what are conclusions in research

• USC Libraries
• Research Guides

Organizing Your Social Sciences Research Paper

• 9. The Conclusion
• Purpose of Guide
• Design Flaws to Avoid
• Independent and Dependent Variables
• Glossary of Research Terms
• Reading Research Effectively
• Narrowing a Topic Idea
• Broadening a Topic Idea
• Extending the Timeliness of a Topic Idea
• Academic Writing Style
• Applying Critical Thinking
• Choosing a Title
• Making an Outline
• Paragraph Development
• Research Process Video Series
• Executive Summary
• The C.A.R.S. Model
• Background Information
• The Research Problem/Question
• Theoretical Framework
• Citation Tracking
• Content Alert Services
• Evaluating Sources
• Primary Sources
• Secondary Sources
• Tiertiary Sources
• Scholarly vs. Popular Publications
• Qualitative Methods
• Quantitative Methods
• Insiderness
• Using Non-Textual Elements
• Limitations of the Study
• Common Grammar Mistakes
• Writing Concisely
• Avoiding Plagiarism
• Footnotes or Endnotes?
• Further Readings
• Generative AI and Writing
• USC Libraries Tutorials and Other Guides
• Bibliography

The conclusion is intended to help the reader understand why your research should matter to them after they have finished reading the paper. A conclusion is not merely a summary of the main topics covered or a re-statement of your research problem, but a synthesis of key points derived from the findings of your study and, if applicable, where you recommend new areas for future research. For most college-level research papers, two or three well-developed paragraphs is sufficient for a conclusion, although in some cases, more paragraphs may be required in describing the key findings and their significance.

Conclusions. The Writing Center. University of North Carolina; Conclusions. The Writing Lab and The OWL. Purdue University.

Importance of a Good Conclusion

A well-written conclusion provides you with important opportunities to demonstrate to the reader your understanding of the research problem. These include:

• Presenting the last word on the issues you raised in your paper . Just as the introduction gives a first impression to your reader, the conclusion offers a chance to leave a lasting impression. Do this, for example, by highlighting key findings in your analysis that advance new understanding about the research problem, that are unusual or unexpected, or that have important implications applied to practice.
• Summarizing your thoughts and conveying the larger significance of your study . The conclusion is an opportunity to succinctly re-emphasize  your answer to the "So What?" question by placing the study within the context of how your research advances past research about the topic.
• Identifying how a gap in the literature has been addressed . The conclusion can be where you describe how a previously identified gap in the literature [first identified in your literature review section] has been addressed by your research and why this contribution is significant.
• Demonstrating the importance of your ideas . Don't be shy. The conclusion offers an opportunity to elaborate on the impact and significance of your findings. This is particularly important if your study approached examining the research problem from an unusual or innovative perspective.
• Introducing possible new or expanded ways of thinking about the research problem . This does not refer to introducing new information [which should be avoided], but to offer new insight and creative approaches for framing or contextualizing the research problem based on the results of your study.

Bunton, David. “The Structure of PhD Conclusion Chapters.” Journal of English for Academic Purposes 4 (July 2005): 207–224; Conclusions. The Writing Center. University of North Carolina; Kretchmer, Paul. Twelve Steps to Writing an Effective Conclusion. San Francisco Edit, 2003-2008; Conclusions. The Writing Lab and The OWL. Purdue University; Assan, Joseph. "Writing the Conclusion Chapter: The Good, the Bad and the Missing." Liverpool: Development Studies Association (2009): 1-8.

Structure and Writing Style

I.  General Rules

The general function of your paper's conclusion is to restate the main argument . It reminds the reader of the strengths of your main argument(s) and reiterates the most important evidence supporting those argument(s). Do this by clearly summarizing the context, background, and necessity of pursuing the research problem you investigated in relation to an issue, controversy, or a gap found in the literature. However, make sure that your conclusion is not simply a repetitive summary of the findings. This reduces the impact of the argument(s) you have developed in your paper.

When writing the conclusion to your paper, follow these general rules:

• Present your conclusions in clear, concise language. Re-state the purpose of your study, then describe how your findings differ or support those of other studies and why [i.e., what were the unique, new, or crucial contributions your study made to the overall research about your topic?].
• Do not simply reiterate your findings or the discussion of your results. Provide a synthesis of arguments presented in the paper to show how these converge to address the research problem and the overall objectives of your study.
• Indicate opportunities for future research if you haven't already done so in the discussion section of your paper. Highlighting the need for further research provides the reader with evidence that you have an in-depth awareness of the research problem but that further investigations should take place beyond the scope of your investigation.

Consider the following points to help ensure your conclusion is presented well:

• If the argument or purpose of your paper is complex, you may need to summarize the argument for your reader.
• If, prior to your conclusion, you have not yet explained the significance of your findings or if you are proceeding inductively, use the end of your paper to describe your main points and explain their significance.
• Move from a detailed to a general level of consideration that returns the topic to the context provided by the introduction or within a new context that emerges from the data [this is opposite of the introduction, which begins with general discussion of the context and ends with a detailed description of the research problem]. 

The conclusion also provides a place for you to persuasively and succinctly restate the research problem, given that the reader has now been presented with all the information about the topic . Depending on the discipline you are writing in, the concluding paragraph may contain your reflections on the evidence presented. However, the nature of being introspective about the research you have conducted will depend on the topic and whether your professor wants you to express your observations in this way. If asked to think introspectively about the topics, do not delve into idle speculation. Being introspective means looking within yourself as an author to try and understand an issue more deeply, not to guess at possible outcomes or make up scenarios not supported by the evidence.

II.  Developing a Compelling Conclusion

Although an effective conclusion needs to be clear and succinct, it does not need to be written passively or lack a compelling narrative. Strategies to help you move beyond merely summarizing the key points of your research paper may include any of the following:

• If your essay deals with a critical, contemporary problem, warn readers of the possible consequences of not attending to the problem proactively.
• Recommend a specific course or courses of action that, if adopted, could address a specific problem in practice or in the development of new knowledge leading to positive change.
• Cite a relevant quotation or expert opinion already noted in your paper in order to lend authority and support to the conclusion(s) you have reached [a good source would be from your literature review].
• Explain the consequences of your research in a way that elicits action or demonstrates urgency in seeking change.
• Restate a key statistic, fact, or visual image to emphasize the most important finding of your paper.
• If your discipline encourages personal reflection, illustrate your concluding point by drawing from your own life experiences.
• Return to an anecdote, an example, or a quotation that you presented in your introduction, but add further insight derived from the findings of your study; use your interpretation of results from your study to recast it in new or important ways.
• Provide a "take-home" message in the form of a succinct, declarative statement that you want the reader to remember about your study.

III. Problems to Avoid

Failure to be concise Your conclusion section should be concise and to the point. Conclusions that are too lengthy often have unnecessary information in them. The conclusion is not the place for details about your methodology or results. Although you should give a summary of what was learned from your research, this summary should be relatively brief, since the emphasis in the conclusion is on the implications, evaluations, insights, and other forms of analysis that you make. Strategies for writing concisely can be found here .

Failure to comment on larger, more significant issues In the introduction, your task was to move from the general [the field of study] to the specific [the research problem]. However, in the conclusion, your task is to move from a specific discussion [your research problem] back to a general discussion framed around the implications and significance of your findings [i.e., how your research contributes new understanding or fills an important gap in the literature]. In short, the conclusion is where you should place your research within a larger context [visualize your paper as an hourglass--start with a broad introduction and review of the literature, move to the specific analysis and discussion, conclude with a broad summary of the study's implications and significance].

Failure to reveal problems and negative results Negative aspects of the research process should never be ignored. These are problems, deficiencies, or challenges encountered during your study. They should be summarized as a way of qualifying your overall conclusions. If you encountered negative or unintended results [i.e., findings that are validated outside the research context in which they were generated], you must report them in the results section and discuss their implications in the discussion section of your paper. In the conclusion, use negative results as an opportunity to explain their possible significance and/or how they may form the basis for future research.

Failure to provide a clear summary of what was learned In order to be able to discuss how your research fits within your field of study [and possibly the world at large], you need to summarize briefly and succinctly how it contributes to new knowledge or a new understanding about the research problem. This element of your conclusion may be only a few sentences long.

Failure to match the objectives of your research Often research objectives in the social and behavioral sciences change while the research is being carried out. This is not a problem unless you forget to go back and refine the original objectives in your introduction. As these changes emerge they must be documented so that they accurately reflect what you were trying to accomplish in your research [not what you thought you might accomplish when you began].

Resist the urge to apologize If you've immersed yourself in studying the research problem, you presumably should know a good deal about it [perhaps even more than your professor!]. Nevertheless, by the time you have finished writing, you may be having some doubts about what you have produced. Repress those doubts! Don't undermine your authority as a researcher by saying something like, "This is just one approach to examining this problem; there may be other, much better approaches that...." The overall tone of your conclusion should convey confidence to the reader about the study's validity and realiability.

Assan, Joseph. "Writing the Conclusion Chapter: The Good, the Bad and the Missing." Liverpool: Development Studies Association (2009): 1-8; Concluding Paragraphs. College Writing Center at Meramec. St. Louis Community College; Conclusions. The Writing Center. University of North Carolina; Conclusions. The Writing Lab and The OWL. Purdue University; Freedman, Leora  and Jerry Plotnick. Introductions and Conclusions. The Lab Report. University College Writing Centre. University of Toronto; Leibensperger, Summer. Draft Your Conclusion. Academic Center, the University of Houston-Victoria, 2003; Make Your Last Words Count. The Writer’s Handbook. Writing Center. University of Wisconsin Madison; Miquel, Fuster-Marquez and Carmen Gregori-Signes. “Chapter Six: ‘Last but Not Least:’ Writing the Conclusion of Your Paper.” In Writing an Applied Linguistics Thesis or Dissertation: A Guide to Presenting Empirical Research . John Bitchener, editor. (Basingstoke,UK: Palgrave Macmillan, 2010), pp. 93-105; Tips for Writing a Good Conclusion. Writing@CSU. Colorado State University; Kretchmer, Paul. Twelve Steps to Writing an Effective Conclusion. San Francisco Edit, 2003-2008; Writing Conclusions. Writing Tutorial Services, Center for Innovative Teaching and Learning. Indiana University; Writing: Considering Structure and Organization. Institute for Writing Rhetoric. Dartmouth College.

Writing Tip

Don't Belabor the Obvious!

Avoid phrases like "in conclusion...," "in summary...," or "in closing...." These phrases can be useful, even welcome, in oral presentations. But readers can see by the tell-tale section heading and number of pages remaining that they are reaching the end of your paper. You'll irritate your readers if you belabor the obvious.

Assan, Joseph. "Writing the Conclusion Chapter: The Good, the Bad and the Missing." Liverpool: Development Studies Association (2009): 1-8.

Another Writing Tip

New Insight, Not New Information!

Don't surprise the reader with new information in your conclusion that was never referenced anywhere else in the paper. This why the conclusion rarely has citations to sources. If you have new information to present, add it to the discussion or other appropriate section of the paper. Note that, although no new information is introduced, the conclusion, along with the discussion section, is where you offer your most "original" contributions in the paper; the conclusion is where you describe the value of your research, demonstrate that you understand the material that you’ve presented, and position your findings within the larger context of scholarship on the topic, including describing how your research contributes new insights to that scholarship.

Assan, Joseph. "Writing the Conclusion Chapter: The Good, the Bad and the Missing." Liverpool: Development Studies Association (2009): 1-8; Conclusions. The Writing Center. University of North Carolina.

• << Previous: Limitations of the Study
• Next: Appendices >>
• Last Updated: May 21, 2024 11:14 AM
• URL: https://libguides.usc.edu/writingguide

Get science-backed answers as you write with Paperpal's Research feature

How to Write a Conclusion for Research Papers (with Examples)

The conclusion of a research paper is a crucial section that plays a significant role in the overall impact and effectiveness of your research paper. However, this is also the section that typically receives less attention compared to the introduction and the body of the paper. The conclusion serves to provide a concise summary of the key findings, their significance, their implications, and a sense of closure to the study. Discussing how can the findings be applied in real-world scenarios or inform policy, practice, or decision-making is especially valuable to practitioners and policymakers. The research paper conclusion also provides researchers with clear insights and valuable information for their own work, which they can then build on and contribute to the advancement of knowledge in the field.

The research paper conclusion should explain the significance of your findings within the broader context of your field. It restates how your results contribute to the existing body of knowledge and whether they confirm or challenge existing theories or hypotheses. Also, by identifying unanswered questions or areas requiring further investigation, your awareness of the broader research landscape can be demonstrated.

Remember to tailor the research paper conclusion to the specific needs and interests of your intended audience, which may include researchers, practitioners, policymakers, or a combination of these.

Table of Contents

What is a conclusion in a research paper, summarizing conclusion, editorial conclusion, externalizing conclusion, importance of a good research paper conclusion, how to write a conclusion for your research paper, research paper conclusion examples.

• How to write a research paper conclusion with Paperpal? 

Frequently Asked Questions

A conclusion in a research paper is the final section where you summarize and wrap up your research, presenting the key findings and insights derived from your study. The research paper conclusion is not the place to introduce new information or data that was not discussed in the main body of the paper. When working on how to conclude a research paper, remember to stick to summarizing and interpreting existing content. The research paper conclusion serves the following purposes: 1

• Warn readers of the possible consequences of not attending to the problem.
• Recommend specific course(s) of action.
• Restate key ideas to drive home the ultimate point of your research paper.
• Provide a “take-home” message that you want the readers to remember about your study.

Types of conclusions for research papers

In research papers, the conclusion provides closure to the reader. The type of research paper conclusion you choose depends on the nature of your study, your goals, and your target audience. I provide you with three common types of conclusions:

A summarizing conclusion is the most common type of conclusion in research papers. It involves summarizing the main points, reiterating the research question, and restating the significance of the findings. This common type of research paper conclusion is used across different disciplines.

An editorial conclusion is less common but can be used in research papers that are focused on proposing or advocating for a particular viewpoint or policy. It involves presenting a strong editorial or opinion based on the research findings and offering recommendations or calls to action.

An externalizing conclusion is a type of conclusion that extends the research beyond the scope of the paper by suggesting potential future research directions or discussing the broader implications of the findings. This type of conclusion is often used in more theoretical or exploratory research papers.

Align your conclusion’s tone with the rest of your research paper. Start Writing with Paperpal Now!  

The conclusion in a research paper serves several important purposes:

• Offers Implications and Recommendations : Your research paper conclusion is an excellent place to discuss the broader implications of your research and suggest potential areas for further study. It’s also an opportunity to offer practical recommendations based on your findings.
• Provides Closure : A good research paper conclusion provides a sense of closure to your paper. It should leave the reader with a feeling that they have reached the end of a well-structured and thought-provoking research project.
• Leaves a Lasting Impression : Writing a well-crafted research paper conclusion leaves a lasting impression on your readers. It’s your final opportunity to leave them with a new idea, a call to action, or a memorable quote.

Writing a strong conclusion for your research paper is essential to leave a lasting impression on your readers. Here’s a step-by-step process to help you create and know what to put in the conclusion of a research paper: 2

• Research Statement : Begin your research paper conclusion by restating your research statement. This reminds the reader of the main point you’ve been trying to prove throughout your paper. Keep it concise and clear.
• Key Points : Summarize the main arguments and key points you’ve made in your paper. Avoid introducing new information in the research paper conclusion. Instead, provide a concise overview of what you’ve discussed in the body of your paper.
• Address the Research Questions : If your research paper is based on specific research questions or hypotheses, briefly address whether you’ve answered them or achieved your research goals. Discuss the significance of your findings in this context.
• Significance : Highlight the importance of your research and its relevance in the broader context. Explain why your findings matter and how they contribute to the existing knowledge in your field.
• Implications : Explore the practical or theoretical implications of your research. How might your findings impact future research, policy, or real-world applications? Consider the “so what?” question.
• Future Research : Offer suggestions for future research in your area. What questions or aspects remain unanswered or warrant further investigation? This shows that your work opens the door for future exploration.
• Closing Thought : Conclude your research paper conclusion with a thought-provoking or memorable statement. This can leave a lasting impression on your readers and wrap up your paper effectively. Avoid introducing new information or arguments here.
• Proofread and Revise : Carefully proofread your conclusion for grammar, spelling, and clarity. Ensure that your ideas flow smoothly and that your conclusion is coherent and well-structured.

Write your research paper conclusion 2x faster with Paperpal. Try it now!

Remember that a well-crafted research paper conclusion is a reflection of the strength of your research and your ability to communicate its significance effectively. It should leave a lasting impression on your readers and tie together all the threads of your paper. Now you know how to start the conclusion of a research paper and what elements to include to make it impactful, let’s look at a research paper conclusion sample.

How to write a research paper conclusion with Paperpal?

A research paper conclusion is not just a summary of your study, but a synthesis of the key findings that ties the research together and places it in a broader context. A research paper conclusion should be concise, typically around one paragraph in length. However, some complex topics may require a longer conclusion to ensure the reader is left with a clear understanding of the study’s significance. Paperpal, an AI writing assistant trusted by over 800,000 academics globally, can help you write a well-structured conclusion for your research paper. 

• Sign Up or Log In: Create a new Paperpal account or login with your details.  
• Navigate to Features : Once logged in, head over to the features’ side navigation pane. Click on Templates and you’ll find a suite of generative AI features to help you write better, faster.  
• Generate an outline: Under Templates, select ‘Outlines’. Choose ‘Research article’ as your document type.  
• Select your section: Since you’re focusing on the conclusion, select this section when prompted.  
• Choose your field of study: Identifying your field of study allows Paperpal to provide more targeted suggestions, ensuring the relevance of your conclusion to your specific area of research. 
• Provide a brief description of your study: Enter details about your research topic and findings. This information helps Paperpal generate a tailored outline that aligns with your paper’s content. 
• Generate the conclusion outline: After entering all necessary details, click on ‘generate’. Paperpal will then create a structured outline for your conclusion, to help you start writing and build upon the outline.  
• Write your conclusion: Use the generated outline to build your conclusion. The outline serves as a guide, ensuring you cover all critical aspects of a strong conclusion, from summarizing key findings to highlighting the research’s implications. 
• Refine and enhance: Paperpal’s ‘Make Academic’ feature can be particularly useful in the final stages. Select any paragraph of your conclusion and use this feature to elevate the academic tone, ensuring your writing is aligned to the academic journal standards. 

By following these steps, Paperpal not only simplifies the process of writing a research paper conclusion but also ensures it is impactful, concise, and aligned with academic standards. Sign up with Paperpal today and write your research paper conclusion 2x faster .  

The research paper conclusion is a crucial part of your paper as it provides the final opportunity to leave a strong impression on your readers. In the research paper conclusion, summarize the main points of your research paper by restating your research statement, highlighting the most important findings, addressing the research questions or objectives, explaining the broader context of the study, discussing the significance of your findings, providing recommendations if applicable, and emphasizing the takeaway message. The main purpose of the conclusion is to remind the reader of the main point or argument of your paper and to provide a clear and concise summary of the key findings and their implications. All these elements should feature on your list of what to put in the conclusion of a research paper to create a strong final statement for your work.

A strong conclusion is a critical component of a research paper, as it provides an opportunity to wrap up your arguments, reiterate your main points, and leave a lasting impression on your readers. Here are the key elements of a strong research paper conclusion: 1. Conciseness : A research paper conclusion should be concise and to the point. It should not introduce new information or ideas that were not discussed in the body of the paper. 2. Summarization : The research paper conclusion should be comprehensive enough to give the reader a clear understanding of the research’s main contributions. 3 . Relevance : Ensure that the information included in the research paper conclusion is directly relevant to the research paper’s main topic and objectives; avoid unnecessary details. 4 . Connection to the Introduction : A well-structured research paper conclusion often revisits the key points made in the introduction and shows how the research has addressed the initial questions or objectives. 5. Emphasis : Highlight the significance and implications of your research. Why is your study important? What are the broader implications or applications of your findings? 6 . Call to Action : Include a call to action or a recommendation for future research or action based on your findings.

The length of a research paper conclusion can vary depending on several factors, including the overall length of the paper, the complexity of the research, and the specific journal requirements. While there is no strict rule for the length of a conclusion, but it’s generally advisable to keep it relatively short. A typical research paper conclusion might be around 5-10% of the paper’s total length. For example, if your paper is 10 pages long, the conclusion might be roughly half a page to one page in length.

In general, you do not need to include citations in the research paper conclusion. Citations are typically reserved for the body of the paper to support your arguments and provide evidence for your claims. However, there may be some exceptions to this rule: 1. If you are drawing a direct quote or paraphrasing a specific source in your research paper conclusion, you should include a citation to give proper credit to the original author. 2. If your conclusion refers to or discusses specific research, data, or sources that are crucial to the overall argument, citations can be included to reinforce your conclusion’s validity.

The conclusion of a research paper serves several important purposes: 1. Summarize the Key Points 2. Reinforce the Main Argument 3. Provide Closure 4. Offer Insights or Implications 5. Engage the Reader. 6. Reflect on Limitations

Remember that the primary purpose of the research paper conclusion is to leave a lasting impression on the reader, reinforcing the key points and providing closure to your research. It’s often the last part of the paper that the reader will see, so it should be strong and well-crafted.

• Makar, G., Foltz, C., Lendner, M., & Vaccaro, A. R. (2018). How to write effective discussion and conclusion sections. Clinical spine surgery, 31(8), 345-346.
• Bunton, D. (2005). The structure of PhD conclusion chapters.  Journal of English for academic purposes ,  4 (3), 207-224.

Paperpal is a comprehensive AI writing toolkit that helps students and researchers achieve 2x the writing in half the time. It leverages 21+ years of STM experience and insights from millions of research articles to provide in-depth academic writing, language editing, and submission readiness support to help you write better, faster.  

Get accurate academic translations, rewriting support, grammar checks, vocabulary suggestions, and generative AI assistance that delivers human precision at machine speed. Try for free or upgrade to Paperpal Prime starting at US$19 a month to access premium features, including consistency, plagiarism, and 30+ submission readiness checks to help you succeed.  

Experience the future of academic writing – Sign up to Paperpal and start writing for free!  

Related Reads:

• 5 Reasons for Rejection After Peer Review
• Ethical Research Practices For Research with Human Subjects

7 Ways to Improve Your Academic Writing Process

• Paraphrasing in Academic Writing: Answering Top Author Queries

Preflight For Editorial Desk: The Perfect Hybrid (AI + Human) Assistance Against Compromised Manuscripts

You may also like, how to write a high-quality conference paper, academic editing: how to self-edit academic text with..., measuring academic success: definition & strategies for excellence, phd qualifying exam: tips for success , ai in education: it’s time to change the..., is it ethical to use ai-generated abstracts without..., what are journal guidelines on using generative ai..., quillbot review: features, pricing, and free alternatives, what is an academic paper types and elements , should you use ai tools like chatgpt for....

When you choose to publish with PLOS, your research makes an impact. Make your work accessible to all, without restrictions, and accelerate scientific discovery with options like preprints and published peer review that make your work more Open.

• PLOS Biology
• PLOS Climate
• PLOS Complex Systems
• PLOS Computational Biology
• PLOS Digital Health
• PLOS Genetics
• PLOS Global Public Health
• PLOS Medicine
• PLOS Mental Health
• PLOS Neglected Tropical Diseases
• PLOS Pathogens
• PLOS Sustainability and Transformation
• PLOS Collections
• How to Write Discussions and Conclusions

The discussion section contains the results and outcomes of a study. An effective discussion informs readers what can be learned from your experiment and provides context for the results.

What makes an effective discussion?

When you’re ready to write your discussion, you’ve already introduced the purpose of your study and provided an in-depth description of the methodology. The discussion informs readers about the larger implications of your study based on the results. Highlighting these implications while not overstating the findings can be challenging, especially when you’re submitting to a journal that selects articles based on novelty or potential impact. Regardless of what journal you are submitting to, the discussion section always serves the same purpose: concluding what your study results actually mean.

A successful discussion section puts your findings in context. It should include:

• the results of your research,
• a discussion of related research, and
• a comparison between your results and initial hypothesis.

Tip: Not all journals share the same naming conventions.

You can apply the advice in this article to the conclusion, results or discussion sections of your manuscript.

Our Early Career Researcher community tells us that the conclusion is often considered the most difficult aspect of a manuscript to write. To help, this guide provides questions to ask yourself, a basic structure to model your discussion off of and examples from published manuscripts. 

Questions to ask yourself:

• Was my hypothesis correct?
• If my hypothesis is partially correct or entirely different, what can be learned from the results? 
• How do the conclusions reshape or add onto the existing knowledge in the field? What does previous research say about the topic? 
• Why are the results important or relevant to your audience? Do they add further evidence to a scientific consensus or disprove prior studies? 
• How can future research build on these observations? What are the key experiments that must be done? 
• What is the “take-home” message you want your reader to leave with?

How to structure a discussion

Trying to fit a complete discussion into a single paragraph can add unnecessary stress to the writing process. If possible, you’ll want to give yourself two or three paragraphs to give the reader a comprehensive understanding of your study as a whole. Here’s one way to structure an effective discussion:

Writing Tips

While the above sections can help you brainstorm and structure your discussion, there are many common mistakes that writers revert to when having difficulties with their paper. Writing a discussion can be a delicate balance between summarizing your results, providing proper context for your research and avoiding introducing new information. Remember that your paper should be both confident and honest about the results! 

• Read the journal’s guidelines on the discussion and conclusion sections. If possible, learn about the guidelines before writing the discussion to ensure you’re writing to meet their expectations. 
• Begin with a clear statement of the principal findings. This will reinforce the main take-away for the reader and set up the rest of the discussion. 
• Explain why the outcomes of your study are important to the reader. Discuss the implications of your findings realistically based on previous literature, highlighting both the strengths and limitations of the research. 
• State whether the results prove or disprove your hypothesis. If your hypothesis was disproved, what might be the reasons? 
• Introduce new or expanded ways to think about the research question. Indicate what next steps can be taken to further pursue any unresolved questions. 
• If dealing with a contemporary or ongoing problem, such as climate change, discuss possible consequences if the problem is avoided. 
• Be concise. Adding unnecessary detail can distract from the main findings. 

Don’t

• Rewrite your abstract. Statements with “we investigated” or “we studied” generally do not belong in the discussion. 
• Include new arguments or evidence not previously discussed. Necessary information and evidence should be introduced in the main body of the paper. 
• Apologize. Even if your research contains significant limitations, don’t undermine your authority by including statements that doubt your methodology or execution. 
• Shy away from speaking on limitations or negative results. Including limitations and negative results will give readers a complete understanding of the presented research. Potential limitations include sources of potential bias, threats to internal or external validity, barriers to implementing an intervention and other issues inherent to the study design. 
• Overstate the importance of your findings. Making grand statements about how a study will fully resolve large questions can lead readers to doubt the success of the research. 

Snippets of Effective Discussions:

Consumer-based actions to reduce plastic pollution in rivers: A multi-criteria decision analysis approach

Identifying reliable indicators of fitness in polar bears

• How to Write a Great Title
• How to Write an Abstract
• How to Write Your Methods
• How to Report Statistics
• How to Edit Your Work

The contents of the Peer Review Center are also available as a live, interactive training session, complete with slides, talking points, and activities. …

The contents of the Writing Center are also available as a live, interactive training session, complete with slides, talking points, and activities. …

There’s a lot to consider when deciding where to submit your work. Learn how to choose a journal that will help your study reach its audience, while reflecting your values as a researcher…

Conclusions

What this handout is about.

This handout will explain the functions of conclusions, offer strategies for writing effective ones, help you evaluate conclusions you’ve drafted, and suggest approaches to avoid.

About conclusions

Introductions and conclusions can be difficult to write, but they’re worth investing time in. They can have a significant influence on a reader’s experience of your paper.

Just as your introduction acts as a bridge that transports your readers from their own lives into the “place” of your analysis, your conclusion can provide a bridge to help your readers make the transition back to their daily lives. Such a conclusion will help them see why all your analysis and information should matter to them after they put the paper down.

Your conclusion is your chance to have the last word on the subject. The conclusion allows you to have the final say on the issues you have raised in your paper, to synthesize your thoughts, to demonstrate the importance of your ideas, and to propel your reader to a new view of the subject. It is also your opportunity to make a good final impression and to end on a positive note.

Your conclusion can go beyond the confines of the assignment. The conclusion pushes beyond the boundaries of the prompt and allows you to consider broader issues, make new connections, and elaborate on the significance of your findings.

Your conclusion should make your readers glad they read your paper. Your conclusion gives your reader something to take away that will help them see things differently or appreciate your topic in personally relevant ways. It can suggest broader implications that will not only interest your reader, but also enrich your reader’s life in some way. It is your gift to the reader.

Strategies for writing an effective conclusion

One or more of the following strategies may help you write an effective conclusion:

• Play the “So What” Game. If you’re stuck and feel like your conclusion isn’t saying anything new or interesting, ask a friend to read it with you. Whenever you make a statement from your conclusion, ask the friend to say, “So what?” or “Why should anybody care?” Then ponder that question and answer it. Here’s how it might go: You: Basically, I’m just saying that education was important to Douglass. Friend: So what? You: Well, it was important because it was a key to him feeling like a free and equal citizen. Friend: Why should anybody care? You: That’s important because plantation owners tried to keep slaves from being educated so that they could maintain control. When Douglass obtained an education, he undermined that control personally. You can also use this strategy on your own, asking yourself “So What?” as you develop your ideas or your draft.
• Return to the theme or themes in the introduction. This strategy brings the reader full circle. For example, if you begin by describing a scenario, you can end with the same scenario as proof that your essay is helpful in creating a new understanding. You may also refer to the introductory paragraph by using key words or parallel concepts and images that you also used in the introduction.
• Synthesize, don’t summarize. Include a brief summary of the paper’s main points, but don’t simply repeat things that were in your paper. Instead, show your reader how the points you made and the support and examples you used fit together. Pull it all together.
• Include a provocative insight or quotation from the research or reading you did for your paper.
• Propose a course of action, a solution to an issue, or questions for further study. This can redirect your reader’s thought process and help them to apply your info and ideas to their own life or to see the broader implications.
• Point to broader implications. For example, if your paper examines the Greensboro sit-ins or another event in the Civil Rights Movement, you could point out its impact on the Civil Rights Movement as a whole. A paper about the style of writer Virginia Woolf could point to her influence on other writers or on later feminists.

Strategies to avoid

• Beginning with an unnecessary, overused phrase such as “in conclusion,” “in summary,” or “in closing.” Although these phrases can work in speeches, they come across as wooden and trite in writing.
• Stating the thesis for the very first time in the conclusion.
• Introducing a new idea or subtopic in your conclusion.
• Ending with a rephrased thesis statement without any substantive changes.
• Making sentimental, emotional appeals that are out of character with the rest of an analytical paper.
• Including evidence (quotations, statistics, etc.) that should be in the body of the paper.

Four kinds of ineffective conclusions

• The “That’s My Story and I’m Sticking to It” Conclusion. This conclusion just restates the thesis and is usually painfully short. It does not push the ideas forward. People write this kind of conclusion when they can’t think of anything else to say. Example: In conclusion, Frederick Douglass was, as we have seen, a pioneer in American education, proving that education was a major force for social change with regard to slavery.
• The “Sherlock Holmes” Conclusion. Sometimes writers will state the thesis for the very first time in the conclusion. You might be tempted to use this strategy if you don’t want to give everything away too early in your paper. You may think it would be more dramatic to keep the reader in the dark until the end and then “wow” them with your main idea, as in a Sherlock Holmes mystery. The reader, however, does not expect a mystery, but an analytical discussion of your topic in an academic style, with the main argument (thesis) stated up front. Example: (After a paper that lists numerous incidents from the book but never says what these incidents reveal about Douglass and his views on education): So, as the evidence above demonstrates, Douglass saw education as a way to undermine the slaveholders’ power and also an important step toward freedom.
• The “America the Beautiful”/”I Am Woman”/”We Shall Overcome” Conclusion. This kind of conclusion usually draws on emotion to make its appeal, but while this emotion and even sentimentality may be very heartfelt, it is usually out of character with the rest of an analytical paper. A more sophisticated commentary, rather than emotional praise, would be a more fitting tribute to the topic. Example: Because of the efforts of fine Americans like Frederick Douglass, countless others have seen the shining beacon of light that is education. His example was a torch that lit the way for others. Frederick Douglass was truly an American hero.
• The “Grab Bag” Conclusion. This kind of conclusion includes extra information that the writer found or thought of but couldn’t integrate into the main paper. You may find it hard to leave out details that you discovered after hours of research and thought, but adding random facts and bits of evidence at the end of an otherwise-well-organized essay can just create confusion. Example: In addition to being an educational pioneer, Frederick Douglass provides an interesting case study for masculinity in the American South. He also offers historians an interesting glimpse into slave resistance when he confronts Covey, the overseer. His relationships with female relatives reveal the importance of family in the slave community.

Works consulted

We consulted these works while writing this handout. This is not a comprehensive list of resources on the handout’s topic, and we encourage you to do your own research to find additional publications. Please do not use this list as a model for the format of your own reference list, as it may not match the citation style you are using. For guidance on formatting citations, please see the UNC Libraries citation tutorial . We revise these tips periodically and welcome feedback.

Douglass, Frederick. 1995. Narrative of the Life of Frederick Douglass, an American Slave, Written by Himself. New York: Dover.

Hamilton College. n.d. “Conclusions.” Writing Center. Accessed June 14, 2019. https://www.hamilton.edu//academics/centers/writing/writing-resources/conclusions .

Holewa, Randa. 2004. “Strategies for Writing a Conclusion.” LEO: Literacy Education Online. Last updated February 19, 2004. https://leo.stcloudstate.edu/acadwrite/conclude.html.

You may reproduce it for non-commercial use if you use the entire handout and attribute the source: The Writing Center, University of North Carolina at Chapel Hill

Make a Gift

• Link to facebook
• Link to linkedin
• Link to twitter
• Link to youtube
• Writing Tips

How to Write a Conclusion for a Research Paper

3-minute read

• 29th August 2023

If you’re writing a research paper, the conclusion is your opportunity to summarize your findings and leave a lasting impression on your readers. In this post, we’ll take you through how to write an effective conclusion for a research paper and how you can:

·   Reword your thesis statement

·   Highlight the significance of your research

·   Discuss limitations

·   Connect to the introduction

·   End with a thought-provoking statement

Rewording Your Thesis Statement

Begin your conclusion by restating your thesis statement in a way that is slightly different from the wording used in the introduction. Avoid presenting new information or evidence in your conclusion. Just summarize the main points and arguments of your essay and keep this part as concise as possible. Remember that you’ve already covered the in-depth analyses and investigations in the main body paragraphs of your essay, so it’s not necessary to restate these details in the conclusion.

Find this useful?

Subscribe to our newsletter and get writing tips from our editors straight to your inbox.

Highlighting the Significance of Your Research

The conclusion is a good place to emphasize the implications of your research . Avoid ambiguous or vague language such as “I think” or “maybe,” which could weaken your position. Clearly explain why your research is significant and how it contributes to the broader field of study.

Here’s an example from a (fictional) study on the impact of social media on mental health:

Discussing Limitations

Although it’s important to emphasize the significance of your study, you can also use the conclusion to briefly address any limitations you discovered while conducting your research, such as time constraints or a shortage of resources. Doing this demonstrates a balanced and honest approach to your research.

Connecting to the Introduction

In your conclusion, you can circle back to your introduction , perhaps by referring to a quote or anecdote you discussed earlier. If you end your paper on a similar note to how you began it, you will create a sense of cohesion for the reader and remind them of the meaning and significance of your research.

Ending With a Thought-Provoking Statement

Consider ending your paper with a thought-provoking and memorable statement that relates to the impact of your research questions or hypothesis. This statement can be a call to action, a philosophical question, or a prediction for the future (positive or negative). Here’s an example that uses the same topic as above (social media and mental health):

Expert Proofreading Services

Ensure that your essay ends on a high note by having our experts proofread your research paper. Our team has experience with a wide variety of academic fields and subjects and can help make your paper stand out from the crowd – get started today and see the difference it can make in your work.

Share this article:

Post A New Comment

Got content that needs a quick turnaround? Let us polish your work. Explore our editorial business services.

9-minute read

How to Use Infographics to Boost Your Presentation

Is your content getting noticed? Capturing and maintaining an audience’s attention is a challenge when...

8-minute read

Why Interactive PDFs Are Better for Engagement

Are you looking to enhance engagement and captivate your audience through your professional documents? Interactive...

7-minute read

Seven Key Strategies for Voice Search Optimization

Voice search optimization is rapidly shaping the digital landscape, requiring content professionals to adapt their...

4-minute read

Five Creative Ways to Showcase Your Digital Portfolio

Are you a creative freelancer looking to make a lasting impression on potential clients or...

How to Ace Slack Messaging for Contractors and Freelancers

Effective professional communication is an important skill for contractors and freelancers navigating remote work environments....

How to Insert a Text Box in a Google Doc

Google Docs is a powerful collaborative tool, and mastering its features can significantly enhance your...

Make sure your writing is the best it can be with our expert English proofreading and editing.

• Walden University
• Faculty Portal

Writing a Paper: Conclusions

Writing a conclusion.

A conclusion is an important part of the paper; it provides closure for the reader while reminding the reader of the contents and importance of the paper. It accomplishes this by stepping back from the specifics in order to view the bigger picture of the document. In other words, it is reminding the reader of the main argument. For most course papers, it is usually one paragraph that simply and succinctly restates the main ideas and arguments, pulling everything together to help clarify the thesis of the paper. A conclusion does not introduce new ideas; instead, it should clarify the intent and importance of the paper. It can also suggest possible future research on the topic.

An Easy Checklist for Writing a Conclusion

It is important to remind the reader of the thesis of the paper so he is reminded of the argument and solutions you proposed.

Think of the main points as puzzle pieces, and the conclusion is where they all fit together to create a bigger picture. The reader should walk away with the bigger picture in mind.

Make sure that the paper places its findings in the context of real social change.

Make sure the reader has a distinct sense that the paper has come to an end. It is important to not leave the reader hanging. (You don’t want her to have flip-the-page syndrome, where the reader turns the page, expecting the paper to continue. The paper should naturally come to an end.)

No new ideas should be introduced in the conclusion. It is simply a review of the material that is already present in the paper. The only new idea would be the suggesting of a direction for future research.

Conclusion Example

As addressed in my analysis of recent research, the advantages of a later starting time for high school students significantly outweigh the disadvantages. A later starting time would allow teens more time to sleep--something that is important for their physical and mental health--and ultimately improve their academic performance and behavior. The added transportation costs that result from this change can be absorbed through energy savings. The beneficial effects on the students’ academic performance and behavior validate this decision, but its effect on student motivation is still unknown. I would encourage an in-depth look at the reactions of students to such a change. This sort of study would help determine the actual effects of a later start time on the time management and sleep habits of students.

Related Webinar

Didn't find what you need? Email us at [email protected] .

• Previous Page: Thesis Statements
• Next Page: Writer's Block
• Office of Student Disability Services

Walden Resources

Departments.

• Academic Residencies
• Academic Skills
• Career Planning and Development
• Customer Care Team
• Field Experience
• Military Services
• Student Success Advising
• Writing Skills

Centers and Offices

• Center for Social Change
• Office of Academic Support and Instructional Services
• Office of Degree Acceleration
• Office of Research and Doctoral Services
• Office of Student Affairs

Student Resources

• Doctoral Writing Assessment
• Form & Style Review
• Quick Answers
• ScholarWorks
• SKIL Courses and Workshops
• Walden Bookstore
• Walden Catalog & Student Handbook
• Student Safety/Title IX
• Legal & Consumer Information
• Website Terms and Conditions
• Cookie Policy
• Accessibility
• Accreditation
• State Authorization
• Net Price Calculator
• Contact Walden

Walden University is a member of Adtalem Global Education, Inc. www.adtalem.com Walden University is certified to operate by SCHEV © 2024 Walden University LLC. All rights reserved.

• PRO Courses Guides New Tech Help Pro Expert Videos About wikiHow Pro Upgrade Sign In
• EDIT Edit this Article
• EXPLORE Tech Help Pro About Us Random Article Quizzes Request a New Article Community Dashboard This Or That Game Popular Categories Arts and Entertainment Artwork Books Movies Computers and Electronics Computers Phone Skills Technology Hacks Health Men's Health Mental Health Women's Health Relationships Dating Love Relationship Issues Hobbies and Crafts Crafts Drawing Games Education & Communication Communication Skills Personal Development Studying Personal Care and Style Fashion Hair Care Personal Hygiene Youth Personal Care School Stuff Dating All Categories Arts and Entertainment Finance and Business Home and Garden Relationship Quizzes Cars & Other Vehicles Food and Entertaining Personal Care and Style Sports and Fitness Computers and Electronics Health Pets and Animals Travel Education & Communication Hobbies and Crafts Philosophy and Religion Work World Family Life Holidays and Traditions Relationships Youth
• Browse Articles
• Learn Something New
• Quizzes Hot
• This Or That Game
• Train Your Brain
• Explore More
• Support wikiHow
• About wikiHow
• Log in / Sign up
• Education and Communications
• College University and Postgraduate
• Academic Writing
• Research Papers

How to Write a Conclusion for a Research Paper

Last Updated: May 8, 2024 Approved

This article was co-authored by Christopher Taylor, PhD . Christopher Taylor is an Adjunct Assistant Professor of English at Austin Community College in Texas. He received his PhD in English Literature and Medieval Studies from the University of Texas at Austin in 2014. wikiHow marks an article as reader-approved once it receives enough positive feedback. This article received 42 testimonials and 83% of readers who voted found it helpful, earning it our reader-approved status. This article has been viewed 2,259,776 times.

The conclusion of a research paper needs to summarize the content and purpose of the paper without seeming too wooden or dry. Every basic conclusion must share several key elements, but there are also several tactics you can play around with to craft a more effective conclusion and several you should avoid to prevent yourself from weakening your paper's conclusion. Here are some writing tips to keep in mind when creating a conclusion for your next research paper.

Sample Conclusions

Writing a basic conclusion.

• Do not spend a great amount of time or space restating your topic.
• A good research paper will make the importance of your topic apparent, so you do not need to write an elaborate defense of your topic in the conclusion.
• Usually a single sentence is all you need to restate your topic.
• An example would be if you were writing a paper on the epidemiology of infectious disease, you might say something like "Tuberculosis is a widespread infectious disease that affects millions of people worldwide every year."
• Yet another example from the humanities would be a paper about the Italian Renaissance: "The Italian Renaissance was an explosion of art and ideas centered around artists, writers, and thinkers in Florence."

• A thesis is a narrowed, focused view on the topic at hand.
• This statement should be rephrased from the thesis you included in your introduction. It should not be identical or too similar to the sentence you originally used.
• Try re-wording your thesis statement in a way that complements your summary of the topic of your paper in your first sentence of your conclusion.
• An example of a good thesis statement, going back to the paper on tuberculosis, would be "Tuberculosis is a widespread disease that affects millions of people worldwide every year. Due to the alarming rate of the spread of tuberculosis, particularly in poor countries, medical professionals are implementing new strategies for the diagnosis, treatment, and containment of this disease ."

• A good way to go about this is to re-read the topic sentence of each major paragraph or section in the body of your paper.
• Find a way to briefly restate each point mentioned in each topic sentence in your conclusion. Do not repeat any of the supporting details used within your body paragraphs.
• Under most circumstances, you should avoid writing new information in your conclusion. This is especially true if the information is vital to the argument or research presented in your paper.
• For example, in the TB paper you could summarize the information. "Tuberculosis is a widespread disease that affects millions of people worldwide. Due to the alarming rate of the spread of tuberculosis, particularly in poor countries, medical professionals are implementing new strategies for the diagnosis, treatment, and containment of this disease. In developing countries, such as those in Africa and Southeast Asia, the rate of TB infections is soaring. Crowded conditions, poor sanitation, and lack of access to medical care are all compounding factors in the spread of the disease. Medical experts, such as those from the World Health Organization are now starting campaigns to go into communities in developing countries and provide diagnostic testing and treatments. However, the treatments for TB are very harsh and have many side effects. This leads to patient non-compliance and spread of multi-drug resistant strains of the disease."

• Note that this is not needed for all research papers.
• If you already fully explained what the points in your paper mean or why they are significant, you do not need to go into them in much detail in your conclusion. Simply restating your thesis or the significance of your topic should suffice.
• It is always best practice to address important issues and fully explain your points in the body of your paper. The point of a conclusion to a research paper is to summarize your argument for the reader and, perhaps, to call the reader to action if needed.

• Note that a call for action is not essential to all conclusions. A research paper on literary criticism, for instance, is less likely to need a call for action than a paper on the effect that television has on toddlers and young children.
• A paper that is more likely to call readers to action is one that addresses a public or scientific need. Let's go back to our example of tuberculosis. This is a very serious disease that is spreading quickly and with antibiotic-resistant forms.
• A call to action in this research paper would be a follow-up statement that might be along the lines of "Despite new efforts to diagnose and contain the disease, more research is needed to develop new antibiotics that will treat the most resistant strains of tuberculosis and ease the side effects of current treatments."

• For example, if you are writing a history paper, then you might discuss how the historical topic you discussed matters today. If you are writing about a foreign country, then you might use the conclusion to discuss how the information you shared may help readers understand their own country.

Making Your Conclusion as Effective as Possible

• Since this sort of conclusion is so basic, you must aim to synthesize the information rather than merely summarizing it.
• Instead of merely repeating things you already said, rephrase your thesis and supporting points in a way that ties them all together.
• By doing so, you make your research paper seem like a "complete thought" rather than a collection of random and vaguely related ideas.

• Ask a question in your introduction. In your conclusion, restate the question and provide a direct answer.
• Write an anecdote or story in your introduction but do not share the ending. Instead, write the conclusion to the anecdote in the conclusion of your paper.
• For example, if you wanted to get more creative and put a more humanistic spin on a paper on tuberculosis, you might start your introduction with a story about a person with the disease, and refer to that story in your conclusion. For example, you could say something like this before you re-state your thesis in your conclusion: "Patient X was unable to complete the treatment for tuberculosis due to severe side effects and unfortunately succumbed to the disease."
• Use the same concepts and images introduced in your introduction in your conclusion. The images may or may not appear at other points throughout the research paper.

• Include enough information about your topic to back the statement up but do not get too carried away with excess detail.
• If your research did not provide you with a clear-cut answer to a question posed in your thesis, do not be afraid to indicate as much.
• Restate your initial hypothesis and indicate whether you still believe it or if the research you performed has begun swaying your opinion.
• Indicate that an answer may still exist and that further research could shed more light on the topic at hand.

• This may not be appropriate for all types of research papers. Most research papers, such as one on effective treatment for diseases, will have the information to make the case for a particular argument already in the paper.
• A good example of a paper that might ask a question of the reader in the ending is one about a social issue, such as poverty or government policy.
• Ask a question that will directly get at the heart or purpose of the paper. This question is often the same question, or some version of it, that you may have started with when you began your research.
• Make sure that the question can be answered by the evidence presented in your paper.
• If desired you can briefly summarize the answer after stating the question. You could also leave the question hanging for the reader to answer, though.

• Even without a call to action, you can still make a recommendation to your reader.
• For instance, if you are writing about a topic like third-world poverty, you can various ways for the reader to assist in the problem without necessarily calling for more research.
• Another example would be, in a paper about treatment for drug-resistant tuberculosis, you could suggest donating to the World Health Organization or research foundations that are developing new treatments for the disease.

Avoiding Common Pitfalls

• These sayings usually sound stiff, unnatural, or trite when used in writing.
• Moreover, using a phrase like "in conclusion" to begin your conclusion is a little too straightforward and tends to lead to a weak conclusion. A strong conclusion can stand on its own without being labeled as such.

• Always state the main argument or thesis in the introduction. A research paper is an analytical discussion of an academic topic, not a mystery novel.
• A good, effective research paper will allow your reader to follow your main argument from start to finish.
• This is why it is best practice to start your paper with an introduction that states your main argument and to end the paper with a conclusion that re-states your thesis for re-iteration.

• All significant information should be introduced in the body of the paper.
• Supporting evidence expands the topic of your paper by making it appear more detailed. A conclusion should narrow the topic to a more general point.
• A conclusion should only summarize what you have already stated in the body of your paper.
• You may suggest further research or a call to action, but you should not bring in any new evidence or facts in the conclusion.

• Most often, a shift in tone occurs when a research paper with an academic tone gives an emotional or sentimental conclusion.
• Even if the topic of the paper is of personal significance for you, you should not indicate as much in your paper.
• If you want to give your paper a more humanistic slant, you could start and end your paper with a story or anecdote that would give your topic more personal meaning to the reader.
• This tone should be consistent throughout the paper, however.

• Apologetic statements include phrases like "I may not be an expert" or "This is only my opinion."
• Statements like this can usually be avoided by refraining from writing in the first-person.
• Avoid any statements in the first-person. First-person is generally considered to be informal and does not fit with the formal tone of a research paper.

Community Q&A

You Might Also Like

• ↑ http://owl.english.purdue.edu/owl/resource/724/04/
• ↑ http://www.crlsresearchguide.org/18_Writing_Conclusion.asp
• ↑ http://writing.wisc.edu/Handbook/PlanResearchPaper.html#conclusion
• ↑ http://writingcenter.unc.edu/handouts/conclusions/
• ↑ http://writing2.richmond.edu/writing/wweb/conclude.html

About This Article

To write a conclusion for a research paper, start by restating your thesis statement to remind your readers what your main topic is and bring everything full circle. Then, briefly summarize all of the main points you made throughout your paper, which will help remind your readers of everything they learned. You might also want to include a call to action if you think more research or work needs to be done on your topic by writing something like, "Despite efforts to contain the disease, more research is needed to develop antibiotics." Finally, end your conclusion by explaining the broader context of your topic and why your readers should care about it, which will help them understand why your topic is relevant and important. For tips from our Academic co-author, like how to avoid common pitfalls when writing your conclusion, scroll down! Did this summary help you? Yes No

• Send fan mail to authors

Reader Success Stories

Ummay Aimen

Sep 30, 2016

Did this article help you?

Oct 22, 2017

Sally Larrin

Mar 17, 2018

Maya Loeven

Jun 4, 2017

Sep 26, 2016

Featured Articles

Trending Articles

Watch Articles

• Terms of Use
• Privacy Policy
• Do Not Sell or Share My Info
• Not Selling Info

Get all the best how-tos!

Sign up for wikiHow's weekly email newsletter

How to write a strong conclusion for your research paper

Last updated

17 February 2024

Reviewed by

Writing a research paper is a chance to share your knowledge and hypothesis. It's an opportunity to demonstrate your many hours of research and prove your ability to write convincingly.

Ideally, by the end of your research paper, you'll have brought your readers on a journey to reach the conclusions you've pre-determined. However, if you don't stick the landing with a good conclusion, you'll risk losing your reader’s trust.

Writing a strong conclusion for your research paper involves a few important steps, including restating the thesis and summing up everything properly.

Find out what to include and what to avoid, so you can effectively demonstrate your understanding of the topic and prove your expertise.

• Why is a good conclusion important?

A good conclusion can cement your paper in the reader’s mind. Making a strong impression in your introduction can draw your readers in, but it's the conclusion that will inspire them.

• What to include in a research paper conclusion

There are a few specifics you should include in your research paper conclusion. Offer your readers some sense of urgency or consequence by pointing out why they should care about the topic you have covered. Discuss any common problems associated with your topic and provide suggestions as to how these problems can be solved or addressed.

The conclusion should include a restatement of your initial thesis. Thesis statements are strengthened after you’ve presented supporting evidence (as you will have done in the paper), so make a point to reintroduce it at the end.

Finally, recap the main points of your research paper, highlighting the key takeaways you want readers to remember. If you've made multiple points throughout the paper, refer to the ones with the strongest supporting evidence.

• Steps for writing a research paper conclusion

Many writers find the conclusion the most challenging part of any research project . By following these three steps, you'll be prepared to write a conclusion that is effective and concise.

• Step 1: Restate the problem

Always begin by restating the research problem in the conclusion of a research paper. This serves to remind the reader of your hypothesis and refresh them on the main point of the paper. 

When restating the problem, take care to avoid using exactly the same words you employed earlier in the paper.

• Step 2: Sum up the paper

After you've restated the problem, sum up the paper by revealing your overall findings. The method for this differs slightly, depending on whether you're crafting an argumentative paper or an empirical paper.

Argumentative paper: Restate your thesis and arguments

Argumentative papers involve introducing a thesis statement early on. In crafting the conclusion for an argumentative paper, always restate the thesis, outlining the way you've developed it throughout the entire paper.

It might be appropriate to mention any counterarguments in the conclusion, so you can demonstrate how your thesis is correct or how the data best supports your main points.

Empirical paper: Summarize research findings

Empirical papers break down a series of research questions. In your conclusion, discuss the findings your research revealed, including any information that surprised you.

Be clear about the conclusions you reached, and explain whether or not you expected to arrive at these particular ones.

• Step 3: Discuss the implications of your research

Argumentative papers and empirical papers also differ in this part of a research paper conclusion. Here are some tips on crafting conclusions for argumentative and empirical papers.

Argumentative paper: Powerful closing statement

In an argumentative paper, you'll have spent a great deal of time expressing the opinions you formed after doing a significant amount of research. Make a strong closing statement in your argumentative paper's conclusion to share the significance of your work.

You can outline the next steps through a bold call to action, or restate how powerful your ideas turned out to be.

Empirical paper: Directions for future research

Empirical papers are broader in scope. They usually cover a variety of aspects and can include several points of view.

To write a good conclusion for an empirical paper, suggest the type of research that could be done in the future, including methods for further investigation or outlining ways other researchers might proceed.

If you feel your research had any limitations, even if they were outside your control, you could mention these in your conclusion.

After you finish outlining your conclusion, ask someone to read it and offer feedback. In any research project you're especially close to, it can be hard to identify problem areas. Having a close friend or someone whose opinion you value read the research paper and provide honest feedback can be invaluable. Take note of any suggested edits and consider incorporating them into your paper if they make sense.

• Things to avoid in a research paper conclusion

Keep these aspects to avoid in mind as you're writing your conclusion and refer to them after you've created an outline.

Dry summary

Writing a memorable, succinct conclusion is arguably more important than a strong introduction. Take care to avoid just rephrasing your main points, and don't fall into the trap of repeating dry facts or citations.

You can provide a new perspective for your readers to think about or contextualize your research. Either way, make the conclusion vibrant and interesting, rather than a rote recitation of your research paper’s highlights.

Clichéd or generic phrasing

Your research paper conclusion should feel fresh and inspiring. Avoid generic phrases like "to sum up" or "in conclusion." These phrases tend to be overused, especially in an academic context and might turn your readers off.

The conclusion also isn't the time to introduce colloquial phrases or informal language. Retain a professional, confident tone consistent throughout your paper’s conclusion so it feels exciting and bold.

New data or evidence

While you should present strong data throughout your paper, the conclusion isn't the place to introduce new evidence. This is because readers are engaged in actively learning as they read through the body of your paper.

By the time they reach the conclusion, they will have formed an opinion one way or the other (hopefully in your favor!). Introducing new evidence in the conclusion will only serve to surprise or frustrate your reader.

Ignoring contradictory evidence

If your research reveals contradictory evidence, don't ignore it in the conclusion. This will damage your credibility as an expert and might even serve to highlight the contradictions.

Be as transparent as possible and admit to any shortcomings in your research, but don't dwell on them for too long.

Ambiguous or unclear resolutions

The point of a research paper conclusion is to provide closure and bring all your ideas together. You should wrap up any arguments you introduced in the paper and tie up any loose ends, while demonstrating why your research and data are strong.

Use direct language in your conclusion and avoid ambiguity. Even if some of the data and sources you cite are inconclusive or contradictory, note this in your conclusion to come across as confident and trustworthy.

• Examples of research paper conclusions

Your research paper should provide a compelling close to the paper as a whole, highlighting your research and hard work. While the conclusion should represent your unique style, these examples offer a starting point:

Ultimately, the data we examined all point to the same conclusion: Encouraging a good work-life balance improves employee productivity and benefits the company overall. The research suggests that when employees feel their personal lives are valued and respected by their employers, they are more likely to be productive when at work. In addition, company turnover tends to be reduced when employees have a balance between their personal and professional lives. While additional research is required to establish ways companies can support employees in creating a stronger work-life balance, it's clear the need is there.

Social media is a primary method of communication among young people. As we've seen in the data presented, most young people in high school use a variety of social media applications at least every hour, including Instagram and Facebook. While social media is an avenue for connection with peers, research increasingly suggests that social media use correlates with body image issues. Young girls with lower self-esteem tend to use social media more often than those who don't log onto social media apps every day. As new applications continue to gain popularity, and as more high school students are given smartphones, more research will be required to measure the effects of prolonged social media use.

What are the different kinds of research paper conclusions?

There are no formal types of research paper conclusions. Ultimately, the conclusion depends on the outline of your paper and the type of research you’re presenting. While some experts note that research papers can end with a new perspective or commentary, most papers should conclude with a combination of both. The most important aspect of a good research paper conclusion is that it accurately represents the body of the paper.

Can I present new arguments in my research paper conclusion?

Research paper conclusions are not the place to introduce new data or arguments. The body of your paper is where you should share research and insights, where the reader is actively absorbing the content. By the time a reader reaches the conclusion of the research paper, they should have formed their opinion. Introducing new arguments in the conclusion can take a reader by surprise, and not in a positive way. It might also serve to frustrate readers.

How long should a research paper conclusion be?

There's no set length for a research paper conclusion. However, it's a good idea not to run on too long, since conclusions are supposed to be succinct. A good rule of thumb is to keep your conclusion around 5 to 10 percent of the paper's total length. If your paper is 10 pages, try to keep your conclusion under one page.

What should I include in a research paper conclusion?

A good research paper conclusion should always include a sense of urgency, so the reader can see how and why the topic should matter to them. You can also note some recommended actions to help fix the problem and some obstacles they might encounter. A conclusion should also remind the reader of the thesis statement, along with the main points you covered in the paper. At the end of the conclusion, add a powerful closing statement that helps cement the paper in the mind of the reader.

Should you be using a customer insights hub?

Do you want to discover previous research faster?

Do you share your research findings with others?

Do you analyze research data?

Start for free today, add your research, and get to key insights faster

Editor’s picks

Last updated: 11 January 2024

Last updated: 15 January 2024

Last updated: 17 January 2024

Last updated: 25 November 2023

Last updated: 12 May 2023

Last updated: 30 April 2024

Last updated: 13 May 2024

Latest articles

Related topics, .css-je19u9{-webkit-align-items:flex-end;-webkit-box-align:flex-end;-ms-flex-align:flex-end;align-items:flex-end;display:-webkit-box;display:-webkit-flex;display:-ms-flexbox;display:flex;-webkit-flex-direction:row;-ms-flex-direction:row;flex-direction:row;-webkit-box-flex-wrap:wrap;-webkit-flex-wrap:wrap;-ms-flex-wrap:wrap;flex-wrap:wrap;-webkit-box-pack:center;-ms-flex-pack:center;-webkit-justify-content:center;justify-content:center;row-gap:0;text-align:center;max-width:671px;}@media (max-width: 1079px){.css-je19u9{max-width:400px;}.css-je19u9>span{white-space:pre;}}@media (max-width: 799px){.css-je19u9{max-width:400px;}.css-je19u9>span{white-space:pre;}} decide what to .css-1kiodld{max-height:56px;display:-webkit-box;display:-webkit-flex;display:-ms-flexbox;display:flex;-webkit-align-items:center;-webkit-box-align:center;-ms-flex-align:center;align-items:center;}@media (max-width: 1079px){.css-1kiodld{display:none;}} build next, decide what to build next.

Users report unexpectedly high data usage, especially during streaming sessions.

Users find it hard to navigate from the home page to relevant playlists in the app.

It would be great to have a sleep timer feature, especially for bedtime listening.

I need better filters to find the songs or artists I’m looking for.

Log in or sign up

Get started for free

The Conclusion: How to End a Scientific Report in Style

• First Online: 26 April 2023

Cite this chapter

• Siew Mei Wu 3 ,
• Kooi Cheng Lee 3 &
• Eric Chun Yong Chan 4  

868 Accesses

Sometimes students have the mistaken belief that the conclusion of a scientific report is just a perfunctory ending that repeats what was presented in the main sections of the report. However, impactful conclusions fulfill a rhetorical function. Besides giving a closing summary, the conclusion reflects the significance of what has been uncovered and how this is connected to a broader issue. At the very least, the conclusion of a scientific report should leave the reader with a new perspective of the research area and something to think about.

This is a preview of subscription content, log in via an institution to check access.

Access this chapter

• Available as EPUB and PDF
• Read on any device
• Instant download
• Own it forever
• Durable hardcover edition
• Dispatched in 3 to 5 business days
• Free shipping worldwide - see info

Tax calculation will be finalised at checkout

Purchases are for personal use only

Institutional subscriptions

Similar content being viewed by others

Writing and publishing a scientific paper

Too good to be true?

How to Write and Publish a Research Paper for a Peer-Reviewed Journal

Goh, Z.-H., Tee, J. K., &amp; Ho, H. K. (2020). An Evaluation of the in vitro roles and mechanisms of silibinin in reducing pyrazinamide and isoniazid-induced hepatocellular damage. International Journal of Molecular Sciences, 21 , 3714–3734. https://doi.org/10.3390/ijms21103714

Article   CAS   PubMed   PubMed Central   Google Scholar  

Swales, J. M., &amp; Feak, C. B. (2012). Academic writing for graduate students (3rd ed.). University of Michigan Press.

Book   Google Scholar  

Download references

Author information

Authors and affiliations.

Centre for English Language Communication, National University of Singapore, Singapore, Singapore

Siew Mei Wu & Kooi Cheng Lee

Pharmacy, National University of Singapore, Singapore, Singapore

Eric Chun Yong Chan

You can also search for this author in PubMed   Google Scholar

Corresponding author

Correspondence to Siew Mei Wu .

Editor information

Editors and affiliations.

School of Chemical and Molecular Biosciences, The University of Queensland, Brisbane, QLD, Australia

Susan Rowland

School of Biological Sciences, The University of Queensland, Brisbane, QLD, Australia

Louise Kuchel

Appendix 1: Tutorial Notes for Conclusion Activity

1.1 learning outcomes.

At the end of the tutorial, you should be able to:

Identify and demonstrate understanding of the roles of Conclusion section of research reports

Analyze the rhetorical moves of Conclusion and apply them effectively in research reports

1.2 Introduction

The Conclusion of a paper is a closing summary of what the report is about. The key role of a Conclusion is to provide a reflection on what has been uncovered during the course of the study and to reflect on the significance of what has been learned (Craswell &amp; Poore, 2012). It should show the readers why all the analysis and information matters.

Besides having a final say on the issues in the report, a Conclusion allows the writer to do the following:

Demonstrate the importance of ideas presented through a synthesis of thoughts

Consider broader issues, make new connections, and elaborate on the significance of the findings

Propel the reader to a new view of the subject

Make a good final impression

End the paper on a positive note

(University of North Carolina at Chapel Hill, 2019)

In other words, a Conclusion gives the readers something to take away that will help them see things differently or appreciate the topic in new ways. It can suggest broader implications that will not only interest the readers, but also enrich their knowledge (Craswell &amp; Poore, 2012), and leave them with something interesting to think about (University of North Carolina at Chapel Hill, 2019).

1.3 About the Conclusion Section

In most universities, undergraduate students, especially those in the last year of their programs, are required to document their research work in the form of a research report. The process of taking what you have done in the lab or from systematic review, and writing it for your academic colleagues is a highly structured activity that stretches and challenges the mind. Overall, a research paper should appeal to the academic community for whom you are writing and should cause the reader to want to know more about your research.

As an undergraduate student in your discipline, you have the advantage of being engaged in a niche area of research. As such, your research is current and will most likely be of interest to scholars in your community.

A typical research paper has the following main sections: introduction, methods, results, discussion, and conclusion. The other front and back matters of a research paper are the title, abstract, acknowledgments, and reference list. This structure is commonly adopted and accepted in the scientific fields. The research report starts with a general idea. The report then leads the reader to a discussion on a specific research area. It then ends with applicability to a bigger area. The last section, Conclusion, is the focus of this lesson.

The rhetorical moves of a Conclusion reflect its roles (see Fig. 54.1 ). It starts by reminding the reader of what is presented in the Introduction. For example, if a problem is described in the Introduction, that same problem can be revisited in the Conclusion to provide evidence that the report is helpful in creating a new understanding of the problem. The writer can also refer to the Introduction by using keywords or parallel concepts that were presented there.

Rhetorical moves of Conclusion (the University of North Carolina at Chapel Hill Writing Center,2019)

Next is a synthesis and not a summary of the outcomes of the study. Ideas should not simply be repeated as they were in the earlier parts of the report. The writer must show how the points made, and the support and examples that were given, fit together.

In terms of limitations, if it is not already mentioned in the Discussion section, the writer should acknowledge the weaknesses and shortcomings in the design and/or conduct of the study.

Finally, in connecting to the wider context, the writer should propose a course of action, a solution to an issue, or pose questions for further study. This can redirect readers’ thoughts and help them apply the information and ideas in the study to their own research context or to see the broader implications of the study.

1.4 Linguistic Features of the Conclusion Section

In terms of linguistic features, the use of tense in the Conclusion section is primarily present where the writer’s voice, position, and interpretation are prominent. This is followed by the use of the future tense in sharing what is ahead and some use of past when referring to the study that was done. As summarized by Swales and Feak (2012), Table 54.1 presents the frequency of use of the present tense and past tense in a research report.

1.5 Writing the Conclusion Section

Often, writing a Conclusion is not as easy as it first seems. Using the Question and Answer approach, below is a description of what is usually included in the Conclusion section.

How long should the Conclusion be?

One or two paragraphs comprising 1 sentence summarizing what the paper was about

Two to three sentences summarizing and synthesizing the key findings related to the thesis or objectives of the study

One sentence on limitations (if not in Discussion)

One to two sentences highlighting the significance and implications

One sentence on potential directions for further research

Should the objective be referred to in a Conclusion?

An effective Conclusion reiterates the issue or problem the hypothesis or objective(s) set out to solve. It is important to remind the readers what the hypothesis or objective(s) of the report are and to what extent they are addressed

How far should the Conclusion reflect the Introduction?

Referring to points made in the Introduction in the conclusion ties the paper together and provides readers with a sense of closure.

How much summarizing should there be in a Conclusion?

The conclusion can loosely follow the organization of your paper to parallel, but the focus should be on the paper’s analysis rather than on the organization.

Should newly found information be added to a Conclusion?

Well-written conclusions do not bring in new information or analysis; instead, they sum up what is already contained in the paper.

(Bahamani et al., 2017; Markowsky, 2010)

1.6 Task: Analysing a Conclusion Section

Consider Examples 1 to 4. How do the writers communicate the following information?

Restatement of objective(s)

Refection of outcome(s)

Acknowledgment of limitations, if any

Connection to wider context

“According to this study, the use of educational models, such as a Precaution Adoption Process Model (PAPM) that most people are associated with the process of decision-making in higher education will be beneficial. Moreover, in the preparation, development and implementation of training programs, factors like increased perceived susceptibility, and perceived benefits should be dealt with and some facilities should be provided to facilitate or resolve the barriers of doing the Pap smear test as much as possible.”

(Bahamani et al., 2016)

“Community pharmacists perceived the NMS service as being of benefit to patients by providing advice and reassurance. Implementation of NMS was variable and pharmacists’ perceptions of its feasibility and operationalisation were mixed. Some found the logistics of arranging and conducting the necessary follow-ups challenging, as were service targets. Patient awareness and understanding of NMS was reported to be low and there was a perceived need for publicity about the service. NMS appeared to have strengthened existing good relationships between pharmacists and GPs. Some pharmacists’ concerns about possible overlap of NMS with GP and nurse input may have impacted on their motivation. Overall, our findings indicate that NMS provides an opportunity for patient benefit (patient interaction and medicines management) and the development of contemporary pharmacy practice.”

(Lucas &amp; Blenkinsopp, 2015)

“In this review, we discussed several strategies for the engineering of RiPP pathways to produce artificial pep-tides bearing non-proteinogenic structures characteristic of peptidic natural products. In the RiPP pathways, the structures of the final products are defined by the primary sequences of the precursor genes. Moreover, only a small number of modifying enzymes are involved, and the enzymes function modularly. These features have greatly facilitated both in vivo and in vitro engineering of the pathways, leading to a wide variety of artificial derivatives of naturally occurring RiPPs. In principle, the engineering strategies introduced here can be interchangeably applied for other classes of RiPP enzymes/pathways. Post-biosynthetic chemical modification of RiPPs would be an alternative approach to further increase the structural variation of the products [48–50]. Given that new classes of RiPP enzymes have been frequently reported, and that genetic information of putative RiPP enzymes continues to arise, the array of molecules feasible by RiPP engineering will be further expanded. Some of the artificial RiPP derivatives exhibited elevated bioactivities or different selectivities as compared with their wild type RiPPs. Although these precedents have demonstrated the pharmaceutical relevance of RiPP ana-logs, the next important step in RiPP engineering is the development of novel RiPP derivatives with artificial bioactivities. In more recent reports [51 __,52 __,53 __], the integration of combinatorial lanthipeptide biosynthesis with in vitro selection or bacterial reverse two-hybrid screening methods have successfully obtained artificial ligands specific to certain target proteins. Such approaches, including other strategies under investigation in laboratories in this field, for constructing and screening vast RiPP libraries would lead to the creation of artificial bioactive peptides with non-proteinogenic structures in the near feature.”

(Goto &amp; Suga, 2018)

“Our study is the first to assess and characterise silibinin’s various roles as an adjuvant in protecting against PZA- and INH-induced hepatotoxicity. Most promisingly, we demonstrated silibinin’s safety and efficacy as a rescue adjuvant in vitro , both of which are fundamental considerations in the use of any drug. We also identified silibinin’s potential utility as a rescue hepatoprotectant, shed important mechanistic insights on its hepatoprotective effect, and identified novel antioxidant targets in ameliorating ATT-induced hepatotoxicity. The proof-of-concept demonstrated in this project forms the ethical and scientific foundation to justify and inform subsequent in vivo preclinical studies and clinical trials. Given the lack of alternative treatments in tuberculosis, the need to preserve our remaining antibiotics is paramount. The high stakes involved necessitate future efforts to support our preliminary work in making silibinin clinically relevant to patients and healthcare professionals alike.”

(Goh, 2018)

1.7 In Summary

To recap, in drafting the Conclusion section, you should keep in mind that final remarks can leave the readers with a long-lasting impression of the report especially on the key point(s) that the writer intends to convey. Therefore, you should be careful in crafting this last section of your report.

1.8 References

Bahamani, A. et al. (2017). The Effect of Training Based on Precaution Adoption Process Model (PAPM) on Rural Females’ Participation in Pap smear. BJPR, 16 , 6. Retrieved from http://www.journalrepository.org/media/journals/BJPR_14/2017/May/Bahmani1662017BJPR32965.pdf

Craswell G., &amp; Poore, M. (2012). Writing for Academic Success, 2nd. London: Sage.

Goh, Z-H. (2018). An Evaluation of the Roles and Mechanisms of Silibinin in Reducing Pyrazinamide- and Isoniazid-Induced Hepatotoxicity . Unpublished Final Year Project. National University of Singapore: Department of Pharmacy.

Goto, Y., &amp; Suga, H. (2018). Engineering of RiPP pathways for the production of artificial peptides bearing various non-proteinogenic structures. Current Opinion in Chemical Biology , 46 , 82–90.

Lucas, B., &amp; Blenkinsopp, A. (2015). Community pharmacists’ experience and perceptions of the New Medicines Serves (NMS). IJPP , 23 , 6. Retrieved from http://onlinelibrary.wiley.com/doi/10.1111/ijpp.12180/full

Markowski (2010). WPPD Evaluation form for capstone paper . Retrieved from https://cop-main.sites.medinfo.ufl.edu/files/2010/12/Capstone-Paper-Checklist-and-Reviewer-Evaluation-Form.pdf

Swales, J.M., &amp; Feak, C.B. (2012). Academic writing for graduate students , 3 rd ed. Michigan: University of Michigan Press.

University of North Carolina at Chapel Hill, The Writing Center. (2019). Conclusions . Retrieved from https://writingcenter.unc.edu/tips-and-tools/conclusions/

Appendix 2: Quiz for Conclusion Activity

Instructions

There are 6 questions in this quiz. Choose the most appropriate answer among the options provided.

What does the Conclusion section of a scientific report do?

It provides a recap of report, with reference to the objective(s).

It gives a closure to what has been discussed in relation to the topic.

It shares future direction(s) and in doing so connects to a wider context.

It propels the reader to have an enhanced understanding of the topic.

i, ii, and iii

i, ii and iv

ii, iii and iv

i, ii, iii and iv

The first rhetorical move of the Conclusion section is restatement of objective(s). It …

reminds the reader the objective(s) of the report.

restates reason(s) of each objective of the report.

revisits issue(s) presented requiring investigation.

reiterates the importance of the research project.

The second rhetorical move of the Conclusion section is reflection of outcome(s). It …

summarizes all the findings of the research project.

synthesizes outcomes of the research project.

is a repeat of important ideas mentioned in the report.

shows how key points, evidence, and support fit together.

In connecting to a wider context, the authors …

remind the reader of the importance of the topic.

propose a course of action for the reader.

pose a question to the reader for further research.

direct the reader to certain direction(s).

Following is the Conclusion section of a published article.

“In summary, we have assessed and characterised silibinin’s various roles as an adjuvant in protecting against PZA- and INH-induced hepatotoxicity. Our in vitro experiments suggest that silibinin may be safe and efficacious as a rescue adjuvant, both fundamental considerations in the use of any drug. Further optimisation of our in vitro model may also enhance silibinin’s hepatoprotective effect in rescue, prophylaxis, and recovery. Using this model, we have gleaned important mechanistic insights into its hepatoprotective effect and identified novel antioxidant targets in ameliorating HRZE-induced hepatotoxicity. Future directions will involve exploring the two main mechanisms by which silibinin may ameliorate hepatotoxicity; the proof-of-concept demonstrated in this project will inform subsequent in vitro and in vivo preclinical studies. Given the lack of alternative treatments in tuberculosis, the need to preserve our remaining antibiotics is paramount. These high stakes necessitate future efforts to support our preliminary work, making silibinin more clinically relevant to patients and healthcare professionals alike.” (Goh et al., 2020)

This excerpt of the Conclusion section…

restates objectives of the research.

synthesizes outcomes of the research.

acknowledges limitations of the research

connects the reader to a wider context.

i, ii and iii

What can one observe about the use of tenses in the Conclusion section? The frequency of use of present and future tenses …

demonstrates the importance results being synthesized.

is ungrammatical as the past tense should be used to state the outcomes.

propels the reader to think of future research.

suggests an encouraging tone to end the report.

Rights and permissions

Reprints and permissions

Copyright information

© 2023 The Author(s), under exclusive license to Springer Nature Switzerland AG

About this chapter

Wu, S.M., Lee, K.C., Chan, E.C.Y. (2023). The Conclusion: How to End a Scientific Report in Style. In: Rowland, S., Kuchel, L. (eds) Teaching Science Students to Communicate: A Practical Guide. Springer, Cham. https://doi.org/10.1007/978-3-030-91628-2_54

Download citation

DOI : https://doi.org/10.1007/978-3-030-91628-2_54

Published : 26 April 2023

Publisher Name : Springer, Cham

Print ISBN : 978-3-030-91627-5

Online ISBN : 978-3-030-91628-2

eBook Packages : Biomedical and Life Sciences Biomedical and Life Sciences (R0)

Share this chapter

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Publish with us

Policies and ethics

• Find a journal
• Track your research

So much is at stake in writing a conclusion. This is, after all, your last chance to persuade your readers to your point of view, to impress yourself upon them as a writer and thinker. And the impression you create in your conclusion will shape the impression that stays with your readers after they've finished the essay.

The end of an essay should therefore convey a sense of completeness and closure as well as a sense of the lingering possibilities of the topic, its larger meaning, its implications: the final paragraph should close the discussion without closing it off.

To establish a sense of closure, you might do one or more of the following:

• Conclude by linking the last paragraph to the first, perhaps by reiterating a word or phrase you used at the beginning.
• Conclude with a sentence composed mainly of one-syllable words. Simple language can help create an effect of understated drama.
• Conclude with a sentence that's compound or parallel in structure; such sentences can establish a sense of balance or order that may feel just right at the end of a complex discussion.

To close the discussion without closing it off, you might do one or more of the following:

• Conclude with a quotation from or reference to a primary or secondary source, one that amplifies your main point or puts it in a different perspective. A quotation from, say, the novel or poem you're writing about can add texture and specificity to your discussion; a critic or scholar can help confirm or complicate your final point. For example, you might conclude an essay on the idea of home in James Joyce's short story collection,  Dubliners , with information about Joyce's own complex feelings towards Dublin, his home. Or you might end with a biographer's statement about Joyce's attitude toward Dublin, which could illuminate his characters' responses to the city. Just be cautious, especially about using secondary material: make sure that you get the last word.
• Conclude by setting your discussion into a different, perhaps larger, context. For example, you might end an essay on nineteenth-century muckraking journalism by linking it to a current news magazine program like  60 Minutes .
• Conclude by redefining one of the key terms of your argument. For example, an essay on Marx's treatment of the conflict between wage labor and capital might begin with Marx's claim that the "capitalist economy is . . . a gigantic enterprise of dehumanization "; the essay might end by suggesting that Marxist analysis is itself dehumanizing because it construes everything in economic -- rather than moral or ethical-- terms.
• Conclude by considering the implications of your argument (or analysis or discussion). What does your argument imply, or involve, or suggest? For example, an essay on the novel  Ambiguous Adventure , by the Senegalese writer Cheikh Hamidou Kane, might open with the idea that the protagonist's development suggests Kane's belief in the need to integrate Western materialism and Sufi spirituality in modern Senegal. The conclusion might make the new but related point that the novel on the whole suggests that such an integration is (or isn't) possible.

Finally, some advice on how not to end an essay:

• Don't simply summarize your essay. A brief summary of your argument may be useful, especially if your essay is long--more than ten pages or so. But shorter essays tend not to require a restatement of your main ideas.
• Avoid phrases like "in conclusion," "to conclude," "in summary," and "to sum up." These phrases can be useful--even welcome--in oral presentations. But readers can see, by the tell-tale compression of the pages, when an essay is about to end. You'll irritate your audience if you belabor the obvious.
• Resist the urge to apologize. If you've immersed yourself in your subject, you now know a good deal more about it than you can possibly include in a five- or ten- or 20-page essay. As a result, by the time you've finished writing, you may be having some doubts about what you've produced. (And if you haven't immersed yourself in your subject, you may be feeling even more doubtful about your essay as you approach the conclusion.) Repress those doubts. Don't undercut your authority by saying things like, "this is just one approach to the subject; there may be other, better approaches. . ."

Copyright 1998, Pat Bellanca, for the Writing Center at Harvard University

• Affiliate Program

• UNITED STATES
• 台灣 (TAIWAN)
• TÜRKIYE (TURKEY)
• Academic Editing Services
• - Research Paper
• - Journal Manuscript
• - Dissertation
• - College & University Assignments
• Admissions Editing Services
• - Application Essay
• - Personal Statement
• - Recommendation Letter
• - Cover Letter
• - CV/Resume
• Business Editing Services
• - Business Documents
• - Report & Brochure
• - Website & Blog
• Writer Editing Services
• - Script & Screenplay
• Our Editors
• Client Reviews
• Editing & Proofreading Prices
• Wordvice Points
• Partner Discount
• Plagiarism Checker
• APA Citation Generator
• MLA Citation Generator
• Chicago Citation Generator
• Vancouver Citation Generator
• - APA Style
• - MLA Style
• - Chicago Style
• - Vancouver Style
• Writing & Editing Guide
• Academic Resources
• Admissions Resources

How to Write a Research Paper Conclusion Section

What is a conclusion in a research paper?

The conclusion in a research paper is the final paragraph or two in a research paper. In scientific papers, the conclusion usually follows the Discussion section , summarizing the importance of the findings and reminding the reader why the work presented in the paper is relevant.

However, it can be a bit confusing to distinguish the conclusion section/paragraph from a summary or a repetition of your findings, your own opinion, or the statement of the implications of your work. In fact, the conclusion should contain a bit of all of these other parts but go beyond it—but not too far beyond! 

The structure and content of the conclusion section can also vary depending on whether you are writing a research manuscript or an essay. This article will explain how to write a good conclusion section, what exactly it should (and should not) contain, how it should be structured, and what you should avoid when writing it.  

Table of Contents:

What does a good conclusion section do, what to include in a research paper conclusion.

• Conclusion in an Essay
• Research Paper Conclusion 
• Conclusion Paragraph Outline and Example
• What Not to Do When Writing a Conclusion

The conclusion of a research paper has several key objectives. It should:

• Restate your research problem addressed in the introduction section
• Summarize your main arguments, important findings, and broader implications
• Synthesize key takeaways from your study

The specific content in the conclusion depends on whether your paper presents the results of original scientific research or constructs an argument through engagement with previously published sources.

You presented your general field of study to the reader in the introduction section, by moving from general information (the background of your work, often combined with a literature review ) to the rationale of your study and then to the specific problem or topic you addressed, formulated in the form of the statement of the problem in research or the thesis statement in an essay.

In the conclusion section, in contrast, your task is to move from your specific findings or arguments back to a more general depiction of how your research contributes to the readers’ understanding of a certain concept or helps solve a practical problem, or fills an important gap in the literature. The content of your conclusion section depends on the type of research you are doing and what type of paper you are writing. But whatever the outcome of your work is, the conclusion is where you briefly summarize it and place it within a larger context. It could be called the “take-home message” of the entire paper.

What to summarize in the conclusion

Your conclusion section needs to contain a very brief summary of your work , a very brief summary of the main findings of your work, and a mention of anything else that seems relevant when you now look at your work from a bigger perspective, even if it was not initially listed as one of your main research questions. This could be a limitation, for example, a problem with the design of your experiment that either needs to be considered when drawing any conclusions or that led you to ask a different question and therefore draw different conclusions at the end of your study (compared to when you started out).

Once you have reminded the reader of what you did and what you found, you need to go beyond that and also provide either your own opinion on why your work is relevant (and for whom, and how) or theoretical or practical implications of the study , or make a specific call for action if there is one to be made.   

How to Write an Essay Conclusion

Academic essays follow quite different structures than their counterparts in STEM and the natural sciences. Humanities papers often have conclusion sections that are much longer and contain more detail than scientific papers. There are three main types of academic essay conclusions.

Summarizing conclusion

The most typical conclusion at the end of an analytical/explanatory/argumentative essay is a summarizing conclusion . This is, as the name suggests, a clear summary of the main points of your topic and thesis. Since you might have gone through a number of different arguments or subtopics in the main part of your essay, you need to remind the reader again what those were, how they fit into each other, and how they helped you develop or corroborate your hypothesis.

For an essay that analyzes how recruiters can hire the best candidates in the shortest time or on “how starving yourself will increase your lifespan, according to science”, a summary of all the points you discussed might be all you need. Note that you should not exactly repeat what you said earlier, but rather highlight the essential details and present those to your reader in a different way. 

Externalizing conclusion

If you think that just reminding the reader of your main points is not enough, you can opt for an externalizing conclusion instead, that presents new points that were not presented in the paper so far. These new points can be additional facts and information or they can be ideas that are relevant to the topic and have not been mentioned before.

Such a conclusion can stimulate your readers to think about your topic or the implications of your analysis in a whole new way. For example, at the end of a historical analysis of a specific event or development, you could direct your reader’s attention to some current events that were not the topic of your essay but that provide a different context for your findings.

Editorial conclusion

In an editorial conclusion , another common type of conclusion that you will find at the end of papers and essays, you do not add new information but instead present your own experiences or opinions on the topic to round everything up. What makes this type of conclusion interesting is that you can choose to agree or disagree with the information you presented in your paper so far. For example, if you have collected and analyzed information on how a specific diet helps people lose weight, you can nevertheless have your doubts on the sustainability of that diet or its practicability in real life—if such arguments were not included in your original thesis and have therefore not been covered in the main part of your paper, the conclusion section is the place where you can get your opinion across.    

How to Conclude an Empirical Research Paper

An empirical research paper is usually more concise and succinct than an essay, because, if it is written well, it focuses on one specific question, describes the method that was used to answer that one question, describes and explains the results, and guides the reader in a logical way from the introduction to the discussion without going on tangents or digging into not absolutely relevant topics.

Summarize the findings

In a scientific paper, you should include a summary of the findings. Don’t go into great detail here (you will have presented your in-depth  results  and  discussion  already), but do clearly express the answers to the  research questions  you investigated.

Describe your main findings, even if they weren’t necessarily the ones anticipated, and explain the conclusion they led you to. Explain these findings in as few words as possible.

Instead of beginning with “ In conclusion, in this study, we investigated the effect of stress on the brain using fMRI …”, you should try to find a way to incorporate the repetition of the essential (and only the essential) details into the summary of the key points. “ The findings of this fMRI study on the effect of stress on the brain suggest that …” or “ While it has been known for a long time that stress has an effect on the brain, the findings of this fMRI study show that, surprisingly… ” would be better ways to start a conclusion. 

You should also not bring up new ideas or present new facts in the conclusion of a research paper, but stick to the background information you have presented earlier, to the findings you have already discussed, and the limitations and implications you have already described. The one thing you can add here is a practical recommendation that you haven’t clearly stated before—but even that one needs to follow logically from everything you have already discussed in the discussion section.

Discuss the implications

After summing up your key arguments or findings, conclude the paper by stating the broader implications of the research , whether in methods , approach, or findings. Express practical or theoretical takeaways from your paper. This often looks like a “call to action” or a final “sales pitch” that puts an exclamation point on your paper.

If your research topic is more theoretical in nature, your closing statement should express the significance of your argument—for example, in proposing a new understanding of a topic or laying the groundwork for future research.

Future research example

Future research into education standards should focus on establishing a more detailed picture of how novel pedagogical approaches impact young people’s ability to absorb new and difficult concepts. Moreover, observational studies are needed to gain more insight into how specific teaching models affect the retention of relationships and facts—for instance, how inquiry-based learning and its emphasis on lateral thinking can be used as a jumping-off point for more holistic classroom approaches.

Research Conclusion Example and Outline

Let’s revisit the study on the effect of stress on the brain we mentioned before and see what the common structure for a conclusion paragraph looks like, in three steps. Following these simple steps will make it easy for you to wrap everything up in one short paragraph that contains all the essential information: 

One: Short summary of what you did, but integrated into the summary of your findings:

While it has been known for a long time that stress has an effect on the brain, the findings of this fMRI study in 25 university students going through mid-term exams show that, surprisingly, one’s attitude to the experienced stress significantly modulates the brain’s response to it. 

Note that you don’t need to repeat any methodological or technical details here—the reader has been presented with all of these before, they have read your results section and the discussion of your results, and even (hopefully!) a discussion of the limitations and strengths of your paper. The only thing you need to remind them of here is the essential outcome of your work. 

Two: Add implications, and don’t forget to specify who this might be relevant for: 

Students could be considered a specific subsample of the general population, but earlier research shows that the effect that exam stress has on their physical and mental health is comparable to the effects of other types of stress on individuals of other ages and occupations. Further research into practical ways of modulating not only one’s mental stress response but potentially also one’s brain activity (e.g., via neurofeedback training) are warranted.

This is a “research implication”, and it is nicely combined with a mention of a potential limitation of the study (the student sample) that turns out not to be a limitation after all (because earlier research suggests we can generalize to other populations). If there already is a lot of research on neurofeedback for stress control, by the way, then this should have been discussed in your discussion section earlier and you wouldn’t say such studies are “warranted” here but rather specify how your findings could inspire specific future experiments or how they should be implemented in existing applications. 

Three: The most important thing is that your conclusion paragraph accurately reflects the content of your paper. Compare it to your research paper title , your research paper abstract , and to your journal submission cover letter , in case you already have one—if these do not all tell the same story, then you need to go back to your paper, start again from the introduction section, and find out where you lost the logical thread. As always, consistency is key.    

Problems to Avoid When Writing a Conclusion 

• Do not suddenly introduce new information that has never been mentioned before (unless you are writing an essay and opting for an externalizing conclusion, see above). The conclusion section is not where you want to surprise your readers, but the take-home message of what you have already presented.
• Do not simply copy your abstract, the conclusion section of your abstract, or the first sentence of your introduction, and put it at the end of the discussion section. Even if these parts of your paper cover the same points, they should not be identical.
• Do not start the conclusion with “In conclusion”. If it has its own section heading, that is redundant, and if it is the last paragraph of the discussion section, it is inelegant and also not really necessary. The reader expects you to wrap your work up in the last paragraph, so you don’t have to announce that. Just look at the above example to see how to start a conclusion in a natural way.
• Do not forget what your research objectives were and how you initially formulated the statement of the problem in your introduction section. If your story/approach/conclusions changed because of methodological issues or information you were not aware of when you started, then make sure you go back to the beginning and adapt your entire story (not just the ending). 

Consider Receiving Academic Editing Services

When you have arrived at the conclusion of your paper, you might want to head over to Wordvice AI’s AI Writing Assistant to receive a free grammar check for any academic content. 

After drafting, you can also receive English editing and proofreading services , including paper editing services for your journal manuscript. If you need advice on how to write the other parts of your research paper , or on how to make a research paper outline if you are struggling with putting everything you did together, then head over to the Wordvice academic resources pages , where we have a lot more articles and videos for you.

Purdue Online Writing Lab Purdue OWL® College of Liberal Arts

Conclusions

Welcome to the Purdue OWL

This page is brought to you by the OWL at Purdue University. When printing this page, you must include the entire legal notice.

Copyright ©1995-2018 by The Writing Lab & The OWL at Purdue and Purdue University. All rights reserved. This material may not be published, reproduced, broadcast, rewritten, or redistributed without permission. Use of this site constitutes acceptance of our terms and conditions of fair use.

Conclusions wrap up what you have been discussing in your paper. After moving from general to specific information in the introduction and body paragraphs, your conclusion should begin pulling back into more general information that restates the main points of your argument. Conclusions may also call for action or overview future possible research. The following outline may help you conclude your paper:

In a general way,

• Restate your topic and why it is important,
• Restate your thesis/claim,
• Address opposing viewpoints and explain why readers should align with your position,
• Call for action or overview future research possibilities.

Remember that once you accomplish these tasks, unless otherwise directed by your instructor, you are finished. Done. Complete. Don't try to bring in new points or end with a whiz bang(!) conclusion or try to solve world hunger in the final sentence of your conclusion. Simplicity is best for a clear, convincing message.

The preacher's maxim is one of the most effective formulas to follow for argument papers:

Tell what you're going to tell them (introduction).

Tell them (body).

Tell them what you told them (conclusion).

How to Write a Conclusion for a Research Paper

When you're wrapping up a research paper, the conclusion is like the grand finale of a fireworks show – it's your chance to leave a lasting impression. In this article, we'll break down the steps to help you write a winning research paper conclusion that not only recaps your main points but also ties everything together. Consider it the "So what?" moment – why should people care about your research? Our professional essay writers will guide you through making your conclusion strong, clear, and something that sticks with your readers long after they've put down your paper. So, let's dive in and ensure your research ends on a high note!

What Is a Conclusion in a Research Paper

In a research paper, the conclusion serves as the final segment, where you summarize the main points and findings of your study. It's not just a repetition of what you've already said but rather a chance to tie everything together and highlight the significance of your research. As you learn how to start a research paper , a good conclusion also often discusses the implications of your findings, suggests potential areas for further research, and leaves the reader with a lasting impression of the importance and relevance of your work in the broader context of the field. Essentially, it's your last opportunity to make a strong impact and leave your readers with a clear understanding of the significance of your research. Here’s a research paper conclusion example:

In conclusion, this research paper has navigated the intricacies of sustainable urban development, shedding light on the pivotal role of community engagement and innovative planning strategies. Through applying qualitative and quantitative research methods, we've uncovered valuable insights into the challenges and opportunities inherent in fostering environmentally friendly urban spaces. The implications of these findings extend beyond the confines of this study, emphasizing the imperative for continued exploration in the realms of urban planning and environmental sustainability. By emphasizing both the practical applications and theoretical contributions, this research underscores the significance of community involvement and forward-thinking strategies in shaping the future of urban landscapes. As cities evolve, incorporating these insights into planning and development practices will create resilient and harmonious urban environments.

Conclusion Outline for Research Paper

This outline for a research paper conclusion provides a structured framework to ensure that your ending effectively summarizes the key elements of your research paper and leaves a lasting impression on your readers. Adjust the content based on the specific requirements and focus of your research.

Restate the Thesis Statement

• Briefly restate the main thesis or research question.
• Emphasize the core objective or purpose of the study.

Summarize Key Findings

• Recap the main points and key findings from each section of the paper.
• Provide a concise overview of the research journey.

Discuss Implications

• Explore the broader implications of the research findings.
• Discuss how the results contribute to the existing body of knowledge in the field.

Address Limitations

• Acknowledge any limitations or constraints encountered during the research process.
• Explain how these limitations may impact the interpretation of the findings.

Suggest Areas for Future Research

• Propose potential directions for future studies related to the topic.
• Identify gaps in the current research that warrant further exploration.

Reaffirm Significance

• Reaffirm the importance and relevance of the research in the broader context.
• Highlight the practical applications or real-world implications of the study.

Concluding Statement

• Craft a strong, memorable closing statement that leaves a lasting impression.
• Sum up the overall impact of the research and its potential contribution to the field.

Study the full guide on how to make a research paper outline here, which will also specify the conclusion writing specifics to improve your general prowess.

Tips on How to Make a Conclusion in Research

Here are key considerations regarding a conclusion for research paper to not only recap the primary ideas in your work but also delve deeper to earn a higher grade:

• Provide a concise recap of your main research outcomes.
• Remind readers of your research goals and their accomplishments.
• Stick to summarizing existing content; refrain from adding new details.
• Emphasize why your research matters and its broader implications.
• Clearly explain the practical or theoretical impact of your findings.
• Prompt readers to reflect on how your research influences their perspective.
• Briefly discuss the robustness of your research methods.
• End with a suggestion for future research or a practical application.
• Transparently address any constraints or biases in your study.
• End on a powerful note, leaving a memorable impression on your readers.

For your inspiration, we’ve also prepared this research proposal example APA , which dwells on another important aspect of research writing.

How to Write a Research Paper Conclusion

As you finish your research paper, the conclusion takes center stage. In this section, we've got five practical tips for writing a conclusion for a research paper. We'll guide you through summarizing your key findings, revisiting your research goals, discussing the bigger picture, addressing any limitations, and ending on a powerful note. Think of it as your roadmap to creating a conclusion that not only wraps up your research but also leaves a lasting impact on your readers. Let's dive in and make sure your conclusion stands out for all the right reasons!

Synthesize Core Discoveries. Initiate your conclusion by synthesizing the essential discoveries of your research. Offer a succinct recapitulation of the primary points and outcomes you have elucidated in your paper. This aids in reinforcing the gravity of your work and reiterates the pivotal information you have presented.

Revisit Research Objectives. Revisit the research objectives or questions you outlined at the beginning of your paper. Assess whether you have successfully addressed these objectives and if your findings align with the initial goals of your research. This reflection helps tie your conclusion back to the purpose of your study.

Discuss Implications and Contributions. Discuss the broader implications of your research and its potential contributions to the field. Consider how your findings might impact future research, applications, or understanding of the subject matter. This demonstrates the significance of your work and places it within a larger context.

Address Limitations and Future Research. Acknowledge any limitations in your study, such as constraints in data collection or potential biases. Briefly discuss how these limitations might have affected your results. Additionally, suggest areas for future research that could build upon your work, addressing any unanswered questions or unexplored aspects. This demonstrates a thoughtful approach to your research.

End with a Strong Conclusion Statement. Conclude your research paper with a strong and memorable statement that reinforces the key message you want readers to take away. This could be a call to action, a proposal for further investigation, or a reflection on the broader significance of your findings. Leave your readers with a lasting impression that emphasizes the importance of your research. Remember that you can buy a research paper anytime if you lack time or get stuck in writer’s block.

Want to Enjoy the Benefits of Academic Freedom?

With our top-notch writers and 24/7 support, you can relax and focus on what really matters

Stylistic Devices to Use in a Conclusion

Discover distinctive stylistic insights that you can apply when writing a conclusion for a research paper:

• Rhetorical Questions. When using rhetorical questions, strategically place them to engage readers' minds. For instance, you might pose a question that prompts reflection on the broader implications of your findings, leaving your audience with something to ponder.
• Powerful Language. Incorporate strong language to convey a sense of conviction and importance. Choose words that resonate with the overall tone of your research and amplify the significance of your conclusions. This adds weight to your key messages.
• Repetitions. Repetitions can be employed to reinforce essential ideas. Reiterate key phrases or concepts in a way that emphasizes their importance without sounding redundant. This technique serves to drive home your main points.
• Anecdotes. Integrating anecdotes into your conclusion can provide a human touch. Share a brief and relevant story that connects with your research, making the information more relatable and memorable for your audience.
• Vivid Imagery. Lastly, use vivid imagery to paint a picture in the minds of your readers. Appeal to their senses by describing scenarios or outcomes related to your research. This creates a more immersive and lasting impression.

If you have a larger paper to write, for example a thesis, use our custom dissertation writing can help you in no time.

How to Make a Conclusion Logically Appealing

Knowing how to write a conclusion for a research paper that is logically appealing is important for leaving a lasting impression on your readers. Here are some tips to achieve this:

Logical Sequencing

• Present your conclusion in a structured manner, following the natural flow of your paper. Readers should effortlessly follow your thought process, making your conclusion more accessible and persuasive.

Reinforce Main Arguments

• Emphasize the core arguments and findings from your research. By reinforcing key points, you solidify your stance and provide a logical culmination to your paper.

Address Counterarguments

• Acknowledge and address potential counterarguments or limitations in your research. Demonstrate intellectual honesty and strengthen your conclusion by preemptively addressing potential doubts.

Connect with Introduction

• Revisit themes or concepts introduced in your introduction to create a cohesive narrative, allowing readers to trace the logical progression of your research from start to finish.

Propose Actionable Insights

• Suggest practical applications or recommendations based on your findings. This will add a forward-looking dimension, making your conclusion more relevant and compelling.

Highlight Significance

• Clearly articulate the broader implications of your research to convey the importance of your work and its potential impact on the field, making your conclusion logically compelling.

Are you ready to produce an A-grade assignment? If not, opt for a custom research paper from our skilled writers across various disciplines.

Avoid These Things When Writing a Research Paper Conclusion

As you write your conclusion of research paper, there’s a list of things professional writers don’t recommend doing. Consider these issues carefully:

• Repetition of Exact Phrases
• Repetitively using the same phrases or sentences from the main body. Repetition can make your conclusion seem redundant and less engaging.
• Overly Lengthy Summaries
• Providing excessively detailed summaries of each section of your paper. Readers may lose interest if the conclusion becomes too long and detailed.
• Unclear Connection to the Introduction
• Failing to connect the conclusion back to the introduction. A lack of continuity may make the paper feel disjointed.
• Adding New Arguments or Ideas
• Introducing new arguments or ideas that were not addressed in the body. This can confuse the reader and disrupt the coherence of your paper.
• Overuse of Complex Jargon
• Using excessively complex or technical language without clarification. Clear communication is essential in the conclusion, ensuring broad understanding.
• Apologizing or Undermining Confidence
• Apologizing for limitations or expressing doubt about your work. Maintain a confident tone; if limitations exist, present them objectively without undermining your research.
• Sweeping Generalizations
• Making overly broad or unsupported generalizations. Such statements can weaken the credibility of your conclusion.
• Neglecting the Significance
• Failing to emphasize the broader significance of your research. Readers need to understand why your findings matter in a larger context.
• Abrupt Endings
• Concluding abruptly without a strong closing statement. A powerful ending leaves a lasting impression; avoid a sudden or weak conclusion.

Research Paper Conclusion Example

That covers the essential aspects of summarizing a research paper. The only remaining step is to review the conclusion examples for research paper provided by our team.

Like our examples? Order our research proposal writing service to write paper according to your instructions to avoid plagiarizing and to keep your academic integrity strong.

Final Thoughts

In conclusion, the knowledge of how to write the conclusion of a research paper is pivotal for presenting your findings and leaving a lasting impression on your readers. By summarizing the key points, reiterating the significance of your research, and offering avenues for future exploration, you can create a conclusion that not only reinforces the value of your study but also encourages further academic discourse. Remember to balance brevity and completeness, ensuring your conclusion is concise yet comprehensive. Emphasizing the practical implications of your research and connecting it to the broader academic landscape will help solidify the impact of your work. Pay someone to write a research paper if you are having a hard time finishing your coursework on time.

Tired of Stressing Over Endless Essays and Deadlines? 

Let us take the load off your shoulders! Order your custom research paper today and experience the relief of knowing that your assignment is in expert hands

How To Write A Conclusion For A Research Paper?

What should the conclusion of a research paper contain, how to start a conclusion paragraph for a research paper.

Daniel Parker

is a seasoned educational writer focusing on scholarship guidance, research papers, and various forms of academic essays including reflective and narrative essays. His expertise also extends to detailed case studies. A scholar with a background in English Literature and Education, Daniel’s work on EssayPro blog aims to support students in achieving academic excellence and securing scholarships. His hobbies include reading classic literature and participating in academic forums.

is an expert in nursing and healthcare, with a strong background in history, law, and literature. Holding advanced degrees in nursing and public health, his analytical approach and comprehensive knowledge help students navigate complex topics. On EssayPro blog, Adam provides insightful articles on everything from historical analysis to the intricacies of healthcare policies. In his downtime, he enjoys historical documentaries and volunteering at local clinics.

Related Articles

• Search Menu
• Advance articles
• Editor's Choice
• Author Guidelines
• Submission Site
• Open Access
• About The British Journal of Social Work
• About the British Association of Social Workers
• Editorial Board
• Advertising and Corporate Services
• Journals Career Network
• Self-Archiving Policy
• Dispatch Dates
• Journals on Oxford Academic
• Books on Oxford Academic

Article Contents

• Introduction
• Limitations
• Supplementary material

Social Workers’ Perceived Barriers and Facilitators to Social Work Practice in Schools: A Scoping Review

• Article contents
• Figures & tables
• Supplementary Data

Sarah Binks, Lyndal Hickey, Airin Heath, Anna Bornemisza, Lauren Goulding, Arno Parolini, Social Workers’ Perceived Barriers and Facilitators to Social Work Practice in Schools: A Scoping Review, The British Journal of Social Work , 2024;, bcae046, https://doi.org/10.1093/bjsw/bcae046

• Permissions Icon Permissions

The aim of this scoping review was to establish the breadth of the academic literature regarding the barriers and facilitators to social work practice in schools as perceived by School Social Workers (SSWs). Following the PRISMA-ScR Scoping Review Framework, 42 articles were identified as meeting the inclusion criteria. Five interrelated themes related to the barriers and facilitators to SSW practice were identified: (1) Inadequacy of service delivery infrastructure; (2) SSWs’ role ambiguities and expectations; (3) SSWs’ competency, knowledge and support; (4) School climate and context; and (5) Cultivating relationships and engagement. This scoping review found that social workers perceive far greater barriers than facilitators when delivering services in school settings, with limited evidence related to the facilitators that enhance School Social Work (SSW) practice. Further research regarding the facilitators of SSW practice is needed, specifically in countries where research on this topic is emergent.

Email alerts

Citing articles via.

• Recommend to your Library

Affiliations

• Online ISSN 1468-263X
• Print ISSN 0045-3102
• Copyright © 2024 British Association of Social Workers
• About Oxford Academic
• Publish journals with us
• University press partners
• What we publish
• New features  
• Open access
• Institutional account management
• Rights and permissions
• Get help with access
• Accessibility
• Advertising
• Media enquiries
• Oxford University Press
• Oxford Languages
• University of Oxford

Oxford University Press is a department of the University of Oxford. It furthers the University's objective of excellence in research, scholarship, and education by publishing worldwide

• Copyright © 2024 Oxford University Press
• Cookie settings
• Cookie policy
• Privacy policy
• Legal notice

This Feature Is Available To Subscribers Only

Sign In or Create an Account

This PDF is available to Subscribers Only

For full access to this pdf, sign in to an existing account, or purchase an annual subscription.

SCIENCE & ENGINEERING INDICATORS

Research and development: u.s. trends and international comparisons.

• Report PDF (808 KB)
• Report - All Formats .ZIP (5.2 MB)
• Supplemental Materials - All Formats .ZIP (513 KB)
• MORE DOWNLOADS OPTIONS
• Share on X/Twitter
• Share on Facebook
• Share on LinkedIn
• Send as Email

U.S. GERD grew at a faster rate than GDP over 2010–21 on a compound annual growth rate basis. And while the United States remains the top R&D performer globally, other countries show continued growth in GERD and R&D intensity (R&D-to-GDP ratio). In 2021, the U.S. R&D intensity was 3.5%, based on internationally comparable OECD statistics. Other economies with R&D intensities above 3.0% include Israel and South Korea (both with intensities above 4.0%). Eight economies had intensities between 3.0% and 4.0%, including Taiwan, the United States, Japan, and Germany. Countries with intensities above 2.0% included the United Kingdom and China.

For the United States, the business sector continued to be the leading performer and funder of R&D. Manufacturing industries accounted for the largest proportion of R&D for companies with 10 or more employees, whereas the professional, scientific, and R&D services industry accounted for the largest proportion of R&D by microbusinesses. And U.S.-located companies continue to invest in software, AI, biotechnology, and nanotechnology R&D.

Consistent federal government support for R&D is a key feature of the U.S. R&D enterprise. The CHIPS and Science Act of 2022 appropriated $52.7 billion to revitalize the U.S. semiconductor industry along the supply chain, including $13.7 billion supporting R&D, workforce development, and related programs. More broadly, federal R&D funding constitutes the second-largest overall funding source and the largest source for U.S. basic research performance. The higher education sector was the largest performer of basic research and the largest recipient of federal R&D funding; in 2022, however, total R&D performance by the higher education sector did not increase after adjusting for inflation.

Related Content

• Open access
• Published: 18 May 2024

Determinants of appropriate antibiotic and NSAID prescribing in unscheduled outpatient settings in the veterans health administration

• Michael J. Ward 1 , 2 , 3 , 4 ,
• Michael E. Matheny 1 , 4 , 5 , 6 ,
• Melissa D. Rubenstein 3 ,
• Kemberlee Bonnet 7 ,
• Chloe Dagostino 7 ,
• David G. Schlundt 7 ,
• Shilo Anders 4 , 8 ,
• Thomas Reese 4 &
• Amanda S. Mixon 1 , 9  

BMC Health Services Research volume  24 , Article number:  640 ( 2024 ) Cite this article

84 Accesses

1 Altmetric

Metrics details

Despite efforts to enhance the quality of medication prescribing in outpatient settings, potentially inappropriate prescribing remains common, particularly in unscheduled settings where patients can present with infectious and pain-related complaints. Two of the most commonly prescribed medication classes in outpatient settings with frequent rates of potentially inappropriate prescribing include antibiotics and nonsteroidal anti-inflammatory drugs (NSAIDs). In the setting of persistent inappropriate prescribing, we sought to understand a diverse set of perspectives on the determinants of inappropriate prescribing of antibiotics and NSAIDs in the Veterans Health Administration.

We conducted a qualitative study guided by the Consolidated Framework for Implementation Research and Theory of Planned Behavior. Semi-structured interviews were conducted with clinicians, stakeholders, and Veterans from March 1, 2021 through December 31, 2021 within the Veteran Affairs Health System in unscheduled outpatient settings at the Tennessee Valley Healthcare System. Stakeholders included clinical operations leadership and methodological experts. Audio-recorded interviews were transcribed and de-identified. Data coding and analysis were conducted by experienced qualitative methodologists adhering to the Consolidated Criteria for Reporting Qualitative Studies guidelines. Analysis was conducted using an iterative inductive/deductive process.

We conducted semi-structured interviews with 66 participants: clinicians ( N  = 25), stakeholders ( N  = 24), and Veterans ( N  = 17). We identified six themes contributing to potentially inappropriate prescribing of antibiotics and NSAIDs: 1) Perceived versus actual Veterans expectations about prescribing; 2) the influence of a time-pressured clinical environment on prescribing stewardship; 3) Limited clinician knowledge, awareness, and willingness to use evidence-based care; 4) Prescriber uncertainties about the Veteran condition at the time of the clinical encounter; 5) Limited communication; and 6) Technology barriers of the electronic health record and patient portal.

Conclusions

The diverse perspectives on prescribing underscore the need for interventions that recognize the detrimental impact of high workload on prescribing stewardship and the need to design interventions with the end-user in mind. This study revealed actionable themes that could be addressed to improve guideline concordant prescribing to enhance the quality of prescribing and to reduce patient harm.

Peer Review reports

Adverse drug events (ADEs) are the most common iatrogenic injury. [ 1 ] Efforts to reduce these events have primarily focused on the inpatient setting. However, the emergency department (ED), urgent care, and urgent primary care clinics are desirable targets for interventions to reduce ADEs because approximately 70% of all outpatient encounters occur in one of these settings. [ 2 ] Two of the most commonly prescribed drug classes during acute outpatient care visits that have frequent rates of potentially inappropriate prescribing include antibiotics and non-steroidal anti-inflammatory drugs (NSAIDs). [ 3 , 4 ]

An estimated 30% of all outpatient oral antibiotic prescriptions may be unnecessary. [ 5 , 6 ] The World Health Organization identified overuse of antibiotics and its resulting antimicrobial resistance as a global threat. [ 7 ] The Centers for Disease Control and Prevention (CDC) conservatively estimates that in the US there are nearly 3 million antibiotic-resistant infections that cause 48,000 deaths annually. [ 8 ] Antibiotics were the second most common source of adverse events with nearly one ADE resulting in an ED visit for every 100 prescriptions. [ 9 ] Inappropriate antibiotic prescriptions (e.g., antibiotic prescription for a viral infection) also contribute to resistance and iatrogenic infections such as C. difficile (antibiotic associated diarrhea) and Methicillin-resistant Staphylococcus aureus (MRSA) . [ 8 ] NSAID prescriptions, on the other hand, result in an ADE at more than twice the rate of antibiotics (2.2%), [ 10 ] are prescribed to patients at an already increased risk of potential ADEs, [ 4 , 11 ] and frequently interact with other medications. [ 12 ] Inappropriate NSAID prescriptions contribute to serious gastrointestinal, [ 13 ] renal, [ 14 ] and cardiovascular [ 15 , 16 ] ADEs such as gastrointestinal bleeding, acute kidney injury, and myocardial infarction or heart failure, respectively. Yet, the use of NSAIDs is ubiquitous; according to the CDC, between 2011 and 2014, 5% of the US population were prescribed an NSAID whereas an additional 2% take NSAIDs over the counter. [ 11 ]

Interventions to reduce inappropriate antibiotic prescribing commonly take the form of antimicrobial stewardship programs. However, no such national programs exist for NSAIDs, particularly in acute outpatient care settings. There is a substantial body of evidence supporting the evidence of such stewardship programs. [ 17 ] The CDC recognizes that such outpatient programs should consist of four core elements of antimicrobial stewardship, [ 18 ] including commitment, action for policy and practice, tracking and reporting, and education and expertise. However, the opportunities to extend antimicrobial stewardship in EDs are vast. Despite the effectiveness, there is a recognized need to understand which implementation strategies and how to implement multifaceted interventions. [ 19 ] Given the unique time-pressured environment of acute outpatient care settings, not all antimicrobial stewardship strategies work in these settings necessitating the development of approaches tailored to these environments. [ 19 , 20 ]

One particularly vulnerable population is within the Veterans Health Administration. With more than 9 million enrollees in the Veterans Health Administration, Veterans who receive care in Veteran Affairs (VA) hospitals and outpatient clinics may be particularly vulnerable to ADEs. Older Veterans have greater medical needs than younger patients, given their concomitant medical and mental health conditions as well as cognitive and social issues. Among Veterans seen in VA EDs and Urgent Care Clinics (UCCs), 50% are age 65 and older, [ 21 ] nearly three times the rate of non-VA emergency care settings (18%). [ 22 ] Inappropriate prescribing in ED and UCC settings is problematic with inappropriate antibiotic prescribing estimated to be higher than 40%. [ 23 ] In a sample of older Veterans discharged from VA ED and UCC settings, NSAIDs were found to be implicated in 77% of drug interactions. [ 24 ]

Learning from antimicrobial stewardship programs and applying to a broader base of prescribing in acute outpatient care settings, it is necessary to understand not only why potentially inappropriate prescribing remains a problem for antibiotics, but for medications (e.g., NSAIDs) which have received little stewardship focus previously. This understanding is essential to develop and implement interventions to reduce iatrogenic harm for vulnerable patients seen in unscheduled settings. In the setting of the Veterans Health Administration, we sought to use these two drug classes (antibiotics and NSAIDs) that have frequent rates of inappropriate prescribing in unscheduled outpatient care settings, to understand a diverse set of perspectives on why potentially inappropriate prescribing continues to occur.

Selection of participants

Participants were recruited from three groups in outpatient settings representing emergency care, urgent care, and urgent primary care in the VA: 1) Clinicians-VA clinicians such as physicians, advanced practice providers, and pharmacists 2) Stakeholders-VA and non-VA clinical operational and clinical content experts such as local and regional medical directors, national clinical, research, and administrative leadership in emergency care, primary care, and pharmacy including geriatrics; and 3) Veterans seeking unscheduled care for infectious or pain symptoms.

Clinicians and stakeholders were recruited using email, informational flyers, faculty/staff meetings, national conferences, and snowball sampling, when existing participants identify additional potential research subjects for recruitment. [ 25 ] Snowball sampling is useful for identifying and recruiting participants who may not be readily apparent to investigators and/or hard to reach. Clinician inclusion criteria consisted of: 1) at least 1 year of VA experience; and 2) ≥ 1 clinical shift in the last 30 days at any VA ED, urgent care, or primary care setting in which unscheduled visits occur. Veterans were recruited in-person at the VA by key study personnel. Inclusion criteria consisted of: 1) clinically stable as determined by the treating clinician; 2) 18 years or older; and 3) seeking care for infectious or pain symptoms in the local VA Tennessee Valley Healthcare System (TVHS). TVHS includes an ED at the Nashville campus with over 30,000 annual visits, urgent care clinic in Murfreesboro, TN with approximately 15,000 annual visits, and multiple primary care locations throughout the middle Tennessee region. This study was approved by the VA TVHS Institutional Review Board as minimal risk.

Data collection

Semi-structured interview guides (Supplemental Table 1) were developed using the Consolidated Framework for Implementation Research (CFIR) [ 26 ] and the Theory of Planned Behavior [ 27 , 28 ] to understand attitudes and beliefs as they relate to behaviors, and potential determinants of a future intervention. Interview guides were modified and finalized by conducting pilot interviews with three members of each participant group. Interview guides were tailored to each group of respondents and consisted of questions relating to: 1) determinants of potentially inappropriate prescribing; and 2) integration into practice (Table. 1 ). Clinicians were also asked about knowledge and awareness of evidence-based prescribing practices for antibiotics and NSAIDs. The interviewer asked follow-up questions to elicit clarity of responses and detail.

Each interview was conducted by a trained interviewer (MDR). Veteran interviews were conducted in-person while Veterans waited for clinical care so as not to disrupt clinical operations. Interviews with clinicians and stakeholders were scheduled virtually. All interviews (including in-person) were recorded and transcribed in a manner compliant with VA information security policies using Microsoft Teams (Redmond, WA). The audio-recorded interviews were transcribed and de-identified by a transcriptionist and stored securely behind the VA firewall using Microsoft Teams. Study personnel maintained a recording log on a password-protected server and each participant was assigned a unique participant ID number. Once 15 interviews were conducted per group, we planned to review interviews with the study team to discuss content, findings, and to decide collectively when thematic saturation was achieved, the point at which no new information was obtained. [ 29 ] If not achieved, we planned to conduct at least 2 additional interviews prior to group review for saturation. We estimated that approximately 20–25 interviews per group were needed to achieve thematic saturation.

Qualitative data coding and analysis was managed by the Vanderbilt University Qualitative Research Core. A hierarchical coding system (Supplemental Table 2) was developed and refined using an iterative inductive/deductive approach [ 30 , 31 , 32 ] guided by a combination of: 1) Consolidated Framework for Implementation Research (CFIR) [ 26 ]; 2) the Theory of Planned Behavior [ 27 , 28 ]; 3) interview guide questions; and 4) a preliminary review of the transcripts. Eighteen major categories (Supplemental Table 3) were identified and were further divided into subcategories, with some subcategories having additional levels of hierarchical division. Definitions and rules were written for the use of each of the coding categories. The process was iterative in that the coding system was both theoretically informed and derived from the qualitative data. The coding system was finalized after it was piloted by the coders. Data coding and analysis met the Consolidated Criteria for Reporting Qualitative Research (COREQ) guidelines. [ 33 ]

Four experienced qualitative coders were trained by independently coding two transcripts from each of the three participant categories. Coding was then compared, and any discrepancies resolved by reconciliation. After establishing reliability in using the coding system, the coders divided and independently coded the remaining transcripts in sequential order. Each statement was treated as a separate quote and could be assigned up to 21 different codes. Coded transcripts were combined and sorted by code.

Following thematic saturation, the frequency of each code was calculated to understand the distribution of quotes. Quotes were then cross-referenced with coding as a barrier to understand potential determinants of inappropriate prescribing. A thematic analysis of the barriers was conducted and presented in an iterative process with the research team of qualitative methodologists and clinicians to understand the nuances and refine the themes and subthemes from the coded transcripts. Transcripts, quotations, and codes were managed using Microsoft Excel and SPSS version 28.0.

We approached 132 individuals and 66 (50%) agreed to be interviewed. Participants included 25 clinicians, 24 stakeholders, and 17 Veterans whose demographic characteristics are presented in Table 2 . The clinicians were from 14 VA facilities throughout the US and 20 physicians, and five advanced practice providers. Of the clinicians, 21 (84%) worked in either an ED or urgent care while the remainder practiced in primary care. The 24 stakeholders included 13 (54%) clinical service chiefs or deputy chief (including medical directors), five (21%) national directors, and six (25%) experts in clinical content and methodology. The 17 Veterans interviewed included 15 (88%) who were seen for pain complaints.

Results are organized by the six thematic categories with several subthemes in each category. Themes and subthemes are presented in Table 3  and are visually represented in Fig.  1 . The six themes were: 1) perceived versus actual Veterans expectations about prescribing, 2) the influence of a time-pressured clinical environment on prescribing stewardship, 3) limited clinician knowledge, awareness, and willingness to use evidence-based care, 4) uncertainties about the Veteran condition at the time of the clinical encounter, 5) limited communication, and 6) technology barriers.

Visual representation of themes and subthemes from 66 clinician, stakeholder, and Veteran interviews

Theme 1: Perception that Veterans routinely expect a medication from their visit, despite clinical inappropriateness

According to clinicians, Veterans frequently expect to receive a prescription even when this decision conflicts with good clinical practice.

Certainly lots of people would say you know if you feel like you’re up against some strong expectations from the patients or caregivers or families around the utility of an antibiotic when it’s probably not indicated…In the emergency department the bias is to act and assume the worst and assume like the worst for the clinical trajectory for the patient rather than the reverse. [Clinician 49, Physician, ED]

In addition, stakeholders further stated that patient prescription expectations are quite influential and are likely shaped by Veterans’ prior experiences.

I think the patients, particularly for antibiotics, have strong feelings about whether they should or shouldn’t get something prescribed. [Stakeholder 34] You know I think the biggest challenge, I think, is adjusting patients’ expectations because you know they got better the last time they were doing an antibiotic. [Stakeholder 64]

Patient satisfaction and clinician workload may also influence the clinician’s prescription decision.

We have a lot of patients that come in with back pain or knee pain or something. We’ll get an x-ray and see there’s nothing actually wrong physically that can be identified on x-ray at least and you have to do something. Otherwise, patient satisfaction will dip, and patients leave angry. [Clinician 28, Physician, urgent care clinic] For some clinicians it’s just easier to prescribe an antibiotic when they know that’s the patient’s expectation and it shortens their in-room discussion and evaluation. [Clinician 55, Physician, ED]

Despite clinician perception, Veterans communicated that they did not necessarily expect a prescription and were instead focused on the clinical interaction and the clinician’s decision.

I’m not sure if they’ll give me [unintelligible] a prescription or what they’ll do. I don’t care as long as they stop the pain. [Patient 40, urgent care clinic] I don’t expect to [receive a prescription], but I mean whatever the doctor finds is wrong with me I will follow what he says. [Patient 31, ED]

Theme 2: Hectic clinical environments and unique practice conditions in unscheduled settings provide little time to focus on prescribing practices

Clinicians and stakeholders reported that the time-constrained clinical environment and need to move onto the next patient were major challenges to prescribing stewardship.

The number one reason is to get a patient out of your office or exam bay and move on to the next one. [Stakeholder 28] It takes a lot of time and you have to be very patient and understanding. So, you end up having to put a fair bit of emotional investment and intelligence into an encounter to not prescribe. [Stakeholder 1]

Stakeholders also noted that unique shift conditions and clinician perceptions that their patients were “different” might influence prescribing practices.

A common pushback was ‘well my patients are different.’ [Stakeholder 4] Providers who worked different types of shifts, so if you happened to work on a Monday when the clinics were open and had more adults from the clinics you were more likely to prescribe antibiotics than if you worked over night and had fewer patients. Providers who worked primarily holidays or your Friday prescribing pattern may be very different if you could get them into a primary care provider the next day. [Stakeholder 22]

Clinicians also reported that historical practices in the clinical environment practices may also contribute to inappropriate prescribing.

I came from working in the [outpatient] Clinic as a new grad and they’re very strict about prescribing only according to evidence-based practice. And then when I came here things are with other colleagues are a little more loose with that type of thing. It can be difficult because you start to adopt that practice to. [Clinician 61, Nurse Practitioner, ED]

Theme 3: Clinician knowledge, awareness, and willingness to use evidence-based care

Stakeholders felt that clinicians had a lack of knowledge about prescribing of NSAIDs and antibiotics.

Sometimes errors are a lack of knowledge or awareness of the need to maybe specifically dose for let’s say impaired kidney function or awareness of current up to date current antibiotic resistance patterns in the location that might inform a more tailored antibiotic choice for a given condition. [Stakeholder 37] NSAIDs are very commonly used in the emergency department for patients of all ages…the ED clinician is simply not being aware that for specific populations this is not recommended and again just doing routine practice for patients of all ages and not realizing that for older patients you actually probably should not be using NSAIDs. [Stakeholder 40]

Some clinicians may be unwilling to change their prescribing practices due to outright resistance, entrenched habits, or lack of interest in doing so.

It sounds silly but there’s always some opposition to people being mandated to do something. But there are some people who would look and go ‘okay we already have a handle on that so why do we need something else? I know who prescribes inappropriately and who doesn’t. Is this a requirement, am I evaluated on it? That would come from supervisors. Is this one more thing on my annual review?’ [Stakeholder 28] If people have entrenched habits that are difficult to change and are physicians are very individualistic people who think that they are right more often than the non-physician because of their expensive training and perception of professionalism. [Stakeholder 4]

Theme 4: Uncertainty about whether an adverse event will occur

Clinicians cited the challenge of understanding the entirety of a Veteran’s condition, potential drug-drug interactions, and existing comorbidities in knowing whether an NSAID prescription may result in an adverse event.

It’s oftentimes a judgement call if someone has renal function that’s right at the precipice of being too poor to merit getting NSAIDs that may potentially cause issues. [Clinician 43, Physician, inpatient and urgent care] It depends on what the harm is. So, for instance, you can’t always predict allergic reactions. Harm from the non-steroidals would be more if you didn’t pre-identify risk factors for harm. So, they have ulcer disease, they have kidney problems where a non-steroidal would not be appropriate for that patient. Or potential for a drug-drug interaction between that non-steroid and another medication in particular. [Clinician 16, Physician, ED]

Rather than be concerned about the adverse events resulting from the medication itself, stakeholders identified the uncertainty that clinicians experience about whether a Veteran may experience an adverse event from an infection if nothing is done. This uncertainty contributes to the prescription of an antibiotic.

My experience in working with providers at the VA over the years is that they worry more about the consequences of not treating an infection than about the consequences of the antibiotic itself. [Stakeholder 19] Sometimes folks like to practice conservatively and they’ll say even though I didn’t really see any hard evidence of a bacterial infection, the patient’s older and sicker and they didn’t want to risk it. [Stakeholder 16]

Theme 5: Limited communication during and after the clinical encounter

The role and type of communication about prescribing depended upon the respondent. Clinicians identified inadequate communication and coordination with the Veteran’s primary care physician during the clinical encounter.

I would like to have a little more communication with the primary doctors. They don’t seem to be super interested in talking to anyone in the emergency room about their patients… A lot of times you don’t get an answer from the primary doctor or you get I’m busy in clinic. You can just pick something or just do what you think is right. [Clinician 25, Physician, ED]

Alternatively, stakeholders identified post-encounter patient outcome and clinical performance feedback as potential barriers.

Physicians tend to think that they are doing their best for every individual patient and without getting patient by patient feedback there is a strong cognitive bias to think well there must have been some exception and reason that I did it in this setting. [Stakeholder 34] It’s really more their own awareness of like their clinical performance and how they’re doing. [Stakeholder 40]

Veterans, however, prioritized communication during the clinical encounter. They expressed the need for clear and informative communication with the clinician, and the need for the clinician to provide a rationale for the choice and medication-specific details along with a need to ask any questions.

I expect him to tell me why I’m taking it, what it should do, and probably the side effects. [Patient 25, ED] I’d like to have a better description of how to take it because I won’t remember all the time and sometimes what they put on the bottle is not quite as clear. [Patient 22, ED]

Veterans reported their desire for a simple way to learn about medication information. They provided feedback on the current approaches to educational materials about prescriptions.

Probably most pamphlets that people get they’re not going to pay attention to them. Websites can be overwhelming. [Patient 3, ED] Posters can be offsetting. If you’re sick, you’re not going to read them…if you’re sick you may glance at that poster and disregard it. So, you’re not really going to see it but if you give them something in the hand people will tend to look at it because it’s in their hand. [Patient 19, ED] It would be nice if labels or something just told me what I needed to know. You know take this exactly when and reminds me here’s why you’re taking it for and just real clear and not small letters. [Patient 7, ED]

Theme 6: Technology barriers limited the usefulness of clinical decision support for order checking and patient communication tools

Following the decision to prescribe a medication, clinicians complained that electronic health record pop-ups with clinical decision support warnings for potential safety concerns (e.g., drug-drug interactions) were both excessive and not useful in a busy clinical environment.

The more the pop ups, the more they get ignored. So, it’s finding that sweet spot right where you’re not constantly having to click out of something because you’re so busy. Particularly in our clinical setting where we have very limited amount of time to read the little monograph. Most of the time you click ‘no’ and off you go. (Clinician 16, Physician, ED) Some of these mechanisms like the EMR [electronic medical record] or pop-up decision-making windows really limit your time. If you know the guidelines appropriately and doing the right thing, even if you’re doing the right thing it takes you a long time to get through something. (Clinician 19, Physician, Primary care clinic)

For post-encounter communication that builds on Theme 5 about patient communication, patients reported finding using the VA patient portal (MyHealtheVet) challenging for post-event communication with their primary care physician and to review the medications they were prescribed.

I’ve got to get help to get onto MyHealtheVet but I would probably like to try and use that, but I haven’t been on it in quite some time. [Patient 22, ED] I tried it [MyHealtheVet] once and it’s just too complicated so I’m not going to deal with it. [Patient 37, Urgent care]

This work examined attitudes and perceptions of barriers to appropriate prescribing of antibiotics and NSAIDs in unscheduled outpatient care settings in the Veterans Health Administration. Expanding on prior qualitative work on antimicrobial stewardship programs, we also included an examination of NSAID prescribing, a medication class which has received little attention focused on prescribing stewardship. This work seeks to advance the understanding of fundamental problems underlying prescribing stewardship to facilitate interventions designed to improve not only the decision to prescribe antibiotics and NSAIDs, but enhances the safety checks once a decision to prescribe is made. Specifically, we identified six themes during these interviews: perceived versus actual Veteran expectations about prescribing, the influence of a time-pressured clinical environment on prescribing stewardship, limited clinician knowledge, awareness, and willingness to use evidence-based care, uncertainties about the Veteran condition at the time of the clinical encounter, limited communication, and technology barriers.

Sensitive to patient expectations, clinicians believed that Veterans would be dissatisfied if they did not receive an antibiotic prescription, [ 34 ] even though most patients presenting to the ED for upper respiratory tract infections do not expect antibiotics. [ 35 ] However, recent work by Staub et al. found that among patients with respiratory tract infections, receipt of an antibiotic was not independently associated with improved satisfaction. [ 36 ] Instead, they found that receipt of antibiotics had to match the patient’s expectations to affect patient satisfaction and recommended that clinicians communicate with their patients about prescribing expectations. This finding complements our results in the present study and the importance of communication about expectations is similarly important for NSAID prescribing as well.

A commitment to stewardship and modification of clinician behavior may be compromised by the time-pressured clinical environment, numerous potential drug interactions, comorbidities of a vulnerable Veteran population, and normative practices. The decision to prescribe medications such as antibiotics is a complex clinical decision and may be influenced by both clinical and non-clinical factors. [ 34 , 37 , 38 ] ED crowding, which occurs when the demand for services exceeds a system’s ability to provide care, [ 39 ] is a well-recognized manifestation of a chaotic clinical environment and is associated with detrimental effects on the hospital system and patient outcomes. [ 40 , 41 ] The likelihood that congestion and wait times will improve is unlikely as the COVID-19 pandemic has exacerbated the already existing crowding and boarding crisis in EDs. [ 42 , 43 ]

Another theme was the uncertainty in the anticipation of adverse events that was exacerbated by the lack of a feedback loop. Feedback on clinical care processes and patient outcomes is uncommonly provided in emergency care settings, [ 44 ] yet may provide an opportunity to change clinician behavior, particularly for antimicrobial stewardship. [ 45 ] However, the frequent use of ineffective feedback strategies [ 46 ] compromises the ability to implement effective feedback interventions; feedback must be specific [ 47 ] and address the Intention-to-Action gap [ 48 ] by including co-interventions to address recipient characteristics (i.e., beliefs and capabilities) and context to maximize impact. Without these, feedback may be ineffective.

An additional barrier identified from this work is the limited communication with primary care following discharge. A 2017 National Quality Forum report on ED care transitions [ 49 ] recommended that EDs and their supporting hospital systems should expand infrastructure and enhance health information technology to support care transitions as Veterans may not understand discharge instructions, may not receive post-ED or urgent care, [ 50 , 51 , 52 ] or may not receive a newly prescribed medication. [ 24 ] While there are existing mechanisms to communicate between the ED and primary care teams such as notifications when a Veteran presents to the ED and when an emergency clinician copies a primary care physician on a note, these mechanisms are insufficient to address care transition gaps and are variable in best practice use. To address this variability, the VA ED PACT Tool was developed using best practices (standardized processes, "closed-loop" communication, embedding into workflow) to facilitate and standardize communication between VA EDs and follow-up care clinicians. [ 53 ] While the ED PACT Tool is implemented at the Greater Los Angeles VA and can create a care coordination order upon ED discharge, its use is not yet widely adopted throughout the VA.

In the final theme about technology barriers, once the decision has been made to prescribe a medication, existing electronic tools that are key components of existing stewardship interventions designed to curtail potentially inappropriate prescriptions may be compromised by their lack of usability. For example, clinician and stakeholder interview respondents described how usability concerns were exacerbated in a time-pressured clinical environment (e.g., electronic health record clinical decision support tools). Clinical decision support is an effective tool to improve healthcare process measures in a diverse group of clinical environments; [ 54 ] however, usability remains a barrier when alerts must be frequently overridden. [ 55 , 56 ] Alert fatigue, as expressed in our interviews for order checking and recognized within the VA’s EHR, [ 57 , 58 ] may contribute to excessive overrides reducing the benefit of clinical decision support, [ 56 , 59 ] there was a notable lack of discussion about the decision to initiate appropriate prescriptions, which is a key action of the CDC’s outpatient antibiotic stewardship campaign. [ 18 ] Thus, a potentially more effective, albeit challenging approach, is to “nudge” clinicians towards appropriate prescribing and away from the initial decision to prescribe (e.g., inappropriate antibiotic prescribing for viral upper respiratory tract infections) with either default order sets for symptom management or to enhance prescription decisions through reminders about potential contraindications to specific indications (e.g., high risk comorbidities). Beyond EHR-based solutions that might change clinician behavior, the CDC’s outpatient antibiotic stewardship program provides a framework to change the normative practices around inappropriate prescribing and includes a commitment to appropriate prescribing, action for policy and change, tracking and reporting, and education and expertise. [ 18 ]

Another technical barrier faces patients through patient-facing electronic tools such as the VA’s MyHealtheVet portal, which was developed to enhance patient communication following care transitions and to allow Veterans to review their medications and to communicate with their primary care clinical team. Patient portals can be an effective tool for medication adherence [ 60 ] and offer promise to provide patient education [ 61 ] following a clinical encounter. However, they are similarly limited by usability concerns, representing an adoption barrier to broader Veteran use after unscheduled outpatient care visits [ 62 ], particularly in an older patient population.

These interviews further underscored that lack of usability of clinical decision support for order checking that arises from ineffective design and is a key barrier preventing health information technology from reaching its promise of improving patient safety. [ 63 ] A common and recognized reason for these design challenges include the failure to place the user (i.e., acute care clinician) at the center of the design process resulting in underutilization, workarounds, [ 64 ] and unintended consequences, [ 65 ] all of which diminish patient safety practices and fail to change clinician behavior (i.e., prescribing). Complex adaptive systems work best when the relative strengths of humans (e.g., context sensitivity, situation specificity) are properly integrated with the information processing power of computerized systems. [ 66 ] One potential approach to address usability concerns is through the integration of user-centered design into technology design represents an opportunity to design more clinician- and patient-centric systems of care to advance prescribing stewardship interventions that may have lacked broader adoption previously. As antimicrobial stewardship and additional prescribing stewardship efforts focus on time-pressured environments where usability is essential to adoption, taking a user-centered design approach to not only the development of electronic tools but also in addressing the identified barriers in prescribing represents a promising approach to enhance the quality of prescribing.

Limitations

The study findings should be considered in light of its limitations. First, the setting for this work was the Veterans Health Administration, the largest integrated health system in the US. Also, while we focused on the stewardship of two drug classes, there are numerous additional drug classes that are prescribed in these settings. Studies in other settings or on other drug classes may not generalize to other settings and drug classes. Second, while clinicians and stakeholder perspectives included diverse, national representation, the Veterans interviewed were local to the Tennessee Valley Healthcare System. Given the concurrent COVID-19 pandemic at the time of enrollment, most of the Veterans were seen for pain-related complaints, and only two infectious-related complaints were included. However, we also asked them about antibiotic prescribing. Clinician and stakeholder narratives may not completely reflect their practice patterns as their responses could be influenced by social desirability bias. Third, responses may be subject to recall bias and may influence the data collected. Finally, the themes and subthemes identified may overlap and have potential interactions. While we used an iterative process to identify discrete themes and subthemes, prescription decisions represent a complex decision process that are influenced by numerous patient and contextual factors and may not be completely independent.

Despite numerous interventions to improve the quality of prescribing, the appropriate prescription of antibiotics and NSAIDs in unscheduled outpatient care settings remains a challenge. Using the Veterans Health Administration, this study found that challenges to high quality prescribing include perceived Veteran expectations about receipt of medications, a hectic clinical environment deprioritizing stewardship, limited clinician knowledge, awareness, and willingness to use evidence-based care, uncertainty about the potential for adverse events, limited communication, and technology barriers. Findings from these interviews suggest that interventions should consider the detrimental impact of high workload on prescribing stewardship, clinician workflow, the initial decision to prescribe medications, and incorporate end-users into the intervention design process. Doing so is a promising approach to enhance adoption of high quality prescribing practices in order to improve the quality and patient outcomes from NSAID and antibiotic prescribing.

Availability of data and materials

De-identified datasets used and/or analysed during the current study will be made available from the corresponding author on reasonable request.

Leape LL, Brennan TA, Laird N, et al. The nature of adverse events in hospitalized patients. Results of the Harvard Medical Practice Study II. N Engl J Med. 1991;324(6):377–384.

Article   CAS   PubMed   Google Scholar  

Pitts SR, Carrier ER, Rich EC, Kellermann AL. Where Americans get acute care: increasingly, it’s not at their doctor’s office. Health Aff (Millwood). 2010;29(9):1620–9.

Article   PubMed   Google Scholar  

Palms DL, Hicks LA, Bartoces M, et al. Comparison of antibiotic prescribing in retail clinics, urgent care centers, emergency departments, and traditional ambulatory care settings in the United States. Jama Intern Med. 2018;178(9):1267–9.

Article   PubMed   PubMed Central   Google Scholar  

Davis JS, Lee HY, Kim J, et al. Use of non-steroidal anti-inflammatory drugs in US adults: changes over time and by demographic. Open Heart. 2017;4(1):e000550.

Fleming-Dutra KE, Hersh AL, Shapiro DJ, et al. Prevalence of inappropriate antibiotic prescriptions among US ambulatory care visits, 2010–2011. JAMA. 2016;315(17):1864–73.

Shively NR, Buehrle DJ, Clancy CJ, Decker BK. Prevalence of Inappropriate Antibiotic Prescribing in Primary Care Clinics within a Veterans Affairs Health Care System. Antimicrob Agents Chemother. 2018;62(8):e00337–18. https://doi.org/10.1128/AAC.00337-18 .  https://pubmed.ncbi.nlm.nih.gov/29967028/ .

World Health Organization. Global antimicrobial resistance and use surveillance system (GLASS) report: 2022. 2022.

Centers for Disease Control and Prevention. COVID-19: U.S. Impact on Antimicrobial Resistance, Special Report 2022. Atlanta: U.S. Department of Health and Human Services, CDC; 2022.

Google Scholar  

Shehab N, Lovegrove MC, Geller AI, Rose KO, Weidle NJ, Budnitz DS. US emergency department visits for outpatient adverse drug events, 2013–2014. JAMA. 2016;316(20):2115–25.

Fassio V, Aspinall SL, Zhao X, et al. Trends in opioid and nonsteroidal anti-inflammatory use and adverse events. Am J Manag Care. 2018;24(3):e61–72.

PubMed   Google Scholar  

Centers for Disease Control and Prevention. Chronic Kidney Disease Surveillance System—United States. http://www.cdc.gov/ckd . Accessed 21 March 2023.

Cahir C, Fahey T, Teeling M, Teljeur C, Feely J, Bennett K. Potentially inappropriate prescribing and cost outcomes for older people: a national population study. Br J Clin Pharmacol. 2010;69(5):543–52.

Gabriel SE, Jaakkimainen L, Bombardier C. Risk for Serious Gastrointestinal Complications Related to Use of Nonsteroidal Antiinflammatory Drugs - a Metaanalysis. Ann Intern Med. 1991;115(10):787–96.

Zhang X, Donnan PT, Bell S, Guthrie B. Non-steroidal anti-inflammatory drug induced acute kidney injury in the community dwelling general population and people with chronic kidney disease: systematic review and meta-analysis. BMC Nephrol. 2017;18(1):256.

McGettigan P, Henry D. Cardiovascular risk with non-steroidal anti-inflammatory drugs: systematic review of population-based controlled observational studies. PLoS Med. 2011;8(9): e1001098.

Article   CAS   PubMed   PubMed Central   Google Scholar  

Holt A, Strange JE, Nouhravesh N, et al. Heart Failure Following Anti-Inflammatory Medications in Patients With Type 2 Diabetes Mellitus. J Am Coll Cardiol. 2023;81(15):1459–70.

Davey P, Marwick CA, Scott CL, et al. Interventions to improve antibiotic prescribing practices for hospital inpatients. Cochrane Database Syst Rev. 2017;2(2):CD003543.

Sanchez GV, Fleming-Dutra KE, Roberts RM, Hicks LA. Core Elements of Outpatient Antibiotic Stewardship. MMWR Recomm Rep. 2016;65(6):1–12.

May L, Martin Quiros A, Ten Oever J, Hoogerwerf J, Schoffelen T, Schouten J. Antimicrobial stewardship in the emergency department: characteristics and evidence for effectiveness of interventions. Clin Microbiol Infect. 2021;27(2):204–9.

May L, Cosgrove S, L'Archeveque M, et al. A call to action for antimicrobial stewardship in the emergency department: approaches and strategies. Ann Emerg Med. 2013;62(1):69–77 e62.

Veterans Health Administration Emergency Medicine Management Tool. EDIS GeriatricsAgeReport v3.

Cairns C KK, Santo L. National Hospital Ambulatory Medical Care Survey: 2020 emergency department summary tables. NHAMCS Factsheets - EDs Web site. https://www.cdc.gov/nchs/data/nhamcs/web_tables/2020-nhamcs-ed-web-tables-508.pdf . Accessed 20 Dec 2022.

Lowery JL, Alexander B, Nair R, Heintz BH, Livorsi DJ. Evaluation of antibiotic prescribing in emergency departments and urgent care centers across the Veterans’ Health Administration. Infect Control Hosp Epidemiol. 2021;42(6):694–701.

Hastings SN, Sloane RJ, Goldberg KC, Oddone EZ, Schmader KE. The quality of pharmacotherapy in older veterans discharged from the emergency department or urgent care clinic. J Am Geriatr Soc. 2007;55(9):1339–48.

Goodman LA. Snowball sampling. The annals of mathematical statistics. 1961. pp. 148–170.

Damschroder LJ, Aron DC, Keith RE, Kirsh SR, Alexander JA, Lowery JC. Fostering implementation of health services research findings into practice: a consolidated framework for advancing implementation science. Implement Sci. 2009;4:50.

Ajzen I. The theory of planned behavior. Organ Behav Hum Decis Process. 1991;50(2):179–211.

Article   Google Scholar  

Ajzen I. The theory of planned behaviour: reactions and reflections. Psychol Health. 2011;26(9):1113–27.  https://doi.org/10.1080/08870446.2011.613995 .  https://www.tandfonline.com/doi/full/10.1080/08870446.2011.613995 .

Morse JM. The significance of saturation. Qual Health Res. 1995;5(2):147–9.

Azungah T. Qualitative research: deductive and inductive approaches to data analysis. Qual Res J. 2018;18(4):383–400.

Tjora A. Qualitative research as stepwise-deductive induction. Routledge; 2018.  https://www.routledge.com/Qualitative-Research-as-Stepwise-Deductive-Induction/Tjora/p/book/9781138304499 .

Fereday J, Muir-Cochrane E. Demonstrating rigor using thematic analysis: A hybrid approach of inductive and deductive coding and theme development. Int J Qual Methods. 2006;5(1):80–92.

Tong A, Sainsbury P, Craig J. Consolidated criteria for reporting qualitative research (COREQ): a 32-item checklist for interviews and focus groups. Int J Qual Health Care. 2007;19(6):349–57.

Patel A, Pfoh ER, Misra Hebert AD, et al. Attitudes of High Versus Low Antibiotic Prescribers in the Management of Upper Respiratory Tract Infections: a Mixed Methods Study. J Gen Intern Med. 2020;35(4):1182–8.

May L, Gudger G, Armstrong P, et al. Multisite exploration of clinical decision making for antibiotic use by emergency medicine providers using quantitative and qualitative methods. Infect Control Hosp Epidemiol. 2014;35(9):1114–25.

Staub MB, Pellegrino R, Gettler E, et al. Association of antibiotics with veteran visit satisfaction and antibiotic expectations for upper respiratory tract infections. Antimicrob Steward Healthc Epidemiol. 2022;2(1): e100.

Schroeck JL, Ruh CA, Sellick JA Jr, Ott MC, Mattappallil A, Mergenhagen KA. Factors associated with antibiotic misuse in outpatient treatment for upper respiratory tract infections. Antimicrob Agents Chemother. 2015;59(7):3848–52.

Hruza HR, Velasquez T, Madaras-Kelly KJ, Fleming-Dutra KE, Samore MH, Butler JM. Evaluation of clinicians’ knowledge, attitudes, and planned behaviors related to an intervention to improve acute respiratory infection management. Infect Control Hosp Epidemiol. 2020;41(6):672–9.

American College of Emergency Physicians Policy Statement. Crowding. https://www.acep.org/globalassets/new-pdfs/policy-statements/crowding.pdf . Published 2019. Accessed 11 Oct 2023.

Bernstein SL, Aronsky D, Duseja R, et al. The effect of emergency department crowding on clinically oriented outcomes. Acad Emerg Med. 2009;16(1):1–10.

Rasouli HR, Esfahani AA, Nobakht M, et al. Outcomes of crowding in emergency departments; a systematic review. Arch Acad Emerg Med. 2019;7(1):e52.

PubMed   PubMed Central   Google Scholar  

Janke AT, Melnick ER, Venkatesh AK. Monthly Rates of Patients Who Left Before Accessing Care in US Emergency Departments, 2017–2021. JAMA Netw Open. 2022;5(9): e2233708.

Janke AT, Melnick ER, Venkatesh AK. Hospital Occupancy and Emergency Department Boarding During the COVID-19 Pandemic. JAMA Netw Open. 2022;5(9): e2233964.

Lavoie CF, Plint AC, Clifford TJ, Gaboury I. “I never hear what happens, even if they die”: a survey of emergency physicians about outcome feedback. CJEM. 2009;11(6):523–8.

Ivers N, Jamtvedt G, Flottorp S, et al. Audit and feedback: effects on professional practice and healthcare outcomes. Cochrane Database Syst Rev. 2012;(6):CD000259. https://doi.org/10.1002/14651858.CD000259.pub3 .

Hysong SJ, SoRelle R, Hughes AM. Prevalence of Effective Audit-and-Feedback Practices in Primary Care Settings: A Qualitative Examination Within Veterans Health Administration. Hum Factors. 2022;64(1):99–108.

Presseau J, McCleary N, Lorencatto F, Patey AM, Grimshaw JM, Francis JJ. Action, actor, context, target, time (AACTT): a framework for specifying behaviour. Implement Sci. 2019;14(1):102.

Desveaux L, Ivers NM, Devotta K, Ramji N, Weyman K, Kiran T. Unpacking the intention to action gap: a qualitative study understanding how physicians engage with audit and feedback. Implement Sci. 2021;16(1):19.

National Quality Forum. Emergency Department Transitions of Care: A Quality Measurement Framework—Final Report: DHHS contract HHSM‐500–2012–000091, Task Order HHSM‐500‐T0025. Washington, DC: National Quality Forum; 2017.

Kyriacou DN, Handel D, Stein AC, Nelson RR. Brief report: factors affecting outpatient follow-up compliance of emergency department patients. J Gen Intern Med. 2005;20(10):938–42.

Vukmir RB, Kremen R, Ellis GL, DeHart DA, Plewa MC, Menegazzi J. Compliance with emergency department referral: the effect of computerized discharge instructions. Ann Emerg Med. 1993;22(5):819–23.

Engel KG, Heisler M, Smith DM, Robinson CH, Forman JH, Ubel PA. Patient comprehension of emergency department care and instructions: are patients aware of when they do not understand? Ann Emerg Med. 2009;53(4):454–461 e415.

Cordasco KM, Saifu HN, Song HS, et al. The ED-PACT Tool Initiative: Communicating Veterans’ Care Needs After Emergency Department Visits. J Healthc Qual. 2020;42(3):157–65.

Bright TJ, Wong A, Dhurjati R, et al. Effect of clinical decision-support systems: a systematic review. Ann Intern Med. 2012;157(1):29–43.

Weingart SN, Toth M, Sands DZ, Aronson MD, Davis RB, Phillips RS. Physicians’ decisions to override computerized drug alerts in primary care. Arch Intern Med. 2003;163(21):2625–31.

van der Sijs H, Aarts J, Vulto A, Berg M. Overriding of drug safety alerts in computerized physician order entry. J Am Med Inform Assoc. 2006;13(2):138–47.

Shah T, Patel-Teague S, Kroupa L, Meyer AND, Singh H. Impact of a national QI programme on reducing electronic health record notifications to clinicians. BMJ Qual Saf. 2019;28(1):10–4.

Lin CP, Payne TH, Nichol WP, Hoey PJ, Anderson CL, Gennari JH. Evaluating clinical decision support systems: monitoring CPOE order check override rates in the Department of Veterans Affairs’ Computerized Patient Record System. J Am Med Inform Assoc. 2008;15(5):620–6.

Middleton B, Bloomrosen M, Dente MA, et al. Enhancing patient safety and quality of care by improving the usability of electronic health record systems: recommendations from AMIA. J Am Med Inform Assoc. 2013;20(e1):e2-8.

Han HR, Gleason KT, Sun CA, et al. Using Patient Portals to Improve Patient Outcomes: Systematic Review. JMIR Hum Factors. 2019;6(4): e15038.

Johnson AM, Brimhall AS, Johnson ET, et al. A systematic review of the effectiveness of patient education through patient portals. JAMIA Open. 2023;6(1):ooac085.

Lazard AJ, Watkins I, Mackert MS, Xie B, Stephens KK, Shalev H. Design simplicity influences patient portal use: the role of aesthetic evaluations for technology acceptance. J Am Med Inform Assoc. 2016;23(e1):e157-161.

IOM. Health IT and Patient Safety: Building Safer Systems for Better Care. Washington, DC: NAP;2012.

Koppel R, Wetterneck T, Telles JL, Karsh BT. Workarounds to barcode medication administration systems: their occurrences, causes, and threats to patient safety. J Am Med Inform Assoc. 2008;15(4):408–23.

Ash JS, Sittig DF, Poon EG, Guappone K, Campbell E, Dykstra RH. The extent and importance of unintended consequences related to computerized provider order entry. J Am Med Inform Assoc. 2007;14(4):415–23.

Hollnagel E, Woods D. Joint Cognitive Systems: Foundations of Cognitive Systems Engineering. Boca Raton: CRC Press; 2006.

Download references

Acknowledgements

This material is based upon work supported by the Department of Veterans Affairs, Veterans Health Administration, Office of Research and Development, Health Services Research and Development (I01HX003057). The content is solely the responsibility of the authors and does not necessarily represent the official views of the VA.

Author information

Authors and affiliations.

Education, and Clinical Center (GRECC), VA , Geriatric Research, Tennessee Valley Healthcare System, 2525 West End Avenue, Ste. 1430, Nashville, TN, 37203, USA

Michael J. Ward, Michael E. Matheny & Amanda S. Mixon

Medicine Service, Tennessee Valley Healthcare System, Nashville, TN, USA

Michael J. Ward

Department of Emergency Medicine, Vanderbilt University Medical Center, Nashville, TN, USA

Michael J. Ward & Melissa D. Rubenstein

Department of Biomedical Informatics, Vanderbilt University Medical Center, Nashville, TN, USA

Michael J. Ward, Michael E. Matheny, Shilo Anders & Thomas Reese

Department of Biostatistics, Vanderbilt University Medical Center, Nashville, TN, USA

Michael E. Matheny

Division of General Internal Medicine & Public Health, Vanderbilt University Medical Center, Nashville, TN, USA

Department of Psychology, Vanderbilt University, Nashville, TN, USA

Kemberlee Bonnet, Chloe Dagostino & David G. Schlundt

Center for Research and Innovation in Systems Safety, Vanderbilt University Medical Center, Nashville, TN, USA

Shilo Anders

Section of Hospital Medicine, Vanderbilt University Medical Center, Nashville, TN, USA

Amanda S. Mixon

You can also search for this author in PubMed   Google Scholar

Contributions

Conceptualization: MJW, ASM, MEM, DS, SA. Methodology: MJW, ASM, MEM, DS, KB, SA, TR. Formal analysis: KB, DS, CD, MJW. Investigation: MJW, MDR, DS. Resources: MJW, MEM. Writing—Original Draft. Preparation: MJW, ASM, KB, MDR. Writing—Review & Editing: All investigators. Supervision: MJW, ASM, MEM. Funding acquisition: MJW, MEM.

Corresponding author

Correspondence to Michael J. Ward .

Ethics declarations

Ethics approval and consent to participate.

This study was approved by the VA Tennessee Valley Healthcare System Institutional Review Board as minimal risk (#1573619). A waiver of informed consent was approved and each subject was verbally consented prior to interviews. The IRB determined that all requirements set forth in 38CFR16.111 in accordance for human subjects research have been satisfied. All the methods were carried out according the relevant guidelines and regulations.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Supplementary material 1., rights and permissions.

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ . The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Cite this article.

Ward, M.J., Matheny, M.E., Rubenstein, M.D. et al. Determinants of appropriate antibiotic and NSAID prescribing in unscheduled outpatient settings in the veterans health administration. BMC Health Serv Res 24 , 640 (2024). https://doi.org/10.1186/s12913-024-11082-0

Download citation

Received : 11 October 2023

Accepted : 07 May 2024

Published : 18 May 2024

DOI : https://doi.org/10.1186/s12913-024-11082-0

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Non-Steroidal Anti-Inflammatory Drugs
• Antibiotics
• Qualitative Methods
• Emergency Department
• Urgent Care
• Primary Care
• Prescribing Stewardship

BMC Health Services Research

ISSN: 1472-6963

• General enquiries: [email protected]

• Open access
• Published: 17 May 2024

The rhizosphere microbiome and its influence on the accumulation of metabolites in Bletilla striata (Thunb.) Reichb. f

• Shiqing Li 1   na1 ,
• Xiaomei Li 1   na1 ,
• Yueyu Ye 1   na1 ,
• Man Chen 1   na1 ,
• Haimin Chen 2 ,
• Dongfeng Yang 2 ,
• Meiya Li 3 ,
• Fusheng Jiang 4 ,
• Xiaobo Zhang 1 &
• Chunchun Zhang 1  

BMC Plant Biology volume  24 , Article number:  409 ( 2024 ) Cite this article

143 Accesses

Metrics details

Bletilla striata (Thunb.) Reichb. f. ( B. striata ) is a perennial herbaceous plant in the Orchidaceae family known for its diverse pharmacological activities, such as promoting wound healing, hemostasis, anti-inflammatory effects, antioxidant properties, and immune regulation. Nevertheless, the microbe-plant-metabolite regulation patterns for B. striata remain largely undetermined, especially in the field of rhizosphere microbes. To elucidate the interrelationships between soil physics and chemistry and rhizosphere microbes and metabolites, a comprehensive approach combining metagenome analysis and targeted metabolomics was employed to investigate the rhizosphere soil and tubers from four provinces and eight production areas in China.

Our study reveals that the core rhizosphere microbiome of B. striata is predominantly comprised of Paraburkholderia , Methylibium , Bradyrhizobium , Chitinophaga , and Mycobacterium . These microbial species are recognized as potentially beneficial for plants health. Comprehensive analysis revealed a significant association between the accumulation of metabolites, such as militarine and polysaccharides in B. striata and the composition of rhizosphere microbes at the genus level. Furthermore, we found that the soil environment indirectly influenced the metabolite profile of B. striata by affecting the composition of rhizosphere microbes. Notably, our research identifies soil organic carbon as a primary driving factor influencing metabolite accumulation in B. striata .

Our fndings contribute to an enhanced understanding of the comprehensive regulatory mechanism involving microbe-plant-metabolite interactions. This research provides a theoretical basis for the cultivation of high-quality traditional Chinese medicine B. striata.

Peer Review reports

The concept of rhizosphere soil was first proposed by German scientist Hiltner in 1904 to describe the soil influenced by plant roots, which subsequently prompted research into rhizosphere microbes. These microbes are attracted by plant root exudates [ 1 , 2 , 3 ] and are abundant in rhizosphere soil, exerting a significant impact on various aspects of plant biology, including nutrition [ 4 , 5 ], growth [ 6 , 7 ], disease resistance, and stress tolerance [ 8 , 9 , 10 ]. In recent years, an increasing number of studies have shown that biological factors such as endophytes and rhizosphere microbes directly or indirectly affect the growth, traits, metabolism, and other attributes of medicinal plants. Consequently, this leads to variations in the quality of medicinal plants across different regions and environments. For example, Su et al. [ 11 ] observed an enrichment of terpenoid backbone biosynthetic genes in the rhizosphere of Citrus reticulata ‘Chachi’ within its core area compareed to non-core areas. Furthermore, they demonstrated that inoculation with Strep-4, a strain of isolated Streptomyces abundant in core rhizosphere soil, significantly increased the concentration of monoterpenes in Citrus reticulata ‘Chachi’. Additionally, Zhong et al. [ 12 ] through a comprehensive analysis involving microbe-plant-metabolites inferred that Lysobacter and Rhodoplanes in the rhizosphere of Glycyrrhiza uralensis Fisch could affect the accumulation of liquiritin and glycyrrhizic acid.

B. Striata, a perennial herbaceous plant belonging to the Orchidaceae family, is primarily distributed in southern Shaanxi, southeastern Gansu, Jiangsu, Anhui, Zhejiang, and other regions of China. Modern research has highlighted the significant role of B. striata in wound healing [ 13 , 14 , 15 , 16 ], hemostasis [ 17 ], anti-inflammatory [ 18 ], antioxidant [ 19 , 20 ], whitening [ 21 , 22 ], and immune regulatory activity [ 23 ]. Current researches on B. striata components are mainly focused on isolating and identifying chemical compounds [ 24 , 25 ], quality control [ 26 ], and pharmacological activities [ 27 , 28 ]. Research into factors influencing the quality of B. striata mainly focuses on varieties, cultivation and planting techniques, processing methods, and other aspects [ 29 , 30 , 31 ]. In terms of microecology, most studies have mainly focused on endophytic fungi [ 32 ] and mycorrhizal fungi [ 33 , 34 , 35 ]. However, there have been no reports regarding the composition, diversity, and function of rhizosphere microbes in B. striata , and there are limited studies on the correlation between B. striata quality and biological factors, especially in the field of rhizosphere microbes.

Samples of fresh B. striata tubers, bulk soil, and rhizosphere soil were collected from eight production areas spanning four provinces in China. A comprehensive approach involving targeted metabolomics, amplicon sequencing, and metagenomic sequencing techniques, combined with structural equation modeling (SEM) was employed to explore the interrelationships between soil physics and chemistry and rhizosphere microbes and metabolites. This study aims to provide a theoretical basis for the cultivation of high-quality traditional Chinese medicine B. striata .

Taxonomic characteristics of rhizosphere microbes in B. striata

The taxonomic composition of the rhizosphere microbes of B. striata was determined through metagenomic sequencing, supplemented by amplicon sequences, to obtain taxonomic annotation results: prokaryotes (bacteria and archaea) accounted for 99.01% of the total annotations, eukaryotes accounted for 0.96% of the total annotations, and virus genes only accounted for 0.02% of the total annotations. The main bacterial phyla found in the rhizosphere soil of B. striata included Proteobacteria, Actinobacteria, Acidobacteria, and Bacteroidetes, while the fungal phyla were Ascomycota, Basidiomycota, and Mucor mycota (Fig.  1 A).

Comparison of the composition and diversity of rhizosphere microbial communities in B. striata from different areas. A Rhizosphere microbial composition at the phylum level, based on amplicon sequence and metagenomic data. B Metagenomic data for non-metric multidimensional scaling (NMDS) analysis based on the Bray Curtis distance. C Shannon index of the alpha diversity of rhizosphere microbes of B. striata in different habitat regions, based on the amplicon data (solid line represents the median Shannon index, and dashed line represents the mean Shannon index)

Utilizing three non-parametric indices (Chao1, Shannon, and Simpson indices) to assess the rhizosphere soil samples, significant differences in alpha diversity of rhizosphere microbes from different origins were observed (Kruskal Wallis test, bacteria, H = 30, p  < 0.01; fungi, H = 33, p  < 0.01). Notably, the diversity of bacterial and fungal communities in the rhizosphere soil of Guilin, Guangxi was significantly lower than that of other production areas (Fig.  1 B). NMDS analysis based on Bray Curtis distance revealed significant differences in the composition of rhizosphere microbial communities of B. striata among different habitats (Fig.  1 C). Furthermore, we compared the relative abundance of rhizosphere microbes in different habitats between high (phyla) and low (genus) classification levels through metagenomic sequences. We identified multiple bacterial phyla with higher relative abundance in the B. striata rhizosphere in Jinzhai, Anhui, and Guilin, Guangxi such as Proteobacteria, while Actinobacteria had a higher relative abundance in Lishui, Zhejiang (Supplementary Fig. 1A). Various bacterial genera including Sphingobium and Burkholderia exhibited significant differences in enrichment within the B. striata rhizosphere across diverse habitats (Supplementary Fig. 1B). Moreover, there are unique and differential species of rhizosphere microbes present within B. striata from different origins. Microbes with an LDA score > 4 were selected as differential species revealing all unique and differential microbes concentrated within the bacterial domain. Notably B. striata from Lishui, Zhejiang, displayed the most significant differential microbial species reaching up to 15 species within its respective rhizospheric environment (Supplementary Fig. 2).

Analysis of the characteristics of the rhizosphere core microbes of B. striata . A Co-occurrence network analysis diagram of the rhizosphere microbes of B. striata at the genus level. Nodes represent microbial genera, node size represents the degree, and the thickness of the line between nodes indicates the size of the correlation coefficient between them. The edge represents the Spearman’s correlation coefficient ( R  > 0.6, p  < 0.05). B Core microbial groups at the genus level with significant centrality (a measure of the importance of nodes). C Core microbial groups at the species level. D Analysis diagram of the co-occurrence network of the rhizosphere microbes at the species level

Core taxa of rhizosphere microbial community in B. striata

Given the metagenomic sequence’s ability to offer comprehensive taxonomic information and consistent community composition results with amplicon sequencing, it was chosen for identifying the core rhizosphere microbial communities of B. striata . Following the methodology outlined by Dong [ 36 ] and Xu J [ 37 ], the core group standard of rhizosphere was determined by taking into account all the habitats of B. striata ; microbial communities or species existed in over 75% of B. striata samples, and their relative abundance was greater than 0.01%. Additionally, shared network analysis was conducted using Spearman’s correlation coefficient ( p ), where an absolute value greater than 0.6 was utilized as a threshold for inclusion.

Based on genus-level analysis, the core taxonomic group of the microbial community formed a rhizosphere microbial network consisting of 83 nodes and 448 edges (Fig.  2 A). The average path length between all node pairs was 2.5, with an average degree of 10.8, a clustering coefficient of 0.50, and a modularity index of 0.43. According to network connectivity statistics (degree, closeness centrality, and betweenness centrality), Paraburkholderia , Methylibium , Bradyrhizobium , Chitinophaga , and Mycobacterium were defined as the core rhizosphere microbial genera (Fig.  2 B), all belonging to the phylum Proteobacteria.

Based on species-level analysis, the core taxonomic group of the microbial community was obtained, and the rhizosphere microbial network of B. striata included 128 nodes and 1089 edges (Fig.  2 D). The average path length between all node pairs was 2.4 edges, with an average degree of 17, a clustering coefficient of 0.51, and a modularity index of 0.41. In accordance with the network connectivity statistics, Paraburkholderia_sp._PGU19 , Paraburkholderia_terrae , Burkholderia_sp._YI23 , Rhizobium_pusense , and Bradyrhizobium_sp. CCBAU_51753 , Bradyrhizobium_diazoefficiens and Rhizobium_pusense , were identified as core rhizosphere microbial species (Fig.  2 C), with two species belonging to Paraburkholderia and two species belonging to Bradyrhizobium . These findings are consistent with the core rhizosphere microbial community at the genus level. Moreover, as depicted in Fig.  2 D, there was a positive correlation among microbial species within the genus Bradyrhizobium , such as Bradyrhizobium diazoefficiens , Bradyrhizobium_ottawaense , Bradyrhizobium_sp._144S4 , and Bradyrhizobium_ sp._LCT2 , indicating that synergistic effects are more likely to occur when microbial species belong to the same genus.

Functional characteristics analysis of rhizosphere microbes in the rhizosphere of B. striata

Through an analysis of the KEGG Orthology (KO) database, a total of 6153 KOs were identified from rhizosphere samples, and 47 annotated KEGG secondary pathways. Notably, the most prevalent metabolic pathways included amino acid metabolism, carbohydrate metabolism, and metabolism of cofactors and vitamins metabolism, accounting for 12.75%, 11.43%, and 8.19%, respectively. Referring to the method of Xu et al. [ 37 ], a rhizosphere enrichment threshold of 75% was utlized to define the core functional characteristics of the rhizosphere microbiome of B. striata . These core functional features primarily encompass microbial interactions with both host plants, and other microbes, as well as potential nutrient acquisition pathways in which rhizosphere microbes may be involved. According to the top 50 functional pathways at level 3 (Fig.  3 ), it was found that pathways related to plant–microbe and microbe-microbe interactions, such as flagella assembly, bacterial chemotaxis, and carbon fixation pathways in prokaryotes, are centrally expressed in the rhizosphere microbes of B. striata . Based on the analysis of KEGG level 3 functional pathways, we found that rhizosphere microbes of B. striata have rich amino acid synthesis and metabolism pathways (including alanine aspartate glutamate metabolism, histidine metabolism, glycine, serine, and threonine metabolism, cysteine and methionine metabolism, arginine biosynthesis, and valine, leucine, and isoleucine biosynthesis) (Fig.  3 ). In addition, many core rhizosphere KOs may also benefit plants by participating in multiple nutrient acquisition pathways, such as phosphate transport (pstA, pstB, pstC, pstS, phnC, phnD, phnE, phnF, phoU) and phosphate regulatory responses (phoB, phoP, phoR, ompR, regX3) (Fig.  4 ).

Heat map analysis of the top 50 functional pathways at Level 3

Core rhizosphere KO grouping and clustering heatmap

Previous studies have highlighted the potential for microbial metabolic capacity and related genes to contribute to the synthesis of medicinally active ingredients in medicinal plants [ 38 ]. For instance, preliminary screenings by Liu et al. [ 39 ] suggested that specific genes such as bgIX (β-d-Glucosidases), otsB (trehalose-phosphate phosphatase), TPS (trehalose-6-phosphate synthase), and GAE (UDP-glucuronate 4-epimerase) may play pivotal roles in militarine synthesis. Additionally, Niu et al. [ 40 ] provided molecular-level insights into the pathway of BSP ( B. striata polysaccharide) synthesis and metabolism. Therefore, the current investigation focuses on identifying key genes involved in the biosynthesis pathways of militarine and BSP within the rhizosphere microbes of B. striata. A comprehensive analysis conducted across various production areas revealed a richness of genes related to militarine synthesis in the rhizosphere microbiota of Anhui Jinzhai, including bgIX and GAE. In contrast, Liupanshui in Guizhou exhibited an abundance of genes associated with militarine synthesis, such as GAE and TPS. Research has indicated that bgIX encodes β-D-glucosidase, a crucial enzyme in cellulose degradation, which possesses both glycoside hydrolysis and glycosyltransferase activities [ 41 ]. The GAE gene encodes UDP-glucuronate 4-epimerase, which plays an important regulatory role in sugar transport, mainly catalyzing the mutual transformation of UDP-glucuronic acid and UDP-D-Galacturonic acid [ 42 ]. The TPS gene is capable of catalyzing the synthesis of trehalose 6-phosphate from UDP-glucose and glucose-6-phosphate, ultimately leading to enhanced trehalose accumulation and improved plant stress resistance. Furthermore, it has been observed that overexpression of TPS also modulates the expression of genes associated with plant abscisic acid, glucose, and anthocyanin synthesis pathways [ 43 ]. Militarine is a glycoside compound found in abundance in B. striata , and it is formed through the dehydration of the hydroxyl amino thiol group of monosaccharides or oligosaccharides and the hemiacetal hydroxyl group of another molecule. Based on metabolome and transcriptome analysis of B. striata suspension culture cells, as well as fluorescence quantitative PCR validation, Liu et al. [ 39 ] proposed that bgIX, TPS, and GAE genes are closely associated with the biological synthesis and accumulation of militarine. Therefore, it is suggested that the rhizosphere microbes of B. striata from these two regions may possess significant potential for promoting militarine biosynthesis (Fig. 5 A and B). The GAE genes enriched in both regions were annotated into 15 genera and 21 species across all regions, with a predominant presence of microbial species such as Bradyrhizobium japonicum, Agrobacterium tumefaciens, Pseudomonas putida, and Rhizobium tropici. Notably, four of these species belonged to the genus Rhizobium (Fig.  5 C). The heat map analysis revealed that the abundance of most of the 21 species annotated by GAE was significantly higher in Jinzhai and Anhui compared to other production areas (Supplementary Fig. 3), aligning with the high expression levels of GAE genes. This consistency indicates a high level of data reliability. Furthermore, our analysis identified that pivotal genes associated with the biosynthesis of BSP within rhizosphere microbiota from diverse habitats, such as pmm, UGP2, GPI, manA, and scrK, demonstrated heightened expression levels in Guilin, Guangxi and Pan'an, Zhejiang (Fig. 5 D).

Analysis of the functional characteristics of the rhizosphere microbial community in B. striata . A After zero mean normalization, the abundance heat map analysis of 11 genes related to militarine biosynthesis. B Circos diagram of microbes that may be involved in militarine biosynthesis. C Species-stratified histogram of the GAE gene in militarine biosynthesis. D Biosynthetic pathway of BSP

Analysis of the correlation between soil factors and rhizosphere microbes of B. striata

The results of the soil physical and chemical properties from the eight production areas are shown in Fig.  6 A. It was observed that the soil pH varied significantly among different production areas, generally exhibiting weak acidity. The highest pH value was found in the soil from the Guangxi Medical Botanical Garden production area. Additionally, a notable finding was the significantly higher soil organic carbon content in Liupanshui, Guizhou, compared to other producing areas ( p  < 0.05). Previous research has indicated that soil physicochemical properties not only influence soil fertility but also play a role in shaping the structure and diversity of rhizosphere microbiota [ 44 ]. The correlation heat map showed a significant negative correlation ( p  < 0.01) between Paraburkholderia and soil-available potassium and soil pH, consistent with the correlations involving four microbial species belonging to Paraburkholderia (Fig.  6 B). Redundancy analysis (RDA) revealed that various soil physical and chemical factors affect the composition of the rhizosphere microbial community of B. striata , with soil-available nitrogen and soil organic carbon being the main factors affecting the composition of the rhizosphere microbial community (Fig.  6 C). Upon analyzing the top 20 KOs with the highest degree of correlation between rhizosphere microbes and soil physicochemical factors, we observed a strong positive correlation between soil-available nitrogen and most of these KOs, indicating a significant association between soil-available nitrogen levels and the majority of the identified KOs (Fig.  6 D).

Correlation analysis between rhizosphere microbes and soil physicochemical factors in B. striata . A Inverted diagram of the soil physical and chemical properties from different production areas. B Heat map analysis of the correlation between the composition of rhizosphere microbial communities and the soil physical and chemical properties. C RDA of microbial community composition and soil physicochemical properties in the rhizosphere of B. striata. D RDA of the top 20 KOs in the rhizosphere microbes of B. striata and soil physicochemical properties

Analysis of factors influencing the metabolic accumulation of B. striata tubers.

Using HPLC and sulfuric acid-phenol methods, the metabolite content in B. striata tubers from various regions was analyzed. The findings revealed significantly higher levels of the indicator component, militarine, in B. striata tubers from Liupanshui, Guizhou and Lishui, Zhejiang compared to other regions. And the content of BSP was found to be consistent with that of militarine (Table  1 ). A correlation analysis was conducted examine the relationship between metabolic components and environmental factors, including the microbiome and soil physicochemical properties. The results showed a significant positive correlation between available soil nitrogen, soil organic carbon, rhizosphere microbial diversity, and rhizosphere microbial function. There was a significant positive correlation between metabolites of B. striata and soil organic carbon, especially the metabolites of militarine, BSP, batatasin III, blestriarene A, and coelonin (Fig. 7 A and C). Furthermore, we employed structural equation modeling to investigate the influence of biological and abiotic factors on metabolite accumulation in B. striata . The results demonstrated that bacterial composition (path coefficient = 0.58, p  < 0.001), fungal composition (path coefficient = 0.27, p  < 0.001), soil organic carbon (path coefficient = 1.7, p  < 0.001), soil-available phosphorus (path coefficient = 1, p  < 0.001), and soil-available potassium (path coefficient = 0.38, p  < 0.001) had direct and significantly effects on metabolite accumulation in B. striata . Soil organic carbon, alkaline nitrogen, and pH were identified as indirect influencers of B. striata metabolite accumulation through their impact on the composition of bacteria and fungi (Fig. 7 B). After standardizing the effect values, we found that soil organic carbon had the highest direct and total effects (Fig. 7 D), indicating that soil organic carbon was the most important driving factor affecting metabolite accumulation in B. striata . In addition, the structural model also indicated that fungal community composition had a certain positive regulatory effect on bacterial community composition (path coefficient = 0.74, p  < 0.001). However, compared to the composition of fungal communities, the composition of bacterial communities played a more important role in metabolite accumulation in B. striata . In summary, considering the intricate interactions among soil, plants, and rhizosphere microbial communities, both abiotic and biological factors have distinct effects on metabolite accumulation in B. striata .

Analysis of the factors affecting metabolite accumulation in B. striata . A Correlation heat map of environmental factor indicators. Spearman's correlation coefficient is represented by the color gradient. Using the Mantel test, a correlation analysis was conducted between the metabolites of B. striata and each influencing factor. The edge width corresponds to Mantel's r statistic of the distance correlation, and the edge color represents statistical significance. B Structural equation modeling: Red represents positive correlation, blue represents negative correlation, and the words on the line represent path coefficients; *** p  < 0.001, ** p  < 0.01, and * p  < 0.05. Model fitness indicated that the model was good: χ 2 / df = 0.88, P  = 0.415, GFI = 1, SRMR = 0.003. C Heat map showing the correlations between environmental factors and various metabolites. D Bar chart showing the standardized effects (direct, indirect, and total) based on the structural equation model

The rhizosphere, an ecological niche facilitating interactions among plant, soil, and microorganisms, is a highly active zone for material and energy exchange [ 45 ]. Plants have the ability to influence the composition of rhizosphere microbiota through secretions and immune systems. Concurrently, rhizosphere microbes actively participate in processes, such as plant development, nutrient absorption, and stress response, through metabolic activities [ 46 , 47 ]. Consequently, the rhizosphere microbiota serves as a critical factor influencing the intricate relationships between plants, soil, and microbes while playing a pivotal role in maintaining plant health. The results of this study showed that the dominant microbes in the rhizosphere of B. striata were mainly prokaryotes, which accounted for 99% of the total microbial community. Among these, Proteobacteria emerged as the dominant phylum, followed by Actinobacteria, Acidobacteria, and Bacteroidetes. Zuo et al. [ 48 ]found that Proteobacteria, Acidobacteria, Actinobacteria, and Bacteroidetes are the dominant bacterial groups in the rhizosphere of Dendrobium officinale . Similarly, high-throughput Illumina MiSeq sequencing of the rhizosphere soil of Gymnadenia conopsea identified Proteobacteria, Actinobacteria, Acidobacteria, and Bacteroidetes as the main groups [ 49 ]. Our findings corroborate these results, and it appears that Proteobacteria, Acidobacteria, Actinobacteria, and Bacteroidetes are the predominant bacterial communities in orchid plant rhizospheres. However, it is noteworthy that these microbiota communities have also been observed in the rhizosphere soils of other plants, such as Ageratina adenophora [ 50 ], Broussonetia papyrifera , Ligustrum lucidum [ 51 ] , Artemisia ordosica and Caragana intermedia [ 52 ]. Therefore, at the phylum level, they are more likely to constitute the predominant bacterial community in the majority of plant rhizosphere soils. Nevertheless, significant variations were observed in the relative abundances of dominant bacterial groups within the rhizosphere of B. striata across different regions. Notably, Actinobacteria exhibited the highest relative abundance in the B. striata rhizosphere of Lishui, Zhejiang. Furthermore, substantial difference were also noted in the enrichment of microbial groups at the genus level within the B. striata rhizosphere. For instance, Kaitobacter emerged as the dominant bacterial genus in Wuhu, Anhui and Jinzhai; meanwhile, Humicola was identified as the dominant fungal genus in Liupanshui, Guizhou, and Paraboeremia held dominance in Lishui, Zhejiang. It is noteworthy that Kaitobacter is a functional microbial group involved in carbon assimilation, and plays a pivotal role in ferrous oxidation-coupled carbon fixation processes. This not only contributes to an increase in organic carbon content within soil but also effectively mitigates heavy metal pollution risks [ 53 ]. Humicola can produce metabolites with unique biological activity and diverse structures [ 54 ], which may have an impact on the growth and development of B. striata . Paraboeremia is the most common and dominant fungal genus associated with the roots of Calanthe orchid species [ 55 ]. It is capable of symbiosis with orchids and plays a crucial role in their growth and development [ 56 ]. Furthermore, β diversity analysis showed that there were significant differences in the rhizosphere microbiota of B. striata from different habitats, indicating that geographical environment exerts a discernible influence on the composition of the rhizosphere microbiota.

The core microbiota, as a key component of the basic functions of the host holographic body, can not only directly play a beneficial role but can also influence a wider range of microbial communities through community cascade effects, thereby promoting the evolution and function of microbial communities [ 38 , 57 , 58 ]. We obtained five core rhizosphere microbial groups, Paraburkholderia, Methylibium, Bradyrhizobium, Chitinophaga, and Mycobacterium, through network coexistence analysis in the rhizosphere soil of eight different production areas. According to reports, Paraberkholderia demonstrates extensive metabolic capacity, with certain species possessing nitrogen fixation ability [ 59 , 60 , 61 ] and antifungal properties [ 62 ], particularly the potential for degradation of aromatic compounds, making it particularly suitable for bioremediation applications involving such compounds [ 63 ]. As a methylotrophic bacterium, Methylobacterium not only utilizes single carbon compounds as a carbon and energy source for growth but also metabolizes and produces various beneficial byproducts, such as plant hormones, iron carriers, and vitamin B12, as a result of promoting plant growth [ 64 , 65 ]. Bradyrhizobium, the main nitrogen-fixing microbiota, can convert free nitrogen into nitrogen-containing compounds that can be directly absorbed and utilized by plants through biological nitrogen fixation, playing a significant role in plant growth and development. Research on the fruit bodies of ectomycorrhizal fungi found that Chitinophaga is almost a specific genus of bacteria that occurs almost exclusively in Cantharelluss and inferred that it is closely related to the functional requirements of Cantharelluss [ 66 , 67 ]. Additionally, at the species level, we found that two of the five core microbes belonged to Paraburkholderia and two belonged to Bradyrhizobium. This suggests that species from the same genus tend to co-occur in similar ecological modules with comparable functions. Additionally, a majority of nodes in the rhizosphere microbial network exhibit positive correlations, indicating extensive coexistence and reciprocity among core microbes. These interactions collectively influence the growth and development of B. striata .

Cell chemotaxis, flagellar assembly, biofilm formation, and bacterial movement in the rhizosphere microbiome reflect the attraction of root exudates to microbes [ 68 ]. Interestingly, functional pathways related to flagella assembly, bacterial chemotaxis, and carbon fixation pathways of prokaryotes are significantly enriched within the rhizosphere microbiota associated with B. striata . As an ecological advantage strategy, bacterial chemotaxis indicates that bacteria are more likely to exhibit movement towards beneficial chemical gradients. Consequently, the rhizosphere secretions of B. striata may play a role in promoting the aggregation of specific microbes, thereby influencing the composition of rhizosphere microbiota. Furthermore, the functional pathways of rhizosphere microbes in B. striata may elicit heightened levels of ROS in the root, serving as a defense mechanism against potential pathogen invasion [ 69 ]. Previous studies have shown that glutamic acid can reshape the plant microbiota to enhance plant resistance against pathogens [ 70 ], and it is noteworthy that rhizosphere microbes exhibit abundant glutamate anabolism pathways. This suggests another potentially effective means by which rhizosphere microbes protect plants from pathogens. This “rhizosphere effect” is an important factor in shaping the rhizosphere microbiome, while rhizosphere microbes obtain nutrients through root exudates and derivatives.

Militarine is the sole indicator component of B. striata in the “Pharmacopoeia of the People’s Republic of China (2020)”, while B. striata polysaccharides serve as its primary functional components. Therefore, promoting the biosynthesis of militarine and BSP through rhizosphere microbial assembly holds significant practical production significance. Based on the functional characteristics of rhizosphere microbes from eight production areas, it was found that rhizosphere microbes in Jinzhai, Anhui and Liupanshui, Guizhou showed significant potential to promote the biosynthesis of militarine, whereas those in Guilin, Guangxi and Pan'an, Zhejiang exhibited notable potential to enhance BSP biosynthesis. Currently, based on the source species of gene annotation, it can be inferred that candidate microbes are involved in regulating militarine and BSP. However, further functional validation is needed to clarify the specific microbes involved and their contribution to component synthesis. Moreover, two of the candidate microbes related to militarine biosynthesis are identified as belonging to Burkholderia, suggesting their potential importance in promoting militarine bioaccumulation, which warrants further investigation. In addition, differences in the assembly of rhizosphere microbes and the abundance of functional genes may be critical factors influencing the quality variations of B. striata . Based on the results from all production areas, it was found that the levels of militarine and BSP in B. striata from Liupanshui, Guizhou, were significantly higher than those in other production areas, indicating higher quality. Meanwhile, B. striata from Liupanshui, Guizhou, showed significant potential for promoting militarine biosynthesis in rhizosphere microbes. Thus, we speculate that this may be attributed to the key gating effect of the root plane as stated by Edward et al. [ 71 ], that is, rhizosphere microbes enter plant roots and form endophytic microbes with selectivity, which in turn affects the accumulation of metabolites in the plant. In addition, the organic carbon and available nitrogen contents of soil in Liupanshui, Guizhou, were significantly higher than those of soil in other producing areas, providing an additional source of nutrition for the accumulation of BSP in B. striata .

Numerous studies have shown that soil microbial diversity and community structure are influenced by soil factors [ 72 , 73 ]. The results of this study indicate that soil physical and chemical factors drive the composition of the rhizosphere microbiota in B. striata , with soil alkaline nitrogen and soil organic carbon being consequential factors affecting the microbiota. Pu Yang et al. [ 74 ] found that soil alkaline nitrogen is the strongest predictor of bacterial and fungal community composition, which is consistent with the results of this experiment. Previous studies have also highlighted the significant influence of soil factors particularly pH, on rhizosphere bacterial communities [ 75 ], aligning with the results of our structural equation model analysis. Soil organic carbon, available potassium, and pH indirectly affect the accumulation of B. striata metabolites by significantly affecting bacterial composition. Correlation analysis revealed a strong positive relationship between soil organic carbon and the contents of metabolites militarine, BSP, batatasin III, blestriarene A, and coelonin. With the exception of militarine and BSP, the remaining three metabolites were stilbene compounds. Accordingly, we speculated that soil organic carbon plays a vital role in promoting the accumulation of stilbene compounds. The stilbene compounds in plants not only have extensive biological activity [ 76 ] but also contribute to enhancing the plant's resistance to environmental stress [ 77 ], thereby playing a pivotal role in plant growth and development. Consequently, increasing the accumulation of stilbene compounds in B. striata by regulating the soil physicochemical properties holds significant practical implications for actual production. In addition, results from structural equation modeling also indicate that, compared to the composition of fungal communities, the composition of bacterial communities plays a more important role in the accumulation of metabolites. In fact, the absolute abundance of bacterial communities in rhizosphere microbial communities is much higher than that of fungal communities, and there exists a relationship between community function and abundance. Moreover, numerous studies have shown that rhizosphere bacteria and their metabolites not only impact plant growth and stress resistance, but also influence the synthesis of plant biological metabolites [ 78 , 79 ]. For example, Piriformospora indica and Azotobacter chroococcum have been shown to increase the artemisinin content of Artemisia caruifolia [ 80 ]. In the present study, we observed a significant positive correlation between the function of rhizosphere microbes and the main functional components, such as BSP and militarine, in B. striata . Combined with gene analysis related to militarine and BSP biosynthesis, we concluded that the additional metabolic capacity provided by rhizosphere microbes and their genes related to the synthesis of medicinally active ingredients may contribute to additional metabolic capacity for B. striata . Overall, the results indicated that the metabolites of B. striata are jointly regulated by multiple factors, and there are certain mutual influences and indirect effects within these factors, ultimately acting together on the accumulation of metabolites.

This study utilized metagenomic technology and targeted metabolomics technology to uncover the comprehensive regulation of rhizosphere microorganisms and secondary metabolites of B. Striata for the first time. To our knowledge, this is a novel report on the joint analysis of microbes and metabolites in the rhizosphere of B. striata , but the core and functional species have not yet been isolated from the rhizosphere soil, resulting in limited practical applications. Therefore, future research should focus on large-scale isolation and identification of relevant microorganisms, as well as validation to facilitate their development and application. In summary, identifying microbe-soil-metabolite interactions can help us select beneficial growth-promoting bacteria as biological fertilizers, enabling effective fertilization management to guide cultivation practices and improve the quality of B. striata while laying a foundation for future conservation research and agricultural sustainability.

Sample collection

In this study, eight geographic areas known for B. striata production were selected as sampling points across four provinces: Zhejiang Province, Anhui Province, Guangxi Province, and Guizhou Province. Details of the sampling points can be found in Table 2 , with the sampling conducted in September 2021. All plant samples have been taxonomically as the orchid plant Bletilla striata (Thunb.) Reichb. f. by Professor Shuili Zhang from Zhejiang Chinese Medical University. Our team has obtained official permission for the collection of plant materials, and the voucher number (20211011-ND) and specimens are stored in the laboratory of the Institute of Traditional Chinese Medicine Resources at Zhejiang Chinese Medical University, maintained at a temperature of -80 ℃. Five healthy three-year-old B. striata plants were randomly selected from each sampling site. The humus was removed from the soil surface, and the roots of healthy plants were excavated vertically from 0 to 20 cm along the base of the plants. The soil around the roots was carefully shaken off, and then the roots were immersed in a sterile bottle containing sterilized phosphate buffer saline (pH = 7.4). They were continuously shaken to merge with the washing solution, forming a rhizosphere soil suspension. After centrifugation, the rhizosphere soil samples were stored at − 80 °C in an ultra-low temperature refrigerator for amplification and metagenomic detection. The fresh B. striata tubers were collected, cleansed through three rounds of ultrasonic cleaning with sterile water, and then stored at − 80 °C.

Soil physicochemical parameters

The pH value was measured using the water extraction (soil water ratio of 2.5:1)—potential method; soil organic carbon content was determined using the potassium dichromate oxidation capacity method; alkali-hydrolyzable nitrogen (AN) content was assessed using the alkaline hydrolysis diffusion method; available phosphorus (AP) content was measured using the ICP-OES method; available potassium (AK) content was determined using the flame photometric method. The physical and chemical indicators of the soil samples from each production area were measured five times.

DNA extraction, DNA sequencing, and metagenomic processing

Genomic DNA was extracted from the samples using the CTAB method, and its concentration and purity were assessed on a 1% agarose gel. The DNA was then diluted to a concentration of 1 ng/µL with sterile water. Subsequently, 16S rRNA genes of distinct regions (16S V3-V4) were amplified using the specific primers 341F (5’-CCTAYGGGRBGCASCAG-3’) and 806R (5’-GGACTACNNGGGTATCTAAT-3’) with the barcode. Additionally, the ITS1-1F region of the ITS rRNA gene was amplified using the universal primers ITS1-1F-F (CTTGGTCATTTAGAGGAAGTAA) and ITS1-1F-R (GCTGCGTTCTTCATCGATGC). The degree of DNA degradation, potential contamination, and DNA concentration were measured using an Agilent 5400 instrument (Agilent Technologies Co., Ltd., USA). Library construction and sequencing were completed by Wekemo Tech Group Co., Ltd. (Shenzhen, China).

Microbiome data analysis

Raw data of bacteria, fungi, and viruses in the rhizosphere of B. striata were obtained by metagenomic sequencing using the Illumina Novaseq high-throughput sequencing platform. To ensure data reliability, raw sequencing data underwent preprocessing using Kneaddata software. Kraken2 and a self-built microbial database (sequences belonging to bacteria, fungi, archaea, and viruses were screened from the NT nucleic acid database and RefSeq whole-genome database of NCBI) were used to identify the species contained in the samples, and Bracken was used to predict the actual relative abundance of species in the samples. Kraken2 is the latest comparison software based on K-mer with 16,799 known bacterial genomes [ 81 , 82 , 83 , 84 ]. After undergoing quality control and de-hosting, the clean reads were aligned to the Uniref90 database using Humann2 software (based on Diamond). Annotation information and relative abundance tables from each functional database were obtained according to the corresponding relationship between Uniref90 ID and each database [ 85 , 86 , 87 , 88 ]. Subsequent analyses including abundance clustering, principal coordinate analysis (PCoA), and NMDS dimensionality reduction were conducted using online cloud platforms ( https://www.bioincloud.tech ).

Determination of metabolic components in B. striata tubers

The B. striata tuber samples were cut, homogenized, passed through an 80 mesh sieve, and then stored at − 80 °C before being freeze-dried for later use. Subsequently, 0.200 g of freeze-dried powder was weighed and mixed with 10 mL of 50% ethanol, followed by incubation at 25 °C for 30 min. The extraction process involved ultrasound treatment at 40 °C (250 W, 60 kHz) for 30 min and subsequent centrifugation at 13,523 × g for 15 min. The supernatant was collected to determine the content of small-molecule compounds, while the precipitate was used for polysaccharide extraction and determination.

Briefly, 1 mL of the supernatant was absorbed and diluted to 2 mL with 50% ethanol to produce a sample solution with a mass concentration of 10 mg/mL dried tuber powder. The samples were passed through a 0.22-μM filter membrane for high performance liquid chromatography (HPLC) analysis. The contents of militarine (58,139–23-4, Chengdu Must Bio-Technology Co., Ltd., Chengdu, China), coelonin (82,344–82-9, Beijing Gersion Bio-Technology Co., Ltd, Beijing, China), batatasin III (56,684–87-8, Chengdu Must Bio-Technology Co., Ltd, Chengdu, China), blestriarene A (126,721–53-7, Chengdu Must Bio-Technology Co., Ltd., Chengdu, China), dactylorhin A (256,459–34-4, Chengdu Must Bio-Technology Co., Ltd., Chengdu, China), and gymnoside III (899,430–03-6, Shanghai Yuanye Bio-Technology Co., Ltd., Shanghai, China) in B. striata tubers from different regions were determined via HPLC. Chromatographic conditions: The analysis was performed using a Waters ACQUITYUPLC BEHC18 column (2.1 mm × 100 mm, 1.7 μm) with a mobile phase consisting of acetonitrile (A) and 0.1% formic acid water (B) for gradient elution. The gradient program was as follows: 0–5 min, 10% A; 5–10 min, 10–18.9% A, 10–30 min, 18.9–32% A; 30–70 min, 32–52% A; 70–72 min, 52% A; 72–73 min, 52–95% A; 73–74 min, 95–10% A; 74–80 min, 10% A. Detection was carried out at a wavelength of 270 nm with a flow rate of 1.0 mL/min and the column temperature maintained at 30 °C. The injection volume was set to be 10 µL.

The collected precipitate was suspended in 20 mL of water and extracted in a 90 °C water bath for 2 h to determine the polysaccharide content. An equal volume of anhydrous ethanol was then added to precipitate the polysaccharides. The resulting precipitate was centrifuged at 4 °C and 8000 rpm for 5 min, followed by removal of the supernatant. The remaining precipitate was quantitatively dissolved in water as the sample to be measured. Glucose was used as a standard, and the sulfuric acid-phenol method was used for color development. The absorbance values of each sample at a wavelength of 490 nm were measured using a UV spectrophotometer (EnSpire, PerkinElmer, USA), and the content of polysaccharides was calculated.

Statistical analyses

The Chao1, Shannon, and Simpson indices were used to evaluate the α diversity of the microbial community in the rhizosphere. Differences were tested using one-way ANOVA, with multiple comparisons were performed using Bonferroni corrected p  < 0.05. The Bray Curtis distance matrix was analyzed using similarity analysis (ANOSIM) in QIIME, with n  = 999 permutations, and significance set at p  < 0.05. PCoA was also performed based on the Bray Curtis dissimilarity matrix to visualize β diversity between groups in the rhizosphere microbiome. A microbial community interaction network was established to explore the interactions among rhizosphere microbes, focusing on microbial groups with a relative abundance greater than 0.01% and present in more than 75% of the samples across groups. In this coexisting network, a SparCC correlation coefficient r  > 0.6 between two nodes indicated significant correlation between them. Redundancy analysis (RDA) was conducted to determine the environmental parameters associated with the structure of the rhizosphere microbiota. A structural equation model was established to analyze the effects of soil physicochemical properties and microbial communities on the metabolic products of B. striata . Graphical visualization was performed in R software using the "lavaan" and "pieceSEM" R packages [ 89 ].

Availability of data and materials

The datasets generated and/or analysed during the current study are available in the NCBI repository [PRJNA1029928].

Feng H, Fu R, Hou X, Lv Y, Zhang N, Liu Y, Xu Z, Miao Y, Krell T, Shen Q, et al. Chemotaxis of beneficial rhizobacteria to root exudates: the first step towards root-microbe rhizosphere interactions. Int J Mol Sci. 2021;22(13):6655.

Article   CAS   PubMed   PubMed Central   Google Scholar  

Vives-Peris V, de Ollas C, Gomez-Cadenas A, Perez-Clemente RM. Root exudates: from plant to rhizosphere and beyond. Plant Cell Rep. 2020;39(1):3–17.

Article   CAS   PubMed   Google Scholar  

Jin Y, Zhu H, Luo S, Yang W, Zhang L, Li S, Jin Q, Cao Q, Sun S, Xiao M. Role of Maize Root Exudates in Promotion of Colonization of Bacillus velezensis Strain S3–1 in Rhizosphere Soil and Root Tissue. Curr Microbiol. 2019;76(7):855–62.

Igiehon NO, Babalola OO. Rhizosphere microbiome modulators: contributions of nitrogen fixing bacteria towards sustainable agriculture. Int J Env Res Pub He. 2018;15(4):574.

Article   Google Scholar  

Lurthy T, Pivato B, Lemanceau P, Mazurier S. Importance of the Rhizosphere Microbiota in Iron Biofortification of Plants. Front Plant Sci. 2021;12:744445.

Article   PubMed   PubMed Central   Google Scholar  

Lu T, Ke M, Lavoie M, Jin Y, Fan X, Zhang Z, Fu Z, Sun L, Gillings M, Penuelas J, et al. Rhizosphere microorganisms can influence the timing of plant flowering. Microbiome. 2018;6(1):231.

Qiao C, Penton CR, Xiong W, Liu C, Wang R, Liu Z, Xu X, Li R, Shen Q. Reshaping the rhizosphere microbiome by bio-organic amendment to enhance crop yield in a maize-cabbage rotation system. Appl Soil Ecol. 2019;142:136–46.

Singh RK, Singh P, Li H, Song Q, Guo D, Solanki MK, Verma KK, Malviya MK, Song X, Lakshmanan P, et al. Diversity of nitrogen-fixing rhizobacteria associated with sugarcane : a comprehensive study of plant-microbe interactions for growth enhancement in Saccharum spp. BMC Plant Biol. 2020;20(1):220.

Jiang H, Xu X, Fang Y, Ogunyemi SO, Ahmed T, Li X, Yang Y, Yan C, Chen J, Li B. Metabarcoding reveals response of rice rhizosphere bacterial community to rice bacterial leaf blight. Microbiol Res. 2023;270:127344.

Ge J, Li D, Ding J, Xiao X, Liang Y. Microbial coexistence in the rhizosphere and the promotion of plant stress resistance: a review. Environ Res. 2023;222:115298.

Su J, Wang Y, Bai M, Peng T, Li H, Xu HJ, Guo G, Bai H, Rong N, Sahu SK, et al. Soil conditions and the plant microbiome boost the accumulation of monoterpenes in the fruit of Citrus reticulata “Chachi.” Microbiome. 2023;11(1):61.

Zhong C, Chen C, Gao X, Tan C, Bai H, Ning K. Multi-omics profiling reveals comprehensive microbe-plant-metabolite regulation patterns for medicinal plant Glycyrrhiza uralensis Fisch. Plant Biotechnol J. 2022;20(10):1874–87.

Liao Z, Zeng R, Hu L, Maffucci KG, Qu Y. Polysaccharides from tubers of Bletilla striata: Physicochemical characterization, formulation of buccoadhesive wafers and preliminary study on treating oral ulcer. Int J Biol Macromol. 2019;122:1035–45.

Guo Q, Li B, Bao C, Li Y, Cao Y, Wang C, Wu W. Bletilla striata polysaccharides improve hemostatic, anti-inflammatory efficacy and platelet aggregation in gingivitis rat model. Starch-Stärke. 2020;73(3–4):2000185.

Google Scholar  

Zhang C, He Y, Chen Z, Shi J, Qu Y, Zhang J. Effect of polysaccharides from Bletilla striata on the healing of dermal wounds in mice. Evid-Based Compl Alt. 2019;2019:9212314.

Huang Y, Shi F, Wang L, Yang Y, Khan BM, Cheong KL, Liu Y. Preparation and evaluation of Bletilla striata polysaccharide/carboxymethyl chitosan/Carbomer 940 hydrogel for wound healing. Int J Biol Macromol. 2019;132:729–37.

Lda B, Xxla C, Sxwa B, Yma B, Mjla B, Yxda B, Jyha B, Yjl B, Yh B, Ylwa B. Rhizoma Bletillae polysaccharide elicits hemostatic effects in platelet-rich plasma by activating adenosine diphosphate receptor signaling pathway - ScienceDirect. Biomed Pharmacother. 2020;130:110537.

Jiang F, Li M, Wang H, Ding B, Zhang C, Ding Z, Yu X, Lv G. Coelonin, an anti-inflammation active component of Bletilla striata and its potential mechanism. Int J Mol Sci. 2019;20(18):4422.

Chen Z, Zhao Y, Zhang M, Yang X, Yue P, Tang D, Wei X. Structural characterization and antioxidant activity of a new polysaccharide from Bletilla striata fibrous roots. Carbohyd Polym. 2020;227:115362.

Article   CAS   Google Scholar  

Li Y, Ma Z, Yang X, Gao Y, Ren Y, Li Q, Qu Y, Chen G, Zeng R. Investigation into the physical properties, antioxidant and antibacterial activity of Bletilla striata polysaccharide/chitosan membranes. Int J Biol Macromol. 2021;182:311–20.

Luo Y, Wang J, Li S, Wu Y, Wang Z, Chen S, Chen H. Discovery and identification of potential anti-melanogenic active constituents of Bletilla striata by zebrafish model and molecular docking. BMC Complement Med. 2022;22(1):1–14.

Scla C, Mlsb D, Yct A, Ycl E, Cwc F, Dwl G. Attenuation of in vitro and in vivo melanin synthesis using a Chinese herbal medicine through the inhibition of tyrosinase activity. Phytomedicine. 2022;95:153876.

Wang Y, Han S, Li R, Cui B, Ma X, Qi X, Hou Q, Lin M, Bai J, Li S. Structural characterization and immunological activity of polysaccharides from the tuber of Bletilla striata. Int J Biol Macromol. 2019;122:628–35.

Ji X, Yin M, Nie H, Liu Y. A review of isolation, chemical properties, and bioactivities of polysaccharides from Bletilla striata. Biomed Res Int. 2020;2020:5391379.

Zhou M, Jiang S, Chen C, Li J, Lou H, Wang M, Liu G, Liu H, Liu T, Pan W. Bioactive bibenzyl enantiomers from the tubers of Bletilla striata. Front Chem. 2022;10:911201.

Hu L, Ma S, Yin C, Liu Z. Quality evaluation and traceability of Bletilla striata by fluorescence fingerprint coupled with multiway chemometrics analysis. J Sci Food Agr. 2019;99(3):1413–24.

Wang B, Zhang H, Chen L, Mi Z, Xu Y, Zhao G, Liu S, Lei H, Wang Z, Niu J. Extraction, purification, and determination of the gastroprotective activity of glucomannan from Bletilla striata. Carbohyd Polym. 2020;246:116620.

Zhu Z, Liang T, Dai G, Zheng J, Dong J, Xia C, Duan B. Extraction, structural-activity relationships, bioactivities, and application prospects of Bletilla striata polysaccharides as ingredients for functional products: a review. Int J Biol Macromol. 2023;245:125407.

Jin-Qiang Z, Tao Z, Cheng-Hong X, Wei-Ke J, Lan-Ping G, Xiao W. Bletilla striata ecological planting patterns and technical principle analysis. Zhongguo Zhong Yao Za Zhi. 2020;45(20):5042–7.

PubMed   Google Scholar  

Gao Y, Cai C, Yang Q, Quan W, Li C, Wu Y. Response of Bletilla striata to drought: effects on biochemical and physiological parameter also with electric measurements. Plants-Basel. 2022;11(17):2313.

Huang J, Yuan F, Zhou M, Huang T, Zhang Y, Liang Q. Phenotype correlation analysis and excellent germplasm screening of herb Bletilla Rchb. f. based on comprehensive evaluation from thirty-three geographic populations. BMC Plant Biol. 2022;22(1):154.

Wu Y, Xiao S, Qi J, Gong Y, Li K. Pseudomonas fluorescens BsEB-1: an endophytic bacterium isolated from the root of Bletilla striata that can promote its growth. Plant Signal Behav. 2022;17(1):2100626.

Xi G, Shi J, Li J, Han Z. Isolation and identification of beneficial orchid mycorrhizal fungi in Bletilla striata (Thunb.) Rchb.f.(Orchidaceae). Plant Signal Behav. 2020;15(12):1816644.

Jiang J, Zhang K, Cheng S, Nie Q, Zhou SX, Chen Q, Zhou J, Zhen X, Li XT, Zhen TW, et al. Fusarium oxysporum KB-3 from Bletilla striata: an orchid mycorrhizal fungus. Mycorrhiza. 2019;29(5):531–40.

Article   PubMed   Google Scholar  

Cheng S, Jiang JW, Tan LT, Deng JX, Liang PY, Su H, Sun ZX, Zhou Y. Plant growth- promoting ability of mycorrhizal fusarium strain KB-3 enhanced by its IAA producing endohyphal Bacterium Klebsiella aerogenes. Front Microbiol. 2022;13:855399.

Dong C, Shao Q, Zhang Q, Yao T, Huang J, Liang Z, Han Y. Preferences for core microbiome composition and function by different definition methods: evidence for the core microbiome of Eucommia ulmoides bark. Sci Total Environ. 2021;790:148091.

Xu J, Zhang Y, Zhang P, Trivedi P, Riera N, Wang Y, Liu X, Fan G, Tang J, Coletta-Filho HD, et al. The structure and function of the global citrus rhizosphere microbiome. Nat Commun. 2018;9(1):4894.

Chen H, Wu H, Yan B, Zhao H, Liu F, Zhang H, Sheng Q, Miao F, Liang Z. Core microbiome of medicinal plant salvia miltiorrhiza seed : a rich reservoir of beneficial microbes for secondary metabolism? Int J Mol Sci. 2018;19(3):672.

Liu H, Huang C, Li Q, Wang M, Xiao S, Shi J, He Y, Wen W, Li L, Xu D. Genome-wide identification of genes related to biosynthesis of phenolic acid derivatives in bletilla striata at different suspension culture stages. Front Plant Sci. 2022;13:875404.

Niu J, Zhao G, Mi Z, Chen L, Liu S, Wang S, Wang D, Wang Z. De novo sequencing of Bletilla striata (Orchidaceae) transcriptome and identification of genes involved in polysaccharide biosynthesis. Genet Mol Biol. 2020;43(3):e20190417.

Christakopoulos P, Bhat MK, Kekos D, Macris BJ. Enzymatic synthesis of trisaccharides and alkyl beta-D-glucosides by the transglycosylation reaction of beta-glucosidase from Fusarium oxysporum. Int J Biol Macromol. 1994;16(6):331–4.

Ma Y. Molecular Mechanism of Sugar Metabolism related Genes in goji berry (Lycium barbarum L.) Fruit under different CO 2 concentration. Ningxia: Ningxia University; 2021. https://doi.org/10.27257/d.cnki.gnxhc.2018.000002 .

Du J, Lin L, Ma Y, Chen J, Chen H. LI Y: Research progress in plant Trehalose-6- phosphate synthase genes. Plant Sci J. 2023;41(03):411–20.

Walters WA, Jin Z, Youngblut N, Wallace JG, Sutter J, Zhang W, Gonzalez-Pena A, Peiffer J, Koren O, Shi Q, et al. Large-scale replicated field study of maize rhizosphere identifies heritable microbes. P Natl Acad Sci USA. 2018;115(28):7368–73.

Li Z, Fu J, Zhou R, Wang D. Effects of phenolic acids from ginseng rhizosphere on soil fungi structure, richness and diversity in consecutive monoculturing of ginseng. Saudi J Biol Sci. 2018;25(8):1788–94.

Kawasaki A, Dennis PG, Forstner C, Raghavendra A, Mathesius U, Richardson AE, Delhaize E, Gilliham M, Watt M, Ryan PR. Manipulating exudate composition from root apices shapes the microbiome throughout the root system. Plant Physiol. 2021;187(4):2279–95.

Ali S, Xie L. Plant growth promoting and stress mitigating abilities of soil born microorganisms. Recent Pat Food Nutr Agric. 2020;11(2):96–104.

Zuo J, Zu M, Liu L, Song X, Yuan Y. Composition and diversity of bacterial communities in the rhizosphere of the Chinese medicinal herb Dendrobium. BMC PLANT BIOL. 2021;21(1):127.

Lin M, Xiong H, Xiang X, Zhou Z, Liang L, Mei Z. The effect of plant geographical location and developmental stage on root-associated microbiomes of Gymnadenia conopsea. Front Microbiol. 2020;11:1257.

Chen L, Fang K, Zhou J, Yang ZP, Dong XF, Dai GH, Zhang HB. Enrichment of soil rare bacteria in root by an invasive plant Ageratina adenophora. Sci Total Environ. 2019;683:202–9.

Guo D, Fan Z, Lu S, Ma Y, Nie X, Tong F, Peng X. Changes in rhizosphere bacterial communities during remediation of heavy metal-accumulating plants around the Xikuangshan mine in southern China. Sci Rep-UK. 2019;9(1):1947.

Dai Y, Yan Z, Xie J, Wu H, Xu L, Hou X, Gao L. CUI Y: soil bacteria diversity in rhizosphere under two types of vegetation restoration based on high throughput sequencing. Acta Pedol Sin. 2017;54(03):735–48.

Tong H, Zheng C, Li B, Swanner ED, Liu C, Chen M, Xia Y, Liu Y, Ning Z, Li F, et al. Microaerophilic Oxidation of Fe(II) coupled with simultaneous carbon fixation and as(III) Oxidation and sequestration in karstic paddy soil. Environ Sci Technol. 2021;55(6):3634–44.

Ibrahim S, Mohamed S, Altyar AE, Mohamed GA. Natural products of the fungal genus humicola: diversity, biological activity, and industrial importance. Curr Microbiol. 2021;78(7):2488–509.

Park MS, Eimes JA, Oh SH, Suh HJ, Oh SY, Lee S, Park KH, Kwon HJ, Kim SY, Lim YW. Diversity of fungi associated with roots of Calanthe orchid species in Korea. J Microbiol. 2018;56(1):49–55.

Cho G, Gang GH, Jung HY, Kwak YS. Exploration of Mycobiota in Cypripedium japonicum, an Endangered Species. Mycobiology. 2022;50(2):142–9.

Agler MT, Ruhe J, Kroll S, Morhenn C, Kim ST, Weigel D, Kemen EM. Microbial hub taxa link host and abiotic factors to plant microbiome variation. PLoS Biol. 2016;14(1):e1002352.

Vandenkoornhuyse P, Quaiser A, Duhamel M, Le Van A, Dufresne A. The importance of the microbiome of the plant holobiont. New Phytol. 2015;206(4):1196–206.

Choi GM, Im WT. Paraburkholderia azotifigens sp. nov., a nitrogen-fixing bacterium isolated from paddy soil. Int J Syst Evol Micr. 2018;68(1):310–6.

Paulitsch F, Dall’Agnol RF, Delamuta J, Ribeiro RA, Da SBJ, Hungria M. Paraburkholderia guartelaensis sp. nov., a nitrogen-fixing species isolated from nodules of Mimosa gymnas in an ecotone considered as a hotspot of biodiversity in Brazil. Arch Microbiol. 2019;201(10):1435–46.

Reis VM, Santos P, Tenorio-Salgado S, Vogel J, Stoffels M, Guyon S, Mavingui P, Baldani V, Schmid M, Baldani JI, et al. Burkholderia tropica sp. nov., a novel nitrogen-fixing, plant-associated bacterium. Int J Syst Evol Micr. 2004;54(Pt 6):2155–62.

Huo Y, Kang JP, Kim YJ, Yang DC. Paraburkholderia panacihumi sp. nov., an isolate from ginseng-cultivated soil, is antagonistic against root rot fungal pathogen. Arch Microbiol. 2018;200(8):1151–8.

Morya R, Salvachua D, Thakur IS. Burkholderia: an untapped but promising bacterial genus for the conversion of aromatic compounds. Trends Biotechnol. 2020;38(9):963–75.

Tani A, Sahin N, Fujitani Y, Kato A, Sato K, Kimbara K. Methylobacterium species promoting rice and barley growth and interaction specificity revealed with whole-cell matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF/MS) analysis. PLoS ONE. 2015;10(6):e129509.

Holland MA. Occam’s razor applied to hormonology (Are cytokinins produced by plants?). Plant Physiol. 1997;115(3):865–8.

Pent M, Poldmaa K, Bahram M. Bacterial communities in boreal forest mushrooms are shaped both by soil parameters and host identity. Front Microbiol. 2017;8:836.

Warmink JA, Nazir R, van Elsas JD. Universal and species-specific bacterial “fungiphiles” in the mycospheres of different basidiomycetous fungi. Environ Microbiol. 2009;11(2):300–12.

Bai B, Liu W, Qiu X, Zhang J, Zhang J, Bai Y. The root microbiome: Community assembly and its contributions to plant fitness. J Integr Plant Biol. 2022;64(2):230–43.

Wen T, Ding Z, Thomashow LS, Hale L, Yang S, Xie P, Liu X, Wang H, Shen Q, Yuan J. Deciphering the mechanism of fungal pathogen-induced disease-suppressive soil. New Phytol. 2023;238(6):2634–50.

Kim DR, Jeon CW, Cho G, Thomashow LS, Weller DM, Paik MJ, Lee YB, Kwak YS. Glutamic acid reshapes the plant microbiota to protect plants against pathogens. Microbiome. 2021;9(1):244.

Edwards J, Johnson C, Santos-Medellin C, Lurie E, Podishetty NK, Bhatnagar S, Eisen JA, Sundaresan V. Structure, variation, and assembly of the root-associated microbiomes of rice. P Natl Acad Sci USA. 2015;112(8):E911–20.

Guo X, Chen HYH, Meng M, Biswas SR, Ye L, Zhang J. Effects of land use change on the composition of soil microbial communities in a managed subtropical forest. Forest Ecol Manag. 2016;373:93–9.

Badri DV, Zolla G, Bakker MG, Manter DK, Vivanco JM. Potential impact of soil microbiomes on the leaf metabolome and on herbivore feeding behavior. New Phytol. 2013;198(1):264–73.

Yang P, Luo Y, Gao Y, Gao X, Gao J, Wang P, Feng B. Soil properties, bacterial and fungal community compositions and the key factors after 5-year continuous monocropping of three minor crops. PLoS ONE. 2020;15(8):e237164.

Liu Y, Wang H, Peng Z, Li D, Chen W, Jiao S, Wei G. Regulation of root secondary metabolites by partial root-associated microbiotas under the shaping of licorice ecotypic differentiation in northwest China. J Integr Plant Biol. 2021;63(12):2093–109.

Zhai D, Lv X, Chen J, Peng M, Cai J. Recent research progress on natural stilbenes in dendrobium species. Molecules. 2022;27(21):7233.

He X, Xue F, Zhang L, Guo H, Ma L, Yang M. Overexpressing fusion proteins of 4-coumaroyl-CoA ligase (4CL) and stilbene synthase (STS) in tobacco plants leading to resveratrol accumulation and improved stress tolerance. Plant Biotechnol Rep. 2018;12(5):295–302.

Zhang Y, Zheng L, Zheng Y, Xue S, Zhang J, Huang P, Zhao Y, Hao X, He Z, Hu Z, et al. Insight into the assembly of root-associated microbiome in the medicinal plant Polygonum cuspidatum. Ind Crop Prod. 2020;2020(145):112163.

Huang W, Long C, Lam E. Roles of plant-associated microbiota in traditional herbal medicine. Trends Plant Sci. 2018;23(7):559–62.

Arora M, Saxena P, Choudhary DK, Abdin MZ, Varma A. Dual symbiosis between Piriformospora indica and Azotobacter chroococcum enhances the artemisinin content in Artemisia annua L. World J Microb Biot. 2016;32(2):19.

Lu J, Breitwieser FP, Thielen P, Salzberg SL. Bracken: estimating species abundance in metagenomics data. PeerJ Comput Sci. 2017;3(1):e104.

Mandal S, Van Treuren W, White RA, Eggesb M, Knight R, Peddada SD. Analysis of composition of microbiomes: a novel method for studying microbial composition. Microb Ecol Health Dis. 2015;26:27663.

Brum JR, Ignacio-Espinoza JC, Roux S, Doulcier G, Acinas SG, Alberti A, Chaffron S, Cruaud C, De Vargas C, Gasol JM. Patterns and ecological drivers of ocean viral communities. Science. 2015;348(6237):1261498.

Wood DE, Salzberg SL. Kraken: ultrafast metagenomic sequence classification using exact alignments. Genome Biol. 2014;15(3):R46.

Segata N, Izard J, Waldron L, Gevers D, Miropolsky L, Garrett WS, Huttenhower C. Metagenomic biomarker discovery and explanation. Genome Biol. 2011;12(6):R60.

Zhu W, Lomsadze A, Borodovsky M. Ab initio gene identification in metagenomic sequences. Nucleic Acids Res. 2010;38(12):e132.

Franzosa EA, McIver LJ, Rahnavard G, Thompson LR, Schirmer M, Weingart G, Lipson KS, Knight R, Caporaso JG, Segata N, et al. Species-level functional profiling of metagenomes and metatranscriptomes. Nat Methods. 2018;15(11):962.

Kim J, Kim MS, Koh AY, Xie Y, Zhan X. FMAP: functional mapping and analysis pipeline for metagenomics and metatranscriptomics studies. BMC Bioinformatics. 2016;17:420.

Byrnes JE, Reed DC, Cardinale BJ, Cavanaugh KC, Holbrook SJ, Schmitt RJ. Climate-driven increases in storm frequency simplify kelp forest food webs. Global Change Biol. 2011;17(8):2513–24.

Download references

Acknowledgments

We thank LetPub ( www.letpub.com ) for its linguistic assistance during the preparation of this manuscript.

The present research was carried out with the financial support of Zhejiang Province Traditional Chinese Medicine Science and Technology Project [grant number 2021ZX008].

Author information

Shiqing Li, Xiaomei Li, Yueyu Ye and Man Chen these authors contributed equally to this work and share first authorship.

Authors and Affiliations

College of Pharmaceutical Sciences, Zhejiang Chinese Medical University, Hangzhou, 310053, Zhejiang, China

Shiqing Li, Xiaomei Li, Yueyu Ye, Man Chen, Xiaobo Zhang & Chunchun Zhang

Key Laboratory of Plant Secondary Metabolism and Regulation of Zhejiang Province, College of Life Sciences and Medicine, Zhejiang Sci-Tech University, Hangzhou, 310018, Zhejiang, China

Haimin Chen & Dongfeng Yang

Academy of Chinese Medical Sciences, Zhejiang Chinese Medical University, Hangzhou, 310053, Zhejiang, China

College of Life Sciences, Zhejiang Chinese Medical University, Hangzhou, 310053, Zhejiang, China

Fusheng Jiang

You can also search for this author in PubMed   Google Scholar

Contributions

The ideas were conceived by F.J., X.Z., C.Z., D.Y.,and S.L. Study was designed by Y.Y., X.Z., H.C., and M.L.; S.L., M.C., X.L.,and M.L. analyzed the data. Writing–original draft: S.L., and X.L.,Writing - review & editing: S.L., and F.J. All authors discussed the findings and helped to write the paper.

Corresponding authors

Correspondence to Fusheng Jiang , Xiaobo Zhang or Chunchun Zhang .

Ethics declarations

Ethics approval and consent to participate.

Not applicable.

Consent for publication

Competing interests.

The authors declare no competing interests.

Additional information

Publisher's note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Supplementary material 1. , rights and permissions.

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ . The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Cite this article.

Li, S., Li, X., Ye, Y. et al. The rhizosphere microbiome and its influence on the accumulation of metabolites in Bletilla striata (Thunb.) Reichb. f. BMC Plant Biol 24 , 409 (2024). https://doi.org/10.1186/s12870-024-05134-0

Download citation

Received : 12 October 2023

Accepted : 10 May 2024

Published : 17 May 2024

DOI : https://doi.org/10.1186/s12870-024-05134-0

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Bletilla striata
• Rhizosphere microbes
• Metabolites

BMC Plant Biology

ISSN: 1471-2229

• General enquiries: [email protected]

129 List Of Research Topics In English Language Teaching [updated]

English Language Teaching (ELT) is a field dedicated to teaching English to non-native speakers. It’s important because English is a global language used for communication, business, and education worldwide. Research in ELT helps improve teaching methods, making it easier for students to learn English effectively. This blog will explore a list of research topics in English language teaching.

What Are The Areas Of Research In English Language Teaching?

Table of Contents

Research in English Language Teaching (ELT) encompasses a wide range of areas, including:

• Language Learning: Understanding how people learn English well, like when they learn a new language and if there’s a best time to do it.
• Teaching Ways: Looking into different ways teachers teach, like using conversations, tasks, or mixing language with other subjects.
• Curriculum Design and Syllabus Development: Designing and evaluating language curricula and syllabi to meet the needs of diverse learners and contexts.
• Assessment and Evaluation: Developing and validating assessment tools, exploring alternative assessment methods, and investigating the effectiveness of feedback and error correction strategies.
• Technology in ELT: Exploring the integration of technology in language teaching and learning, including computer-assisted language learning (CALL), mobile-assisted language learning (MALL), and online learning platforms.
• Teacher Education and Professional Development: Investigating pre-service and in-service teacher education programs, reflective practices, and challenges in teacher training.
• Cultural and Sociolinguistic Aspects: Examining the role of culture in language teaching and learning, sociolinguistic competence, and addressing cultural diversity in the classroom.
• Learner Diversity and Inclusive Practices: Researching teaching strategies for diverse learners, including young learners, learners with learning disabilities, and learners from diverse linguistic and cultural backgrounds.
• Policy and Planning in ELT: Analyzing language policies at national and international levels, exploring the implementation of ELT programs, and examining the role of ELT in national development.
• Research Methodologies in ELT: Investigating qualitative, quantitative, and mixed-methods research approaches in ELT research, including action research conducted by teachers in their own classrooms.
• Future Trends and Innovations: Exploring emerging trends and innovations in ELT, such as the impact of globalization, the use of artificial intelligence (AI) in language learning, and innovative teaching strategies.

129 List Of Research Topics In English Language Teaching: Category Wise

Language acquisition and development.

• Second Language Acquisition Theories: Explore different theories explaining how learners acquire a second language.
• Critical Period Hypothesis: Investigate the idea of an optimal age range for language acquisition.
• Multilingualism and Language Development: Study how knowing multiple languages affects language development.
• Cognitive and Affective Factors in Language Learning: Examine the role of cognitive abilities and emotions in language learning.
• Language Learning Strategies: Investigate the strategies learners use to acquire and develop language skills.
• Input Hypothesis: Explore the role of comprehensible input in language acquisition.
• Interaction Hypothesis: Examine the importance of interaction in language learning.
• Fossilization in Second Language Learning: Study why some learners reach a plateau in their language development.

Teaching Methodologies and Approaches

• Communicative Language Teaching (CLT): Analyze the effectiveness of CLT in promoting communication skills.
• Task-Based Language Teaching (TBLT): Explore the use of real-world tasks to teach language.
• Content and Language Integrated Learning (CLIL): Investigate teaching subject content through English.
• Blended Learning in ELT: Study the integration of traditional and online teaching methods.
• Audio-Lingual Method: Assess the effectiveness of drills and repetition in language teaching.
• Grammar-Translation Method: Compare traditional grammar-focused methods with communicative approaches.
• Lexical Approach: Explore teaching vocabulary as a key component of language proficiency.
• Suggestopedia: Investigate the use of relaxation techniques to enhance language learning.

Curriculum Design and Syllabus Development

• Needs Analysis in ELT: Identify the language needs of learners and design appropriate curricula.
• Integrating Language Skills in Curriculum: Examine strategies for integrating reading, writing, listening, and speaking skills.
• Syllabus Types: Compare different types of syllabi, such as structural and task-based.
• Task-Based Syllabus Design: Design syllabi based on real-world tasks to promote language acquisition.
• Content-Based Instruction (CBI): Integrate language learning with academic content in syllabus design.
• Needs Analysis in Specific Contexts: Conduct needs analyses for learners in specific professional or academic contexts.
• Cross-Cultural Communication in Curriculum Design: Incorporate intercultural communication skills into language curricula.

Assessment and Evaluation

• Standardized Testing in ELT: Evaluate the reliability and validity of standardized English language tests.
• Alternative Assessment Approaches: Explore non-traditional assessment methods like portfolios and self-assessment.
• Feedback Strategies in Language Learning: Investigate effective feedback techniques for improving language proficiency.
• Washback Effect of Testing: Study how assessment practices influence teaching and learning.
• Authentic Assessment in ELT: Develop assessment tasks that mirror real-life language use situations.
• Portfolio Assessment: Investigate the use of portfolios to track language learning progress over time.
• Computer Adaptive Testing (CAT): Evaluate the feasibility and effectiveness of adaptive testing methods in ELT.

Technology in ELT

• Computer-Assisted Language Learning (CALL): Assess the impact of computer-based language learning programs.
• Mobile-Assisted Language Learning (MALL): Study the effectiveness of mobile devices in language learning.
• Online Learning Platforms for ELT: Analyze the features and usability of online platforms for language education.
• Virtual Reality (VR) in Language Learning: Explore immersive VR environments for language practice and instruction.
• Artificial Intelligence (AI) Tutoring Systems: Assess the effectiveness of AI-based tutors in providing personalized language instruction.
• Social Media in Language Learning: Study the role of social media platforms in informal language learning contexts.
• Gamification in ELT: Investigate the use of game elements to enhance engagement and motivation in language learning.

Teacher Education and Professional Development

• Pre-service Teacher Education Programs: Evaluate the effectiveness of teacher training programs.
• Reflective Practice in Teaching: Investigate how teachers reflect on their practice to improve teaching.
• Challenges in Teacher Education: Identify challenges faced by educators in training and development.
• Teacher Beliefs and Practices: Examine how teachers’ beliefs about language learning influence their instructional practices.
• Peer Observation in Teacher Development: Explore the benefits of peer observation and feedback for teacher professional growth.
• Mentoring Programs for New Teachers: Evaluate the effectiveness of mentoring programs in supporting novice teachers.
• Continuing Professional Development (CPD) Models: Compare different models of CPD for language teachers and their impact on teaching quality.

Cultural and Sociolinguistic Aspects

• Language and Culture Interrelationship: Explore the relationship between language and culture in ELT.
• Sociolinguistic Competence and Pragmatics: Study how social context influences language use and understanding.
• Gender and Identity in Language Learning: Investigate how gender identity affects language learning experiences.
• Intercultural Competence in Language Teaching: Develop strategies for promoting intercultural communicative competence in language learners.
• Language Policy and Minority Language Education: Analyze the impact of language policies on the education of minority language speakers.
• Gender and Language Learning Strategies: Investigate gender differences in language learning strategies and their implications for instruction.
• Code-Switching in Multilingual Classrooms: Study the role of code-switching in language learning and classroom interaction.

Learner Diversity and Inclusive Practices

• Teaching English to Young Learners (TEYL): Examine effective teaching strategies for children learning English.
• Addressing Learning Disabilities in ELT: Investigate methods for supporting learners with disabilities in language learning.
• ELT for Specific Purposes (ESP): Explore specialized English language instruction for specific fields.
• Differentiated Instruction in Language Teaching: Develop strategies for addressing diverse learner needs in the language classroom.
• Inclusive Pedagogies for Learners with Special Educational Needs: Design instructional approaches that accommodate learners with disabilities in language learning.
• Language Learning Strategies of Autistic Learners: Investigate effective language learning strategies for individuals on the autism spectrum.
• Language Identity and Learner Motivation: Explore the relationship between language identity and motivation in language learning.

Policy and Planning in ELT

• National and International Language Policies: Analyze policies governing English language education at different levels.
• ELT Program Implementation Challenges: Identify challenges in implementing ELT programs in diverse contexts.
• Role of ELT in National Development: Examine the contribution of English language education to national development goals.
• English as a Medium of Instruction (EMI) Policies: Analyze the impact of EMI policies on educational equity and access.
• Language Teacher Recruitment and Deployment Policies: Evaluate policies related to the recruitment and deployment of language teachers in diverse contexts.
• Language Assessment Policy Reform: Propose reforms to language assessment policies to promote fairness and validity.
• Biliteracy Development Policies: Study policies aimed at promoting biliteracy development among bilingual learners.

Research Methodologies in ELT

• Qualitative Research Methods in ELT: Explore qualitative approaches like interviews and case studies in ELT research.
• Quantitative Research Methods in ELT: Investigate quantitative methods such as surveys and experiments in language education research.
• Mixed-Methods Approaches in ELT Research: Combine qualitative and quantitative methods to gain a comprehensive understanding of research questions.
• Ethnographic Approaches to ELT Research: Conduct ethnographic studies to explore language learning and teaching in naturalistic settings.
• Case Study Research in Language Education: Investigate specific language learning contexts or programs through in-depth case studies.
• Corpus Linguistics in ELT Research: Analyze language use patterns and learner language production using corpus linguistic methods.
• Longitudinal Studies of Language Learning: Follow language learners over an extended period to examine developmental trajectories and factors influencing language acquisition.

Future Trends and Innovations

• Emerging Technologies in ELT: Study the integration of technologies like AI and VR in language teaching.
• Innovations in Teaching Strategies: Explore new approaches to teaching language, such as flipped classrooms and gamification.
• Future Directions in ELT Research: Investigate potential areas for future research in English language teaching.
• Wearable Technology in Language Learning: Explore the potential of wearable devices for delivering personalized language instruction.
• Data Analytics for Adaptive Learning: Develop data-driven approaches to adaptive learning in language education.
• Augmented Reality (AR) Applications in ELT: Design AR-enhanced language learning experiences for immersive language practice.
• Global Citizenship Education and Language Learning: Investigate the role of language education in fostering global citizenship skills.
• Eco-Linguistics and Language Education: Explore the intersection of language education and environmental sustainability.
• Metacognition and Language Learning: Explore how learners’ awareness of their own learning processes affects language acquisition.
• Peer Interaction in Language Learning: Investigate the role of peer collaboration and discussion in promoting language development.
• Heritage Language Education: Study strategies for maintaining and revitalizing heritage languages among immigrant and minority communities.
• Language Learning Motivation in Adolescents: Examine factors influencing motivation and engagement in adolescent language learners.
• Phonological Awareness in Language Learning: Investigate the role of phonological awareness in literacy development for language learners.
• Pragmatic Development in Language Learners: Explore how learners acquire pragmatic competence and understanding of language use in context.
• Digital Literacies and Language Learning: Examine how digital literacy skills contribute to language proficiency and communication in the digital age.
• Critical Language Awareness: Investigate approaches to developing learners’ critical awareness of language use and power dynamics.
• Language Teacher Identity: Study how language teachers’ identities shape their beliefs, practices, and interactions in the classroom.
• Collaborative Learning in Language Education: Explore the benefits and challenges of collaborative learning environments for language learners.
• Motivational Strategies in Language Teaching: Develop and evaluate motivational techniques to enhance student engagement and persistence in language learning.
• Heritage Language Maintenance: Investigate factors influencing the maintenance and transmission of heritage languages across generations.
• Phonics Instruction in Language Learning: Examine the effectiveness of phonics-based approaches for teaching reading and pronunciation.
• Language Policy Implementation: Analyze the challenges and successes of implementing language policies at the institutional, regional, and national levels.
• Language Teacher Cognition: Explore language teachers’ beliefs, knowledge, and decision-making processes in the classroom.
• Intercultural Communicative Competence: Develop strategies for fostering learners’ ability to communicate effectively across cultures.
• Critical Pedagogy in Language Education: Explore approaches to teaching language that promote critical thinking, social justice, and equity.
• Language Learning Strategies for Autodidacts: Investigate effective self-directed learning strategies for language learners outside formal educational settings.
• Content and Language Integrated Learning (CLIL) in Higher Education: Examine the implementation and outcomes of CLIL programs in tertiary education.
• Sociocultural Theory and Language Learning: Explore how social and cultural factors influence language acquisition and development.
• Language Socialization: Investigate how individuals learn language within social and cultural contexts, including family, peer groups, and communities.
• Speech Perception and Language Learning: Examine the relationship between speech perception abilities and language proficiency in second language learners.
• Genre-Based Approaches to Language Teaching: Explore the use of genre analysis and genre-based pedagogy to teach language skills in context.
• Learner Autonomy in Language Learning: Investigate strategies for promoting learner autonomy and independence in language education.
• Multimodal Literacy in Language Learning: Examine the integration of multiple modes of communication, such as text, image, and sound, in language instruction.
• Community-Based Language Learning: Study language learning initiatives that engage learners with their local communities and resources.
• English as a Lingua Franca (ELF) Communication: Explore the use of English as a global means of communication among speakers from diverse linguistic backgrounds.

Research in English Language Teaching covers a wide range of topics, from language acquisition theories to the impact of technology on learning. By exploring these topics (from a list of research topics in english language teaching), we can improve how English is taught and learned, making it more effective and accessible for everyone.

Continuous research and collaboration among educators, researchers, and policymakers are essential for the ongoing development of ELT.

Related Posts

Step by Step Guide on The Best Way to Finance Car

The Best Way on How to Get Fund For Business to Grow it Efficiently

Leave a comment cancel reply.

Your email address will not be published. Required fields are marked *

A .gov website belongs to an official government organization in the United States.

A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

• About Health Effects of Cigarette Smoking
• Secondhand Smoke
• E-cigarettes (Vapes)
• Menthol Tobacco Products
• Morbidity and Mortality Weekly Reports (MMWR)
• About Surveys
• Other Tobacco Products
• Smoking and Tobacco Use Features
• Patient Care Settings and Smoking Cessation
• Patient Care
• Funding Opportunity Announcements
• State and Community Work
• National and State Tobacco Control Program
• Multimedia and Tools
• Tobacco - Health Equity
• Tobacco - Surgeon General's Reports
• State Tobacco Activities Tracking and Evaluation (STATE) System
• Global Tobacco Control

E-Cigarette Use Among Youth

What to know.

E-cigarettes are the most commonly used tobacco product among U.S. youth. No tobacco products, including e-cigarettes, are safe, especially for children, teens, and young adults. Learn more about e-cigarette use among youth.

• In the United States, youth use e-cigarettes, or vapes, more than any other tobacco product. 1
• No tobacco products, including e-cigarettes, are safe, especially for children, teens, and young adults. 2
• Most e-cigarettes contain nicotine, which is highly addictive. Nicotine can harm the parts of an adolescent's brain that control attention, learning, mood, and impulse control. 2
• E-cigarette marketing, the availability of flavored products, social influences, and the effects of nicotine can influence youth to start or continue vaping. 3 4
• Most middle and high school students who vape want to quit. 5
• Many people have an important role in protecting youth from vaping including parents and caregivers, educators and school administrators, health care providers, and community partners.
• States and local communities can implement evidence-based policies, programs, and services to reduce youth vaping.

E-cigarette use among U.S. youth

In 2023, e-cigarettes were the most commonly used tobacco product among middle and high school students in the United States. In 2023: 6

• 550,000 (4.6%) middle school students.
• 1.56 million (10.0%) high school students.
• Among students who had ever used e-cigarettes, 46.7% reported current e-cigarette use.
• 1 in 4 (25.2%) used an e-cigarette every day.
• 1 in 3 (34.7%) used an e-cigarette on at least 20 of the last 30 days.
• 9 in 10 (89.4%) used flavored e-cigarettes.
• Most often used disposable e-cigarettes (60.7%) followed by e-cigarettes with prefilled or refillable pods or cartridges (16.1%).
• Most commonly reported using the following brands: Elf Bar, Esco Bars, Vuse, JUUL, and Mr. Fog.

Most middle and high school students who vape want to quit and have tried to quit. 5 In 2020:

• 63.9% of students who currently used e-cigarettes reported wanting to quit.
• 67.4% of students who currently used e-cigarettes reported trying to quit in the last year.

Most tobacco use, including vaping, starts and is established during adolescence. There are many factors associated with youth tobacco product use . These include:

• Tobacco advertising that targets youth.
• Product accessibility.
• Availability of flavored products.
• Social influences.
• Adolescent brain sensitivity to nicotine.

Some groups of middle and high school students use e-cigarettes at a higher percentage than others. For example, in 2023: 6

• More females than males reported current e-cigarette use.
• Non-Hispanic multiracial students: 20.8%.
• Non-Hispanic White students: 18.4%.
• Hispanic or Latino students: 18.2%.
• Non-Hispanic American Indian and Alaska Native students: 15.4%.
• Non-Hispanic Black or African American students: 12.9%.

Many young people who vape also use other tobacco products, including cigarettes and cigars. 7 This is called dual use. In 2020: 8

• About one in three high school students (36.8%) who vaped also used other tobacco products.
• One in two middle school students (49.0%) who vaped also used other tobacco products.

E-cigarettes can also be used to deliver other substances, including cannabis. In 2016, nearly one in three (30.6%) of U.S. middle and high school students who had ever used an e-cigarette reported using marijuana in the device. 9

• Park-Lee E, Ren C, Cooper M, Cornelius M, Jamal A, Cullen KA. Tobacco product use among middle and high school students—United States, 2022 . MMWR Morb Mortal Wkly Rep. 2022;71:1429–1435.
• U.S. Department of Health and Human Services. E-cigarette Use Among Youth and Young Adults: A Report of the Surgeon General . Centers for Disease Control and Prevention; 2016. Accessed Feb 14, 2024.
• Apelberg BJ, Corey CG, Hoffman AC, et al. Symptoms of tobacco dependence among middle and high school tobacco users: results from the 2012 National Youth Tobacco Survey . Am J Prev Med. 2014;47(Suppl 1):S4–14.
• Gentzke AS, Wang TW, Cornelius M, et al. Tobacco product use and associated factors among middle and high school students—National Youth Tobacco Survey, United States, 2021 . MMWR Surveill Summ. 2022;71(No. SS-5):1–29.
• Zhang L, Gentzke A, Trivers KF, VanFrank B. Tobacco cessation behaviors among U.S. middle and high school students, 2020 . J Adolesc Health. 2022;70(1):147–154.
• Birdsey J, Cornelius M, Jamal A, et al. Tobacco product use among U.S. middle and high school students—National Youth Tobacco Survey, 2023 . MMWR Morb Mortal Wkly Rep. 2023;72:1173–1182.
• Wang TW, Gentzke AS, Creamer MR, et al. Tobacco product use and associated factors among middle and high school students—United States, 2019 . MMWR Surveill Summ. 2019;68(No. SS-12):1–22.
• Wang TW, Gentzke AS, Neff LJ, et al. Characteristics of e-cigarette use behaviors among US youth, 2020 . JAMA Netw Open. 2021;4(6):e2111336.
• Trivers KF, Phillips E, Gentzke AS, Tynan MA, Neff LJ. Prevalence of cannabis use in electronic cigarettes among U.S. youth . JAMA Pediatr. 2018;172(11):1097–1099.

Smoking and Tobacco Use

Commercial tobacco use is the leading cause of preventable disease, disability, and death in the United States.

For Everyone

Health care providers, public health.

Advertisement

Supported by

Putin’s China Visit Highlights Military Ties That Worry the West

The Russian leader visited an institute in Harbin known for defense research. President Xi Jinping saw him off with a rare and seemingly deliberate embrace for the cameras.

• Share full article

By David Pierson

President Vladimir V. Putin of Russia attended a trade fair on Friday in a northeastern Chinese city and toured a state-backed university famous for its cutting-edge defense research, highlighting how economic and military ties between the countries have grown despite, or perhaps because of, Western pressure.

Mr. Putin’s visit to Harbin, a Chinese city with a Russian past, is part of a trip aimed at demonstrating that he has powerful friends even as his war against Ukraine — a campaign that he is escalating — has isolated him from the West. The visit followed a day of talks between him and President Xi Jinping of China that seemed orchestrated to convey not only the strategic alignment of the two powerful, autocratic leaders against the West, but a personal connection.

State media showed Mr. Putin and Mr. Xi, neckties off after formal talks on Thursday, strolling under willow trees and sipping tea at a traditional pavilion on the sprawling grounds of Zhongnanhai, the walled leadership compound in Beijing, with only their interpreters. As Mr. Xi saw Mr. Putin off in the evening, he even initiated a hug — a rare expression of affection for the Chinese leader.

“Xi’s very deliberate embrace of Putin for the cameras wasn’t just to emphasize the closeness of the political relationship between the two countries and their leaders,” said Richard McGregor, a senior fellow for East Asia at the Lowy Institute in Sydney. “There was also a touch of disdain directed at Washington, which has been pressuring Beijing to withdraw support from Moscow. That clearly isn’t going to happen in any substantive fashion.”

The show of camaraderie was the final touch in talks that culminated in a joint statement that took aim at the United States, which Mr. Putin and Mr. Xi have accused of seeking to suppress their countries. The statement pledged that Russia and China would work more closely in critical sectors like energy, space and the military.

The large size of Russia’s delegation, which included Mr. Putin’s top security and energy officials, as well the length of the bilateral meetings, implied the seriousness with which both sides have approached the negotiations, said Alexander Gabuev, a China expert at the Carnegie Russia Eurasia Center in Berlin.

“It’s like an iceberg,” he said. “The public documents are symbolic and largely meaningless. But there’s an underwater part, which is likely to be much more significant.”

Still, Mr. Putin’s visit also showed the limits of the countries alliance. In China, Mr. Xi rolled out the red carpet for Mr. Putin, but the visit did not produce any public commitments to concrete new projects or investments between the two countries.

Specifically, Mr. Putin and Mr. Xi have not publicly reported any progress on a planned new gas pipeline from China into Russia, known as Power of Siberia 2. Russia urgently needs the pipeline to redirect the flow of its gas exports from the rapidly declining market in Europe.

Mr. Putin had no news to share about the pipeline’s progress when he was asked about it in a brief news conference at the end of his trip on Friday.

“I am not prepared to discuss any technical details, but the interest of both sides in realizing these projects has been confirmed,” Mr. Putin said, referring to Power of Siberia 2.

He also deflected a question about reports that Chinese banks are reducing transactions with Russian clients out of fear of Western sanctions, turning the conversation from China to the shortcomings of the U.S. financial system.

The growing security ties between the two nuclear-armed powers was a focal point of Mr. Putin’s visit to Harbin, and the Harbin Institute of Technology.

While China and Russia are not formal allies committed to defend each other with military support, their armed forces have worked together more closely in recent years. Their air forces and navies have held joint military exercises, including near Alaska and Taiwan, the de facto independent island claimed by Beijing. On Thursday, the two leaders issued words of support for their separate claims to Taiwan and Ukraine.

And while China has vowed not to provide Russia with lethal weapons, it has been the top supplier of components like semiconductors and machine tools that have both civilian and military uses.

While that is helpful, Mr. Putin still seeks access to more sophisticated tools. The Harbin institute is best known for its research of rockets, missiles and space technology — expertise that Russia would greatly benefit from as the war in Ukraine has revived its need for a more robust military-industrial complex. The institute also trained North Korean scientists who worked on Pyongyang’s nuclear weapons program, according to The Wall Street Journal and South Korean media.

Mr. Putin’s tour of the institute was steeped in symbolism. The 103-year-old institution recently opened a joint campus with St. Petersburg State University, Mr. Putin’s alma mater. And in something of a snub to Washington, the school belongs on the United States’ so-called entity list, barring it from accessing American technology and taking part in educational exchanges because of its links to the People’s Liberation Army.

“We should be less concerned about what particular technologies China might be sharing with Russia from Harbin or elsewhere, than the larger pattern and signal that this visit represents,” said Markus Garlauskas, a security expert at the Atlantic Council.

“China did not need to host Putin at Harbin in order to transfer technologies from there to Russia,” he added. “That this visit took place so openly is a visible and symbolic sign of Beijing being willing to provide directly military-applicable technology to support Russia’s war against Ukraine.”

Song Zhongping, a commentator in Beijing who is a former military officer, defended Mr. Putin’s visit to the institute, pointing to the school’s cooperation with Russia in education.

“Communication at the university level between China and Russia is consistent with the academic exchange and national interests of both countries,” Mr. Song said.

Mr. Garlauskas said the tour of the institute had echoes of when Mr. Putin hosted Kim Jong-un, the North Korean dictator, at a Russian spaceport last year before Pyongyang began supplying Moscow with ballistic missiles and other munitions to use in Ukraine.

“What China shares with Russia, Russia could easily then turn around and share with North Korea,” Mr. Garlauskas said.

Not long ago, it was China that drew greater benefits from access to Russian military technology. Starting in the 1990s, and peaking in the early 2000s, Beijing was a major buyer of Russian arms. Sales then began to slow after Moscow grew concerned about China reverse-engineering Russian weapons, said Elizabeth Wishnick, a senior research scientist at the Center for Naval Analyses in Virginia.

It wasn’t until about a decade ago that cooperation between the two sides returned, leading to China’s acquisition of more Russian jet engine technology and surface-to-air missile systems. Still, in a sign that there are limits to its cooperation with China, Russia is holding out sharing its silent submarine technology, a feature that makes the vessels especially hard to detect, Ms. Wishnick said.

Mr. Putin is also using his visit to Harbin, where he attended a trade fair, to promote the flow of goods between the countries.

China has given Russia an economic lifeline by buying huge amounts of Russian oil to circumvent the effects of its financial isolation from the West. Not only that, with many foreign consumer brands also leaving Russia, Chinese companies have stepped in to fill a vacuum for the likes of automobiles , smartphones and televisions. That contributed to a record $240 billion in two-way trade between the China and Russia in 2023, up from $190 billion in 2022, according to Chinese customs data.

Maintaining that growth in trade is a major focus in both countries, analysts said, now that Western pressure on Chinese banks to scale back transactions with Russian firms is believed to have led to the first year-on-year decline in trade in more than two years in March.

One solution would be to increase the amount of transactions settled in local currencies rather than dollars to avoid the risk of sanctions. Mr. Putin said on Thursday that more than 90 percent of commercial transactions conducted between Russia and China were now being cleared in rubles or renminbi.

“Protecting the financial assets of big banks in China is the top crucial interest of China,” said Shi Yinhong, an international relations professor at Renmin University in Beijing. He said China was trying to reduce its exposure to the dollar beyond just in Russia, but that the room to do so was “limited.”

Olivia Wang and Anatoly Kurmanaev contributed reporting.

David Pierson covers Chinese foreign policy and China’s economic and cultural engagement with the world. He has been a journalist for more than two decades. More about David Pierson

Our Coverage of the War in Ukraine

News and Analysis

As Russia’s war effort in Ukraine intensifies, it is increasingly clear that efforts by the West to squeeze Moscow’s oil revenues are faltering .

The United States and Europe are coalescing around a plan to use interest earned on frozen Russian central bank assets to provide Ukraine with a loan to be used for military and economic assistance .

The Chinese leader Xi Jinping’s talks with President Vladimir Putin of Russia were a show of solidarity  between two autocrats battling Western pressure.

Europe’s Defense Industry: Russia’s invasion of Ukraine jolted Europe out of complacency about military spending. But the challenges are about more than just money .

Putin’s Victory Narrative: The Russian leader’s message to his country appears to be taking hold : that Russia is fighting against the whole Western world — and winning.

A Boxing Win Offers Hope: The Ukrainian boxer Oleksandr Usyk became the world’s undisputed heavyweight champion, a victory that has lifted morale  in a country struggling to contain Russian advances.

How We Verify Our Reporting

Our team of visual journalists analyzes satellite images, photographs , videos and radio transmissions  to independently confirm troop movements and other details.

We monitor and authenticate reports on social media, corroborating these with eyewitness accounts and interviews. Read more about our reporting efforts .