
In individuals with severe or critical COVID-19, a functional interaction of the TYK2 receptor subunit with the suppressor of cytokine signaling 1 (SOCS1) and SOCS3 has also been documented ( Johnson et al., 2020 ; Low et al., 2022 ). A study demonstrated that the expression of the TYK2 gene was reduced in COVID-19 patients compared to healthy individuals ( Akbari et al., 2022 ). Furthermore, TYK2 SNPs may be used to determine high-risk individuals for severe COVID-19 ( Zabihi Rizi et al., 2023 ). Interestingly, the presence of some alleles (T in rs2304255, A in rs12720354, and G in rs12720207) of TYK2 decreases its expression and may predict COVID-19 severity ( Zabihi Rizi et al., 2023 ).
Nevertheless, the potential of IFNAR2 and TYK2 expressions as prognostic biomarkers for COVID-19 has yet to be fully established. Comprehensive research in this area holds the promise of shedding light on the molecular mechanisms underlying the severe and critical forms of COVID-19. This knowledge could subsequently be leveraged for therapeutic purposes to enhance patient survival rates ( Baillie, 2014 ). Through the conduct of these studies, we aim to make a valuable contribution to ongoing biomedical research endeavors aimed at combating SARS-CoV-2. Additionally, our findings can guide current genetic and genomic research, facilitating further exploration of candidate gene variants that may assist in stratifying individuals based on their risk levels. In this retrospective research, we delve into the prognostic role of IFNAR2 and TYK2 expressions in the progression of COVID-19 disease.
2.1 Study design and participants
We conducted a retrospective study involving 56 adult patients diagnosed with COVID-19, who were referred to Imam Khomeini Hospital in Sari in 2022. The diagnosis was confirmed by assessing nasopharyngeal swab samples. At the time of admission to triage, peripheral blood was collected from patients who had a positive reverse transcription-polymerase chain reaction (RT-PCR) test for SARS-CoV-2. All blood samples were collected before any interventions. Patients with a history of hypertension, autoimmune diseases, malignancies, asthma, chronic kidney disease, any congenital immune system defects, liver cirrhosis, hepatitis, hepatitis vaccination, and those using medications that affect IFNAR2 and TYK2 genes, were excluded. Control specimens were obtained in equal quantities from unaffected individuals without any underlying disorders. The study protocol received approval from the Ethical Committee of Mazandaran University of Medical Sciences (IR.MAZUMS.REC.1400.10406). Informed consent was acquired from all patients and controls. Laboratory parameters were collected from all patients. The sample size for both groups, comprising 56 individuals with COVID-19 and 56 controls, was determined based on an α = 0.05, a 90% power, and β = 0.1 and p1 = 0.34 and p2 = 0.66 (according to the risk allele frequency reported by Pairo-Castineira et al. (2021) for the IFNAR2) by STATA software (Version 12.0; Stata Corporation, Lakeway, TX, USA).
2.2 Definition of COVID-19 severity
We adopted a modified version of the COVID-19 severity definition provided by the CDC ( https://www.covid19treatmentguidelines.nih.gov/overview/clinical-spectrum ). In this revised definition, COVID-19 disease is characterized by the presence of symptoms typically associated with COVID-19, such as fever and sore throat, along with a positive SARS-CoV-2 detection using a virus nucleic acid amplification assay (qPCR). A patient with confirmed COVID-19 (as diagnosed by the admitting clinician) who did not require hospitalization was classified as having a mild disease. ‘Moderate’ disease was defined as the need for hospitalization due to COVID-19, and ‘severe’ disease was characterized by the necessity of mechanical ventilation in an intensive care unit ( Shojaei et al., 2023 ).
2.3 Experiments
Two samples of 2 mL of venous whole blood in EDTA tubes (Liuyang SANLI Medical Technology Development Co, LTD, Liuyang, China) were obtained from patients who had the RT-PCR test for SARS-CoV-2 at the time of admission to triage. Blood samples were collected prior to any interventions. Finally, 300 μL of venous whole blood was utilized from all patients and healthy controls. Subsequently, total RNA was extracted from whole-blood samples using the Total RNA mini kit purification (FAVORGEN Biotech Co, Taiwan) in three primary steps: lysis, filtration, and washing following the manufacturer’s instructions. The extracted RNA samples (extracted from white blood cells and platelets) were then stored at −80°C. A NanoDrop1000 spectrophotometer (Biochrom, Cambridge, UK) was used to assess the quality and quantity of RNA. The purity of RNA was determined by comparing the absorbance at 260 nm and 280 nm. In general, RNA is considered to be “pure” with a ratio of around 2.0. Subsequently, complementary DNA (cDNA) was reverse-transcribed from these DNA-free RNA using the Yektatajhiz cDNA synthesis kit (Iran) based on the manufacturer’s instructions. Real-time PCR was conducted using real-time PCR Master Mix with SYBER Green (Amplicon, Odense, Denmark) on synthesized cDNA, IFNAR2 (FW: ATGATTCGCCTGATTACACA; RV: ACAGTTCTTAACCACCTTCAA), and TYK2 (FW: CCATCATTCCGCACCATC; RV: GGATCGTAGCAGTACAAGC). GAPDH (FW: GTCTCCTCTGACTTCAACAGCG; RV: ACCACCCTGTTGCTGTAGCCAA) was utilized as the internal control ( Figure 1 ). Transcript quantities of IFNAR2 and TYK2 genes were assessed using a Delta-Ct (ΔCt) method. To validate and visualize the results obtained from real-time PCR, gel electrophoresis (Bio-Rad, Hercules, CA, USA) was used as detailed in the Supplementary Methods .
Figure 1 Summary of the steps of performing the executive method in the evaluation of IFNAR2 and TYK2 gene expressions.
2.4 Statistical analysis
Descriptive statistics were employed to summarize demographic and clinical characteristics. For continuous variables, normality was assessed using the One-Sample Kolmogorov–Smirnov. The results were reported as either mean ± standard deviation (SD) when normality assumptions were met, and median ± interquartile range (IQR) if normality assumptions were violated. Pearson’s correlation coefficient (r) was used to measure the statistical association between variables. The interpretation of Pearson’s correlation coefficients was informed by the study conducted by Chan et al. ( Chan, 2003 ). If needed, partial correlation was used to eliminate confounding effects. One-way ANOVA or a two-tailed Student’s t -test was used to analyze data when they exhibited a normal distribution. Alternatively, when the data did not follow a normal distribution, the Kruskal–Wallis test was utilized. Fisher’s exact test was employed to ascertain non-random associations between two categorical variables. Linear regression analysis was applied to model the relationship between a dependent variable and multiple independent variables, aiming to predict the outcome of the dependent variable. K-means clustering analysis was utilized to group similar data points in a process known as clustering. To evaluate the diagnostic efficacy of IFNAR2 ΔΔCt and TYK2 ΔΔCt (IFNAR2 and TYK2 expressions), we conducted a receiver operating characteristic (ROC) curve analysis. All statistical analyses were carried out using SPSS version 20 (SPSS Inc., version 20, Chicago, IL, USA), with a significance level set at 0.05.
Our cohort comprised 56 control subjects, accounting for 50.9% of the total, and 54 cases, representing 49.1%. Two patients were excluded from the analysis (one due to being in the critical group and another in the asymptomatic group in terms of the severity of COVID-19). Among the cases, they were further categorized into mild ( n = 22, 20.0%), moderate ( n = 21, 19.1%), and severe ( n = 11, 10.0%) subgroups. No statistically significant differences were detected among the groups regarding the distribution of sex, with 52 females (47.3%) and 58 males (52.7%) ( Table 1 , p = 0.840), or in terms of age, with means of 42.30 ± 17.70 and 46.22 ± 13.88, respectively, ( Table 1 , p -value = 0.200). The BMI values for the mild, moderate, and severe subgroups were 28.19 ± 5.46, 28.62 ± 4.19, and 29.11 ± 6.71, respectively. Importantly, there were no significant differences observed among these subgroups ( p = 0.895). Among the 23 patients (20.9%), a history of COVID-19 was reported. The mean interval between the last vaccine dose and sample collection was 105.75 ± 80.568 days, with a range of 10 to 365 days. Among the subjects, 91 (82.7%) had a positive vaccination status, with Sinopharm being the most prevalent vaccine type ( n = 54, 58.9%). A total of 85 individuals (93.4%) had received more than one vaccine dose. Comorbidities were present in 22 patients (40.7%), including hypothyroidism ( n = 8, 14.8%), hyperlipidemia ( n = 3, 5.6%), diabetes ( n = 4, 7.4%), cardiovascular diseases ( n = 3, 5.6%), and other types ( n = 3). The CT scans showed normal results in 22 patients, while lung involvement was as follows: <25% in 8 patients (15.4%), 25–50% in 19 patients (36.5%), and >50% in 3 patients (5.8%).
Table 1 Demographics, history of vaccination, COVID-19 signs and symptoms, and treatments.
Out of the 54 patients, 36 (66.7%) had a fever, 32 (59.3%) had a cough, 20 (37.0%) experienced myalgia, and 28 (51.9%) reported chills. The most common antiviral drug used was remdesivir, administered to 30 patients (27.3%), while the most common anti-inflammatory drug was dexamethasone, prescribed to 37 patients (33.6%). In terms of respiratory support, 26 patients (54.2%) did not require any support, while 12 patients (25.0%) needed a reservoir bag, 6 patients (12.5%) required a nasal catheter, and 4 patients (8.3%) were provided with an oxygen mask.
The mean hospitalization duration was 6.26 ± 2.58 days, with a range of 0 to 11 days. Regarding gene expression levels, there was a negligible difference for both IFNAR2 and TYK2 between patients who received oxygen therapy and those who did not require it ( p -value = 0.708 and p -value = 0.729, respectively, Figure 2 ). The level of expression in both the IFNAR2 and TYK2 genes did not significantly differ between patients hospitalized for less than 7 days and those hospitalized for ≥7 days ( p -value = 0.618 and p -value = 0.822, respectively, Figure 3 ). We analyzed the correlation between the expression levels of IFNAR2 and TYK2 and demographic and clinical data. Our findings show a weak correlation between the expressions of IFNAR2 and CRP ( p -value = 0.045, r = 0.192). After adjusting for potential confounding factors (age, sex, and history of COVID-19 vaccination injection), we observed a negative correlation between the expression levels of IFNAR2 and TYK2 transcripts in COVID-19 patients ( p -value = 0.044; partial correlation coefficient = -0.283). However, in healthy individuals, after controlling for the same confounders, there was no significant correlation between the expression of IFNAR2 and TYK2 transcripts ( p -value = 0.112; partial correlation coefficient = -0.221). The ΔCt and ΔΔCt for IFNAR2 were significantly higher in the case group compared to the control group [6.29 vs . 3.99, p -value = 0.002; 2.03 vs . 1 × 10 −15 , p -value = 0.002, respectively, ( Table 2 )], suggesting lower gene expression in the case group. The ΔCt and ΔΔCt levels for TYK2 were notably higher in the COVID-19 patients than in the controls [9.02 vs . 7.79, p -value = 0.028; 1.23 vs . 2.8571 × 10 −10 , p -value = 0.028, respectively, ( Table 2 )], suggesting decreased gene expression in the COVID-19 patients. However, there was no significant difference in gene expressions for both IFNAR2 and TYK2 among the subgroups of the case group (mild, moderate, and severe) ( Table 3 , p -value > 0.05). Our combined gene expression cluster analysis for IFNAR2 and TYK2 showed 2 clusters ( Table 4 ). A linear regression analysis was conducted to predict hospitalization duration based on the IFNAR2 ΔΔCt and TYK2 ΔΔCt values. Surprisingly, the results indicated that neither the IFNAR2 ΔΔCt (B = -0.184, 95% CI: -0.524–0.157, p -value = 0.275) nor the TYK2 ΔΔCt (B = 0.114, 95% CI: -0.268–0.496, p -value = 0.543) were significant predictors of hospitalization duration.
Figure 2 Expressions of IFNAR2 and TYK2 transcripts among COVID-19 patients who received oxygen(O2) therapy (n = 22) and those who did not require it (n = 27). TYK2 2 −ΔΔCt values in the patients who received O2 and the group that did not need O2 were 14.57 ± 21.85 and 17.55 ± 34.98, respectively. IFNAR2 2 −ΔΔCt values in the patients who received O2 and the group that did not need O2 were 2.13 ± 4.29 and 2.68 ± 5.61, respectively. A two-tailed t-test was used to compare between two groups. Mild outliers are marked with a circle (O) and extreme outliers are marked with a star (*).
Figure 3 Expressions of IFNAR2 and TYK2 transcripts among COVID-19 patients hospitalized for less than 7 days (n = 41) and those hospitalized for ≥ 7 days (n = 10). TYK2 2 −ΔΔCt values in the patients with hospitalization duration < 7 days and those hospitalized for ≥ 7 days were 16.47 ± 30.38 and 14.12 ± 24.27, respectively. IFNAR2 2 −ΔΔCt values in the patients with hospitalization duration < 7 days and those hospitalized for ≥ 7 days were 1.86 ± 4.64 and 2.67 ± 4.13, respectively. A two-tailed t-test was used to compare between two groups. Mild outliers are marked with a circle (O) and extreme outliers are marked with a star (*).
Table 2 Comparison of ΔCt, ΔΔCt, and 2 −ΔΔCt between the case and control groups.
Table 3 Comparison of ΔCt, ΔΔCt, and 2 −ΔΔCt among mild, moderate, and severe groups.
Table 4 Combined gene expression cluster analysis of ΔΔCt of both IFNAR2 and TYK2.
The ROC curve for IFNAR2 ΔΔCt showed an area under the curve (AUC) of 0.655 ( p -value = 0.005, 95% CI: 0.554–0.757, Figure 4 ). In contrast, the ROC curve for TYK2 ΔΔCt yielded an AUC of 0.602, which was not statistically significant ( p -value = 0.066, 95% CI: 0.495–0.708, Figure 4 ). The IFNAR2 ΔΔCt = −0.21 demonstrated a sensitivity of 0.75 and specificity of 0.51. Moreover, the TYK2 ΔΔCt = −0.126 showed a sensitivity of 0.55 and a specificity of 0.55. Additionally, ROC analysis was repeated based on the level of CRP among two groups of patients with positive and negative CRP levels. ROC curve assessed prognostic power of TYK2 ΔΔCt in patients with negative CRP showed an AUC of 0.340 ( p -value=0.356, CI: 0.000-0.763). Also, it showed an AUC of 0.781 ( p -value=0.025, CI: 0.619-0.943) for patients with positive levels of CRP.
Figure 4 ROC curves showing the prognostic power of IFNAR2 and TYK2 expressions in COVID-19.
4 Discussion
The global impact of the COVID-19 pandemic since 2019 has resulted in significant morbidity and mortality worldwide ( Ciotti et al., 2020 ). Extensive research has investigated the interplay between genetic factors and COVID-19 susceptibility and severity. Among the key determinants of disease progression, cytokines play a crucial role, and variations in these factors are closely linked to the severity and outcomes of COVID-19 cases ( Akbari et al., 2020 ). The heightened susceptibility of certain individuals to severe respiratory infections has been distinctly associated with specific genetic variants. Host genetic variants have been linked to disruptions in vital immune response proteins during COVID-19 pathogenesis ( Choudhary et al., 2021 ). These disruptions can lead to severe symptoms in susceptible individuals. Our study explores the possible role of two genes in shaping COVID-19 prognosis.
Genome-wide association studies (GWASs) focusing on SARS-CoV-2 infection dynamics have significantly illuminated the potential involvement of IFNAR2 and TYK2 ( Ma et al., 2021 ; Aghamirli and Saleh-Gohari, 2023 ). A higher expression of IFNAR2 was linked to a reduced probability of critical COVID-19, and TYK2 expression had a role in regulating IFNAR signaling ( Velavan et al., 2021 ). Our findings also demonstrate a significant reduction in the expression levels of IFNAR2 and TYK2 among COVID-19 patients. Despite the recognized role of IFNs in reducing viral replication through IFN receptor signaling, it is perplexing that severe COVID-19 cases exhibit significantly lower IFN levels compared to other viral infections ( Hadjadj et al., 2020 ). This scenario could underscore the strategies employed by coronaviruses, which are adept at concealing viral RNA from pattern recognition receptors, allowing for covert replication. These viruses bind to specific proteins that hinder IFN responses, evade detection, or directly inhibit IFNAR signaling ( Acharya et al., 2020 ). TYK2, a crucial cytokine receptor-associated kinase, notably emerges as an essential for IFNAR signaling in this regulatory network ( Velavan et al., 2021 ). These genes have also gained clinical interest as potential targets for COVID-19 treatment. Several clinical trials have investigated the role of glucocorticoids in treating COVID-19 at its early stages, and glucocorticoids are capable of inhibiting IFNAR signaling. On the other hand, baricitinib is a Janus kinase (JAK) 1/2 inhibitor with the potential to inhibit TYK2. Both baricitinib and tocilizumab are recommended for COVID-19 treatment. Recent meta-analyses indicate no difference in mortality reduction between the two drugs; however, adverse reactions following baricitinib might be significantly fewer than tocilizumab ( Zhang et al., 2023 ; Albuquerque et al., 2023 ). However, this evidence contradicts the findings of the study by Akbari et al., where no significant difference in IFNAR2 expression was observed between the controls and cases, and TYK2 expression was only significantly lower in males ( Akbari et al., 2022 ). In the study by Akbari et al., the reported AUC was 0.53 for IFNAR1 and 0.58 for TYK2, resulting in a combined AUC of 0.57 for both genes, which did not reach statistical significance. The contrasting findings may be attributed to variations in sampling methodologies and laboratory protocols. Furthermore, various conditions and factors, including diseases and medications, have the potential to influence IFNAR2 and TYK2 expressions. Additionally, a limited sample size might have had an impact on these findings and further studies with a larger population would yield different values of AUCs.
Evidence highlighting the significance of IFNAR2’s role in COVID-19 severity spans various studies, ranging from genetic and transcriptional levels to soluble protein dynamics. Associations between the IFNAR2 locus and COVID-19 severity have been identified through various GWAS and multi-omic analyses ( Akter et al., 2022 ). Despite ongoing controversies, the interaction between various cytokines, including IFN, and their impact on COVID-19 severity and clinical outcomes remains apparent. Fricke-Galindo et al. reported a connection between reduced IFNAR2 expression and severe COVID-19 in their study ( Fricke-Galindo et al., 2022 ). This observation is corroborated by the notable decrease in sIFNAR2 levels among non-survivors. Patients who did not require invasive mechanical ventilation had higher sIFNAR2 levels compared to those who did, and the sIFNAR2 levels showed a weak correlation with the duration of invasive mechanical ventilation. Another study examining IFNAR2 single-nucleotide variants revealed their association with clinical outcomes, particularly in severe cases. Survivors and non-survivors exhibited distinct expression profiles ( Dieter et al., 2022 ). The recent study by Yaugel-Novoa reported no significant difference between IFNAR1 concentrations among COVID-19 groups based on severity; however, the IFNAR2 concentration was significantly related to more severe COVID-19. This article suggests that some of the discrepancies among different studies might be attributed to the difference between isoforms of IFNAR2 as it has been suggested that the soluble isoform is linked to impairment of the immune system in combating the coronavirus through IFNAR signaling ( Yaugel-Novoa et al., 2023 ). Our study reveals no significant difference in IFNAR2 and TYK2 expressions among three COVID-19 subgroups, including mild, moderate, and severe COVID-19. We were focused on IFNAR2 expression, and measuring IFNAR2 isoforms was not our objective. Future research focusing on post-transcriptional modifications in IFNAR signaling could fill current gaps and also hints at research on IFNAR2 expression among COVID-19 patients. The small number of cases and controls might have had an impact on the significance level resulting in our study. Despite discrepancies in findings regarding the downregulation of IFNAR2 and TYK2 in COVID-19 patients, the importance of these genes in the pathogenesis of COVID-19 remains prominent.
The expressions of both IFNAR2 and TYK2 showed no significant association with the need for oxygen therapy or hospitalization exceeding seven days. It is worth noting that the correlation between IFNAR2 expression and CRP levels appeared to be relatively weak. However, the reported AUCs in our study (0.65 for IFNAR2 and 0.60 for TYK2) indicated statistical significance, but only for IFNAR2. It also should be noted that despite this significant p -value, the AUCs in our study were not at the level to conclude the strong prognostic role of these genes. Therefore, the results of this study need to be interpreted cautiously regarding poor discrimination of AUC values due to the small sample size. The findings by Akbari et al. showed no significant difference in the expression levels of IFNAR1 and TYK2 between individuals requiring ICU admission due to severe COVID-19 and those who did not. Although the AUCs for IFNAR1 and TYK2 were reported as 0.49 and 0.59, respectively, the combined analysis resulted in an AUC of 0.57, but none of these reached statistical significance ( Akbari et al., 2022 ). Another study by Zabihi Rizi et al. demonstrated an association between TYK2 single-nucleotide variants and COVID-19 severity, as indicated by significant outcomes in ROC analysis ( Zabihi Rizi et al., 2023 ). In a large-scale GWAS conducted by Pairo-Castineira et al., utilizing Mendelian randomization methods, they found that a low expression of IFNAR2 and a high expression of TYK2 both contribute to the severity of COVID-19 ( Pairo-Castineira et al., 2021 ). While our findings align with the studies mentioned, they do not support the up-regulation of TYK2. This controversy could be attributed to the difference in sample size and ethnicity between populations. However, impaired IFNAR signaling and low IFNAR2 expression appear to be related to the severity of COVID-19, as supported by various studies. These findings highlight the importance of IFNAR2 expression both in the complex puzzle of COVID-19 pathogenesis and also in the clinical context to understand its possible prognosis and potential therapeutic implications.
Based on our findings, the negative correlation between IFNAR2 and TYK2 expression levels, even after adjusting for confounding factors, highlights their potential role in COVID-19 pathogenesis. These genes are likely involved in similar biological pathways or regulatory networks. This discovery from the current study warrants investigation within the JAK-STAT signaling pathway.
We showed that both IFNAR2 ΔΔCt and TYK2 ΔΔCt are insignificant predictors of hospitalization duration. In other words, changes in these gene expression levels do not reliably predict how long a patient with COVID-19 will be hospitalized. These findings suggest that other factors beyond IFNAR2 and TYK2 expression may be important in determining hospitalization duration for COVID-19 patients.
To determine whether CRP can impact the prognosis of COVID-19 in conjunction with the expression of two specific genes, we separated the study participants into two groups - one with positive CRP levels and one with negative CRP levels, based on the reference laboratory. Although the AUC of TYK2 ΔΔCt was 0.781 in positive CRP subjects and 0.340 in negative CRP subjects, there was no significant difference due to overlapping confidence intervals. Some findings from a subgroup analysis of Wuhan research showed CRP can be considered a dependable predictor of adverse outcomes in COVID-19 patients with different disease severity (AUC 0.832, z=10.23, p<0.001; AUC 0.989, z=44.04, p<0.001). On admission, CRP was a strong predictor of severe/critical illness (AUC 0.783, z=10.69, p<0.001) ( Luo et al., 2020 ). The discrepancy in the results can be attributed to differences in the study design and statistical analysis methods used.
While our study yields significant findings regarding COVID-19 prognosis, it is essential to acknowledge a few limitations. Despite diligent efforts to minimize confounding factors, fully eliminating them proved to be a challenging task. While our stringent inclusion criteria were designed to enroll cases and controls without underlying diseases or drug consumption, the prevailing circumstances of the Omicron pandemic required us to consider individuals with prior infection or vaccination. Additionally, the study population was limited. Despite precisely calculating the number of cases and controls based on appropriate statistical methods, conducting large-scale studies could bring a better understanding of these genes’ prognostic roles. Furthermore, the absence of a follow-up phase and the lack of survival analysis represent additional potential limitations. Other studies might consider studying the dynamic changes of gene expression across severity or intervention using longitudinal samples. Also, conducting studies to investigate the loss of function mutations in these genes or studies at the protein level would be an interesting topic for future investigators since our objective was limited to the RNA level. Nevertheless, this study makes a valuable contribution to our understanding of COVID-19 pathogenesis, shedding light on the genetic factors that significantly influence prognosis.
5 Conclusions
This study determines that there were no significant gene expression differences for IFNAR2 and TYK2 among patients requiring oxygen therapy or differing hospitalization durations. A significant finding emerged when comparing COVID-19 patients with controls, which demonstrated lower gene expressions of IFNAR2 and TYK2 in COVID-19 cases. However, when conducting an analysis of different severity subgroups within the cases, no significant gene expression variations were observed. Importantly, the analysis of the study produced a significant AUC value of 0.655 for IFNAR2 expression, signifying its poor discriminative value, and TYK2 expression’s AUC of 0.602 did not reach statistical significance.
Data availability statement
The original contributions presented in the study are included in the article/ Supplementary Material . Further inquiries can be directed to the corresponding author.
Ethics statement
The studies involving humans were approved by Ethics Committee of Mazandaran University of Medical Sciences (IR.MAZUMS.REC.1400.10406). The studies were conducted in accordance with the local legislation and institutional requirements. The human samples used in this study were acquired from primarily isolated as part of your previous study for which ethical approval was obtained. Written informed consent for participation was not required from the participants or the participants’ legal guardians/next of kin in accordance with the national legislation and institutional requirements. Written informed consent has been obtained from the patient(s) to publish this paper.
Author contributions
AR: Conceptualization, Formal analysis, Investigation, Methodology, Supervision, Writing – original draft, Writing – review & editing. MR: Conceptualization, Investigation, Writing – original draft. YH: Investigation, Writing – original draft. GC: Investigation, Writing – original draft. YG: Investigation, Writing – original draft. RG: Investigation, Writing – original draft. RA-N: Conceptualization, Formal analysis, Investigation, Supervision, Writing – review & editing. HY: Investigation, Writing – original draft, Writing – review & editing. MS: Writing – review & editing. MT: Formal analysis, Writing – original draft. RV: Investigation, Writing – original draft. FM: Investigation, Writing – original draft. AT: Conceptualization, Investigation, Supervision, Writing – review & editing. BR: Investigation, Writing – original draft.
The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This study was supported by Mazandaran University of Medical Sciences (IR.MAZUMS.REC.1400.10406).
Acknowledgments
We would like to extend our heartfelt gratitude to Mohammad Bagher Hashemi-Soteh, Omolbanin Amjadi, and Amir Shamshirian.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
The author(s) declared that they were an editorial board member of Frontiers, at the time of submission. This had no impact on the peer review process and the final decision.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fcimb.2024.1356542/full#supplementary-material
Acharya, D., Liu, G., Gack, M. U. (2020). Dysregulation of type I interferon responses in COVID-19. Nat. Rev. Immunol. 20, 397–398. doi: 10.1038/s41577-020-0346-x
PubMed Abstract | CrossRef Full Text | Google Scholar
Aghamirli, S. S., Saleh-Gohari, N. (2023). ACE2, TMPRSS2, TYK2, SLC6A20, and IFNAR2 human genes variants influence SARS−CoV−2 infection susceptibility. Authorea Preprints doi: 10.22541/au.169035663.39913026/v1
CrossRef Full Text | Google Scholar
Akbari, H., Tabrizi, R., Lankarani, K. B., Aria, H., Vakili, S., Asadian, F., et al. (2020). The role of cytokine profile and lymphocyte subsets in the severity of coronavirus disease 2019 (COVID-19): a systematic review and meta-analysis. Life Sci. 258, 118167. doi: 10.1016/j.lfs.2020.118167
Akbari, M., Akhavan-Bahabadi, M., Shafigh, N., Taheriazam, A., Hussen, B. M., Sayad, A., et al. (2022). Expression analysis of IFNAR1 and TYK2 transcripts in COVID-19 patients. Cytokine 153, 155849. doi: 10.1016/j.cyto.2022.155849
Akter, S., Roy, A. S., Tonmoy, M. I. Q., Islam, M. S. (2022). Deleterious single nucleotide polymorphisms (SNPs) of human IFNAR2 gene facilitate COVID-19 severity in patients: a comprehensive in silico approach. J. Biomol. Struct. Dyn. 40, 11173–11189. doi: 10.1080/07391102.2021.1957714
Albuquerque, A. M., Eckert, I., Tramujas, L., Butler-Laporte, G., McDonald, E. G., Brophy, J. M., et al. (2023). Effect of tocilizumab, sarilumab, and baricitinib on mortality among patients hospitalized for COVID-19 treated with corticosteroids: a systematic review and meta-analysis. Clin. Microbiol. Infect. 29, 13–21. doi: 10.1016/j.cmi.2022.07.008
Available online at: https://www.covid19treatmentguidelines.nih.gov/overview/clinical-spectrum .
Google Scholar
Baillie, J. K. (2014). Targeting the host immune response to fight infection. Science 344, 807–808. doi: 10.1126/science.1255074
Blanco-Melo, D., Nilsson-Payant, B. E., Liu, W.-C., Uhl, S., Hoagland, D., Møller, R., et al. (2020). Imbalanced host response to SARS-CoV-2 drives development of COVID-19. Cell 181, 1036–45.e9. doi: 10.1016/j.cell.2020.04.026
Chan, Y. (2003). Biostatistics 104: correlational analysis. Singapore Med. J. 44, 614–619. doi: 10.12691/ajmsm-5-4-3
Choudhary, S., Sreenivasulu, K., Mitra, P., Misra, S., Sharma, P. (2021). Role of genetic variants and gene expression in the susceptibility and severity of COVID-19. Ann. Lab. Med. 41, 129. doi: 10.3343/alm.2021.41.2.129
Ciotti, M., Ciccozzi, M., Terrinoni, A., Jiang, W.-C., Wang, C.-B., Bernardini, S. (2020). The COVID-19 pandemic. Crit. Rev. Clin. Lab. Sci. 57, 365–388. doi: 10.1080/10408363.2020.1783198
Dieter, C., de Almeida Brondani, L., Lemos, N. E., Schaeffer, A. F., Zanotto, C., Ramos, D. T., et al. (2022). Polymorphisms in ACE1, TMPRSS2, IFIH1, IFNAR2, and TYK2 genes are associated with worse clinical outcomes in COVID-19. Genes 14, 29. doi: 10.3390/genes14010029
Fitzgerald, K. A., McWhirter, S. M., Faia, K. L., Rowe, D. C., Latz, E., Golenbock, D. T., et al. (2003). IKKϵ and TBK1 are essential components of the IRF3 signaling pathway. Nat. Immunol. 4, 491–496. doi: 10.1038/ni921
Fricke-Galindo, I., Martínez-Morales, A., Chávez-Galán, L., Ocaña-Guzmán, R., Buendía-Roldán, I., Pérez-Rubio, G., et al. (2022). IFNAR2 relevance in the clinical outcome of individuals with severe COVID-19. Front. Immunol. 13, 949413. doi: 10.3389/fimmu.2022.949413
Gallo Marin, B., Aghagoli, G., Lavine, K., Yang, L., Siff, E. J., Chiang, S. S., et al. (2021). Predictors of COVID-19 severity: a literature review. Rev. Med. Virol. 31, 1–10. doi: 10.1002/rmv.2146
Hadjadj, J., Yatim, N., Barnabei, L., Corneau, A., Boussier, J., Smith, N., et al. (2020). Impaired type I interferon activity and inflammatory responses in severe COVID-19 patients. Science 369, 718–724. doi: 10.1126/science.abc6027
Johnson, H. M., Lewin, A. S., Ahmed, C. M. (2020). SOCS, intrinsic virulence factors, and treatment of COVID-19. Front. Immunol. 11, 582102. doi: 10.3389/fimmu.2020.582102
Kaser, A. (2020). Genetic risk of severe Covid-19. Mass Med. Soc; p, 1590–1591. doi: 10.1056/NEJMe2025501
Kawasaki, T., Kawai, T. (2014). Toll-like receptor signaling pathways. Front. Immunol. 5, 461. doi: 10.3389/fimmu.2014.00461
Low, Z. Y., Wen Yip, A. J., Chow, V. T., Lal, S. K. (2022). The Suppressor of Cytokine Signalling family of proteins and their potential impact on COVID-19 disease progression. Rev. Med. Virol. 32, e2300. doi: 10.1002/rmv.2300
Luo, X., Zhou, W., Yan, X., Guo, T., Wang, B., Xia, H., et al. (2020). Prognostic value of C-reactive protein in patients with coronavirus 2019. Clin. Infect. Dis. 71, 2174–2179. doi: 10.1093/cid/ciaa641
Ma, Y., Huang, Y., Zhao, S., Yao, Y., Zhang, Y., Qu, J., et al. (2021). Integrative genomics analysis reveals a 21q22. 11 locus contributing risk to COVID-19. Hum. Mol. Genet. 30, 1247–1258. doi: 10.1093/hmg/ddab125
Pairo-Castineira, E., Clohisey, S., Klaric, L., Bretherick, A. D., Rawlik, K., Pasko, D., et al. (2021). Genetic mechanisms of critical illness in COVID-19. Nature 591, 92–98. doi: 10.1038/s41586-020-03065-y
Rahimi, F., Abadi, A. T. B. (2020). Practical strategies against the novel coronavirus and COVID-19—the imminent global threat. Arch. Med. Res. 51, 280–281. doi: 10.1016/j.arcmed.2020.03.005
Shojaei, M., Shamshirian, A., Monkman, J., Grice, L., Tran, M., Tan, C. W., et al. (2023). IFI27 transcription is an early predictor for COVID-19 outcomes, a multi-cohort observational study. Front. Immunol. 13, 1060438. doi: 10.3389/fimmu.2022.1060438
Thiel, V., Weber, F. (2008). Interferon and cytokine responses to SARS-coronavirus infection. Cytokine Growth Factor Rev. 19, 121–132. doi: 10.1016/j.cytogfr.2008.01.001
Velavan, T. P., Pallerla, S. R., Rüter, J., Augustin, Y., Kremsner, P. G., Krishna, S., et al. (2021). Host genetic factors determining COVID-19 susceptibility and severity. EBioMedicine 72, 103629. doi: 10.1016/j.ebiom.2021.103629
Wallweber, H. J., Tam, C., Franke, Y., Starovasnik, M. A., Lupardus, P. J. (2014). Structural basis of recognition of interferon-α receptor by tyrosine kinase 2. Nat. Struct. Mol. Biol. 21, 443–448. doi: 10.1038/nsmb.2807
Yaugel-Novoa, M., Bourlet, T., Longet, S., Botelho-Nevers, E., Paul, S. (2023). Association of IFNAR1 and IFNAR2 with COVID-19 severity. Lancet Microbe . 6, e487 doi: 10.1016/S2666-5247(23)00095-2
Zabihi Rizi, F., Ghorbani, A., Zahtab, P., Darbaghshahi, N. N., Ataee, N., Pourhamzeh, P., et al. (2023). TYK2 single-nucleotide variants associated with the severity of COVID-19 disease. Arch. Virol. 168, 119. doi: 10.1007/s00705-023-05729-2
Zeberg, H., Pääbo, S. (2020). The major genetic risk factor for severe COVID-19 is inherited from Neanderthals. Nature 587, 610–612. doi: 10.1038/s41586-020-2818-3
Zhang, J., Fan, X., Zhang, X., Jiang, F., Wu, Y., Yang, B., et al. Efficacy and safety of tocilizumab and baricitinib among patients hospitalized for COVID-19: a systematic review and meta-analysis. Front. Pharmacol. (2023) 14, 1293331. doi: 10.3389/fphar.2023.1293331
Zhang, Q., Bastard, P., Cobat, A., Casanova, J.-L. (2022). Human genetic and immunological determinants of critical COVID-19 pneumonia. Nature 603, 587–598. doi: 10.1038/s41586-022-04447-0
Keywords: coronavirus disease 2019, interferon alpha-beta receptor IFNAR2 subunit, prognostic factor, SARS coronavirus 2, tyrosine kinase
Citation: Razavi A, Raei M, Hatami Y, Chokami GS, Goudarzi Y, Ghasemian R, Alizadeh-Navaei R, Yarmohammadi H, Soltanipur M, Tabarestani M, Valadan R, Meshkinfam Haghighi F, Tarsi AK and Razavi B (2024) Evaluation of IFNAR2 and TYK2 transcripts’ prognostic role in COVID-19 patients: a retrospective study. Front. Cell. Infect. Microbiol. 14:1356542. doi: 10.3389/fcimb.2024.1356542
Received: 15 December 2023; Accepted: 12 April 2024; Published: 29 April 2024.
Reviewed by:
Copyright © 2024 Razavi, Raei, Hatami, Chokami, Goudarzi, Ghasemian, Alizadeh-Navaei, Yarmohammadi, Soltanipur, Tabarestani, Valadan, Meshkinfam Haghighi, Tarsi and Razavi. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) . The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Abbas Khonakdar Tarsi, [email protected]
IMAGES
VIDEO
COMMENTS
A case study is a detailed study of a specific subject, such as a person, group, place, event, organization, or phenomenon. It involves qualitative and/or quantitative methods to describe, compare, evaluate and understand different aspects of the research problem. Learn how to do a case study with steps, tips and examples.
Definition of a case study. A case study in qualitative research is a strategy of inquiry that involves an in-depth investigation of a phenomenon within its real-world context. It provides researchers with the opportunity to acquire an in-depth understanding of intricate details that might not be as apparent or accessible through other methods ...
A case study is an in-depth, detailed examination of a particular case (or cases) within a real-world context. For example, case studies in medicine may focus on an individual patient or ailment; case studies in business might cover a particular firm's strategy or a broader market; similarly, case studies in politics can range from a narrow happening over time like the operations of a specific ...
A case study is a research method that involves an in-depth examination and analysis of a particular phenomenon or case, such as an individual, organization, community, event, or situation. It is a qualitative research approach that aims to provide a detailed and comprehensive understanding of the case being studied. Learn about the types, methods, data collection methods, and steps of conducting a case study research.
A case study is a detailed description and assessment of a specific situation in the real world for the purpose of deriving generalizations and insights. Learn about the process, types, benefits, and limitations of case studies in various fields, such as business, criminology, psychology, and sociology.
A case study is a detailed account or examination of a person, group, or thing, often to show general principles or effects. Learn more about the meaning, usage, and examples of case study in different contexts and languages.
Learn the meaning of case study as an intensive analysis of an individual unit or a case history. See how to use the word in sentences and explore its synonyms, history, and related entries.
Learn the meaning of case study as a detailed account or examination of a person, group, or thing, especially to show general principles. See how to use case study in different contexts and domains with examples from the Cambridge Dictionary.
A case study is an in-depth study of one person, group, or event. In a case study, nearly every aspect of the subject's life and history is analyzed to seek patterns and causes of behavior. Case studies can be used in many different fields, including psychology, medicine, education, anthropology, political science, and social work.
A case study is an in-depth investigation of a single person, group, event, or community. It involves intensively analyzing a subject to understand its complexity and context. Learn how to define a case study, see examples in different fields, and discover the steps and benefits of crafting a good case study.
Case study definition: a study of an individual unit, as a person, family, or social group, usually emphasizing developmental issues and relationships with the environment, especially in order to compare a larger group to the individual unit.. See examples of CASE STUDY used in a sentence.
A case study is a detailed analysis of a subject using multiple sets of data observed over time. Learn about the benefits, types, and examples of case studies in various fields such as marketing, neuroscience, and psychoanalysis.
Learn the definition, pronunciation and usage of the noun case study, which means a detailed account of a person, group or situation over time or a person or situation used to study an idea or theory. See examples, synonyms and related topics.
Case study definition: a study of an individual unit, as a person, family, or social group, usually emphasizing developmental issues and relationships with the environment, especially in order to compare a larger group to the individual unit. See examples of CASE STUDY used in a sentence.
A case study is a detailed study of a specific subject, such as a person, group, place, event, organisation, or phenomenon. It involves qualitative and/or quantitative methods to describe, compare, evaluate, and understand different aspects of the research problem. Learn how to do a case study with examples and tips from Scribbr.
Case study is a common methodology in the social sciences (management, psychology, science of education, political science, sociology). A lot of methodological papers have been dedicated to case study but, paradoxically, the question "what is a case?" has been less studied. Hence the fact that researchers conducting a case study are ...
A Case study is: An in-depth research design that primarily uses a qualitative methodology but sometimes includes quantitative methodology. Used to examine an identifiable problem confirmed through research. Used to investigate an individual, group of people, organization, or event. Used to mostly answer "how" and "why" questions.
Definition and Overview. Case study refers to the collection and presentation of detailed information about a particular participant or small group, frequently including the accounts of subjects themselves. A form of qualitative descriptive research, the case study looks intensely at an individual or small participant pool, drawing conclusions ...
A case study is one of the most commonly used methodologies of social research. This article attempts to look into the various dimensions of a case study research strategy, the different epistemological strands which determine the particular case study type and approach adopted in the field, discusses the factors which can enhance the effectiveness of a case study research, and the debate ...
Five elements of a research design: Identify data to be collected— define: 1. question: case studies most useful for answering how, why 2. propositions, if any to help problematize your question (e.g., organizations collaborate because they derive mutual benefit). 3.
Learn what a case study is and how it can be used to examine complex phenomena in the natural setting. Compare single-case and multiple-case studies, and see examples of case study research in nursing.
Although case studies have been discussed extensively in the literature, little has been written about the specific steps one may use to conduct case study research effectively (Gagnon, 2010; Hancock & Algozzine, 2016).Baskarada (2014) also emphasized the need to have a succinct guideline that can be practically followed as it is actually tough to execute a case study well in practice.
Learn what a case study is, how to write one, and what types of case studies exist. Find out how to get your case study written by a professional service with verified data and quality control.
Background and objectivesThis study aimed to investigate the possible prognostic significance of interferon alpha-beta receptor subunit 2 (IFNAR2) and tyrosine kinase 2 (TYK2) expressions.MethodsWe conducted a retrospective study including COVID-19 adult patients. All blood samples were collected before any interventions. The expressions of IFNAR2 and TYK2 were assessed using real-time PCR ...