Home » Application » Application Letter for Missing Result – Sample Letter Regarding Missing Result
Application Letter for Missing Result – Sample Letter Regarding Missing Result
Table of Contents:
- Sample Letter
Live Editing Assistance
How to use live assistant, additional template options, download options, share via email, share via whatsapp, copy to clipboard, print letter, sample letter regarding missing result.
To, The Registrar, __________ (University Name), __________ (Address)
Date: __/__/____ (Date)
Subject: Issuance of result _________ (University roll number)
Respected Sir/ Madam,
I would most respectfully state that my name is _________ (name) and I am a student of _________ (year/ department) of your esteemed University having roll number _________ (University roll number).
I am writing this letter to state that the result for my batch was declared on __/__/____ (Date) but unfortunately, my result was not available on the portal. As per the records my result is ________ (RLA/missing/any other). I request you to kindly look into the matter and do the needful.
I shall be highly obliged for your kind support.
Thanking You,
_________ (Name), _________ (Roll Number), _________ (Contact Number)
Live Preview
The Live Assistant feature is represented by a real-time preview functionality. Here’s how to use it:
- Start Typing: Enter your letter content in the "Letter Input" textarea.
- Live Preview: As you type, the content of your letter will be displayed in the "Live Preview" section below the textarea. This feature converts newline characters in the textarea into <br> tags in HTML for better readability.
The letter writing editor allows you to start with predefined templates for drafting your letters:
- Choose a Template: Click one of the template buttons ("Start with Sample Template 1", "Start with Sample Template 2", or "Start with Sample Template 3").
- Auto-Fill Textarea: The chosen template's content will automatically fill the textarea, which you can then modify or use as is.
Click the "Download Letter" button after composing your letter. This triggers a download of a file containing the content of your letter.
Click the "Share via Email" button after composing your letter. Your default email client will open a new message window with the subject "Sharing My Draft Letter" and the content of your letter in the body.
Click the "Share via WhatsApp" button after you've composed your letter. Your default browser will open a new tab prompting you to send the letter as a message to a contact on WhatsApp.
If you want to copy the text of your letter to the clipboard:
- Copy to Clipboard: Click the "Copy to Clipboard" button after composing your letter.
- Paste Anywhere: You can then paste the copied text anywhere you need, such as into another application or document.
For printing the letter directly from the browser:
- Print Letter: Click the "Print Letter" button after composing your letter.
- Print Preview: A new browser window will open showing your letter formatted for printing.
- Print: Use the print dialog in the browser to complete printing.
- If your result is missing after the declaration, promptly inform the university authorities in writing about the issue.
- Yes, providing your roll number helps the authorities identify and locate your records efficiently.
- Yes, mentioning the date of result declaration provides context and helps the authorities understand the timeline of the issue.
- Response times may vary, but you can typically expect a response within a reasonable timeframe, depending on the university's administrative procedures.
- If you don't receive a response within a reasonable timeframe, consider following up with the university authorities or seeking assistance from relevant departments.
Incoming Search Terms:
- sample letter to University complaining about result missing
- missing result complaint letter to college
By letterskadmin
Related post, application letter for workshop attendance – sample letter applying for workshop participation.
Application for Exemption from Duty – Sample Application for Seeking for Exemption from Duty
Application for student bus pass – sample application for requesting for student bus pass, leave a reply cancel reply.
You must be logged in to post a comment.
Congratulations Letter to Colleague On Promotion – Sample Letter to Congratulate Colleague On Promotion
Food diet chart request letter – sample letter requesting food diet chart, letter to embassy for visa refusal reason – sample letter requesting reason for visa refusal, holiday request letter – sample letter requesting leave, privacy overview.
30,000+ students realised their study abroad dream with us. Take the first step today
Here’s your new year gift, one app for all your, study abroad needs, start your journey, track your progress, grow with the community and so much more.
Verification Code
An OTP has been sent to your registered mobile no. Please verify
Thanks for your comment !
Our team will review it before it's shown to our readers.
How to Write an Application to the Principal – Learn Here with Format & Samples
- Updated on
- Apr 5, 2023
Writing an application to the principal is an important part of the English syllabus in school. Schools teach application writing to familiarize students with the proper format and composition for a Formal Application. Submitting a properly formatted application will set you apart from the rest no matter if it is for a leave, fee concession or transfer to a different stream.
Creating an impressive Formal Application to the principal is easy to do. All you have to do to master this skill is to understand the application’s format and structure and maintain a respectable tone. This blog brings you a detailed guide on writing an application to the principal, its format and style of writing as well as useful samples.
This Blog Includes:
What is an application to the principal, things to keep in mind, format for writing an application to the principal, application for casual leave, application for sick/ medical leave, application to the principal for sick leave written by parents, application for school transfer, application to principal for leave due to marriage in family, application to the principal for one day’s leave.
Check Out: Letter to the Editor
An application to the principal is a formal way to place a request in front of the school authorities. It can be written for different reasons such as:
- For Sick Leave
- For Full Fee Concession
- For Change of Section
- For Admission-related queries and concerns
- For Transfer Certificate
- For Change of Stream, etc.
While creating the application, you must specify the reason for writing it. Don’t forget to add any other related factors as well.
Certain pointers can help you in drafting a well-written application. Mentioned below are some useful tips and tricks that can make your application to the principal more appropriate and better to read:
- the number of days for the leave
- amount of fee concession required
- medical certificate or any other proof (as required)
- Do not write a very long application. Keep it short and concise..
- Ensure that the grammar, syntax and structure of the application is correct.
- State your request clearly and respectfully in an official manner.
Recommended Read: Job Application Letter
The format of the application means the structure that is to be followed when drafting an application to the Principal. Below is the standard format for writing an application to the Principal:
Sample Applications to the Principal
Now that you are familiar with the format, let’s take a look at a sample application to the principal.
Write an application to the Principal asking for leave for three days because of a wedding you have to attend.
Write an application to the principal asking for medical leave.
The Principal Mary Public School Gurgaon, Haryana 122XXX 8th September, 20XX
Subject: Application for a Sick Leave
Dear Sir/Madam
I Sonal Rajput, am a student of Class X of your school. I have been diagnosed with jaundice and the doctor has advised me to rest for one week. Please grant me leave from (date) to (date).
I have attached the medical certificate issued by a doctor for reference. I will resume my classes from (date)
Thanking you,
Yours obediently, Sonal Rajput Class X 07
Write an application to the principal asking for leave for your child as he/she is sick.
I would like to bring to your kind attention that my son/daughter (name), a student of Class X of your school will not be able to attend school for the next few days. She is hospitalized and diagnosed with jaundice.
The medical certificate issued by the doctor is attached herewith for your reference. She/he will attend school from next week as advised by doctors.
Thanking you, (Name) (Signature of the parent)
Write an application to the principal asking for a transfer certificate as you want to transfer to a different school.
There is a marriage in your family because of which you will not be able to attend school for 4 days. Write an application to your principal asking for leave for the same.
Subject: Application for a Marriage Leave
I am Pallavi Sehgal, a student of Class X of your school. I would like to bring to your kind attention that I will not be able to attend school for 4 days. There is a marriage in my family for which I have to leave town. I will not be able to attend school between (date) to (date). Please grant me leave for the same.
Yours obediently, Pallavi Sehgal Class X 07
Write a letter to your principal asking for leave for one day.
Subject: Application for One Day Leave
My name is Shubhangi Sharma, a student of Class X of your school. Due to some personal emergency, I have to take one day’s leave and won’t be able to attend school tomorrow. Please grant me leave as I will not be able to come tomorrow.
Yours obediently, Shubhangi Sharma Class X 07
Start your letter with the address and date, followed by the subject, salutation and then the body of the letter in which you convey the reason behind your letter.
It is important to clearly mention the date on which you would be absent from school because it gives clarity and is also used for attendance management and documentation.
A letter to the School Principal or any higher authority should always be in the format of a formal letter as it is concerned with matters of personal and professional importance. The language used should be formal as well.
The format for writing an application to the principal includes the sender’s details (name, class, section), the principal’s name and designation, the date, a subject line, a salutation, the body of the letter (clearly stating the purpose or request), a closing, and the sender’s signature.
The tone of an application to the principal should be polite, formal, and respectful.
We hope that this blog helped you understand the format and structure of writing an application to the principal. If you have any questions, feel free to drop them in the commet box below.
Team Leverage Edu
Leave a Reply Cancel reply
Save my name, email, and website in this browser for the next time I comment.
Contact no. *
Leaving already?
8 Universities with higher ROI than IITs and IIMs
Grab this one-time opportunity to download this ebook
Connect With Us
30,000+ students realised their study abroad dream with us. take the first step today..
Resend OTP in
Need help with?
Study abroad.
UK, Canada, US & More
IELTS, GRE, GMAT & More
Scholarship, Loans & Forex
Country Preference
New Zealand
Which English test are you planning to take?
Which academic test are you planning to take.
Not Sure yet
When are you planning to take the exam?
Already booked my exam slot
Within 2 Months
Want to learn about the test
Which Degree do you wish to pursue?
When do you want to start studying abroad.
September 2024
January 2025
What is your budget to study abroad?
How would you describe this article ?
Please rate this article
We would like to hear more.
How to Write an Application to the Principal: Step-By-Step Guide with Sample Letters & Templates
May 20, 2023
Writing an application to the principal is crucial for seeking permission, scheduling meetings, reporting issues, and making suggestions.
It is a formal and structured way of communicating with the school’s administration, ensuring that matters are handled appropriately and respectfully.
Applications to the Principal Are Required in What Situations
Some common situations where a formal application to the principal is required are:
- Permission to participate in extracurricular activities
- Seeking admission to the best boarding schools in Mumbai
- Complaints or grievances
- Request for leave ( leave letter to principal )
- Suggestions or feedback
- Request for certificate or recommendation letter
- Request for transfer or change of section
Step-by-step Guide on How to Write the Application – Format to Follow
- Opening Statement and Introduction
Start the application by addressing the principal respectfully and introducing yourself (mandatory in case of a leave letter to principal). For example, “Respected Principal, I am writing this application to request a leave.”
- Clearly Stating the Purpose of the Application
In the next paragraph, clearly state the purpose of the application using your communication skills. For example, “I am writing to request permission to attend a sports event.”
- Providing Relevant Details and Supporting Information
In the following paragraphs, provide relevant details and supporting information to strengthen your case. For example, mention the dates and timings of the event.
- Closing Statement and Expression of Gratitude
End the application by thanking the principal for considering your request and expressing hope that permission is granted. For example, “Thank you for considering my request. Your support will be highly appreciated.”
Also Read: * The Impact Of Teacher-Student Relationships On Academic Success * List Of Animals And Their Homes With Young Ones- Images & Names * Who Invented Zero First | Guide To The History & Invention Of Zero * 5 Simple Daily Habits To Reduce Stress & Improve Focus * Advantages Of Reading Newspaper For Students & Tips To Cultivate The Habit
Examples of Sample Applications to the Principal
> sample application – how to write permission letter to principal.
To Principal
MIT Vishwashanti Gurukul,
Pune Location Rajbaug,
Maharashtra - 412 201
Date: 7th January 2023
Subject: Request for Permission to Attend a Seminar
Respected Sir/Ma'am,
I, Aditi Gupta of class 10th- want your permission to attend the upcoming seminar on Effective Communication with Childrens . The seminar is scheduled to take place on 2nd February from 9.00 AM to 11.00 AM at Public Auditorium.
The English speech topics that will be covered in the seminar are closely related to my course of study, and I am confident that attending it will help me improve my understanding of the subject.
Please grant me permission to attend the seminar. Thank you for your consideration. Let me know if more information is required.
Yours faithfully,
Aditi Gupta,
> Sample Job Application - What is a Cover Letter for a Job Application
A cover letter is essential when applying for a job. It highlights your qualifications and skills that match the job and convinces the employer to invite you for an interview.
Here's a sample job application cover letter:
Aditi Gupta
Meridian Apartment
Mumbai - 400001
6th January 2023
Sunil Kapoor
L&T Company
Dear Mr. Kapoor,
> Sample Leave Application- How To Write a Leave Application to Principal
Date: 13th April 2023
Subject: Leave Application to Principal for Attending a Family Function
Respected Principal,
I am writing this application to bring to your notice that I, Aditi Gupta of class 10th-A, will not be able to attend school for the coming 2 days as I have to attend my cousin's wedding.
I would kindly request you to grant me leave of absence from school for 2 days, starting from 20th April to 21st April. I understand my absence may affect the school's schedule and my academic progress. I'll ensure I keep up with my studies during my absence.
I would be grateful if you could grant me leave for the above-mentioned dates. Thank you for your consideration.
Importance of Reviewing and Editing the Application for Errors and Clarity
Reviewing and editing your formal application to principal is crucial for ensuring that it is error-free and clear. By taking the time to review and edit your application, you can increase your chances of success and achieve your desired outcome. Here are some reasons why it is important:
- It enhances clarity
- Helps to avoid errors
- Ensures accuracy
- Improves overall quality
Tips for Finalizing the Application
- Use spellcheck and grammar check tools like Grammarly to catch any obvious errors when writing a letter to principal for leave.
- Have someone else review the application for errors and clarity to catch errors that you may have missed.
- Check that all required materials have been included and are in the correct format.
- Follow the instructions and guidelines provided by the program or institution.
- Use a clear and concise writing style, avoid jargon and technical terms, and keep the sentences short and to the point.
- Consider the tone and professionalism of the application and avoid using slang or humour.
- Submit the application before the deadline.
To wrap up, writing a strong application or formal letter to principal is crucial for students, parents, and teachers. Use the step-by-step guide with examples to craft any type of formal application to principal . If you need further assistance, consider reaching out to MIT Gurukul, one of the best schools in India , for guidance and support.
A letter of introduction is a type of correspondence that is typically used to introduce oneself. Reading newspaper habit can improve your letter-writing skills.
A cover letter should have your introduction, highlight your relevant skills and experience, and express your interest.
It is a formal letter to principal for permission, information, or some other form of assistance. For example, a letter to principal for leave .
To end an application letter, you should express your gratitude. It should end with “sincerely, or best regards”, followed by your name.
Previous Post
Role of Social Media in Education: 10 Ways To Use Social Media For Education
Self introduction in english for students: 5 easy ways to introduce yourself in english.
How To Writing
How to Write Application to Principal: A Step-by-Step Guide
Are you a student, parent, or teacher looking to How To write application to principal? Whether it’s for requesting leave, addressing a concern, or seeking permission, composing an effective application is crucial. In this comprehensive guide, we’ll walk you through the process of crafting a well-structured and impactful application that will get noticed by the principal.
THIS BLOG INCLUDES:
What is an Application to the Principal?
What’s a Letter to the Principal? Sometimes, you might need to write a letter to your school principal. You could do this for different reasons, like:
- Telling the Principal You’re Sick and Can’t Come to School
- Asking for a Discount on School Fees
- Wanting to Change Your Class Section
- Having Questions About Joining the School
- Needing a Paper to Say You’re Leaving the School
- Deciding to Change the Subjects You’re Studying And more things like that.
When you write the letter, you need to explain why you’re writing it and give all the details. For example, if you’re asking for leave because you’re not feeling well, say why and for how many days. And when you write, make sure to be polite and keep it short.
Important Points to Remember Here are some things to remember when writing a good application. These tips can help you make your letter to the principal clear and easy to understand:
- Say why you’re writing the application and be clear about it. Also, if needed, mention details like how many days you need off for leave or any reasons for fee concessions.
- Write your application with respect, and don’t make it too long.
- Check your grammar, sentences, and how your application is organized. It should be error-free.
Keep these points in mind when you write your application to the principal. It will help you create a good letter!
Format of Application to the Principal
The way you set up your application is really important. It helps you organize your thoughts when writing to the Principal. Here’s a common format to use:
Receiver’s Address [Write down who you’re addressing, like ‘The Principal’, and then the school’s address.]
Date [Put the date when you’re writing the application. This makes it official.]
Subject [A short sentence that tells why you’re writing this application.]
Salutation [This is where you say ‘Sir’ or ‘Madam’ to show respect. Use both if you’re not sure about the person’s gender.]
Body of the Application [Start by saying your name and class. Then explain why you’re writing this application. You can mention things like the reason for wanting leave or asking for a fee reduction. Also, include how many days you need for leave or why you need the fee reduction. Be polite and thankful to the Principal for reading your application.]
Closing Line [End the application with a closing like ‘Yours Obediently’ or ‘Yours Sincerely’.]
Your Name and Details [Finish by writing your name, class, roll number, and any other important details.]
Application Format
(Address of the Receiver) (The Principal) (School’s Address)
(Date) (Write the Date)
Subject: (State the Purpose of the Application)
Respected Sir/Madam,
I hope this letter finds you well. My name is (Your Name) and I am a student of (Your Class) in (Your Section). I am writing this application to bring to your attention the matter of (Explain the Reason for the Application, such as seeking leave or requesting fee concession).
(Explain the Details of Your Request. For example, if requesting leave, mention the dates and the reason. If seeking fee concession, provide the reason for the request along with any relevant details.)
I am aware of the rules and responsibilities of a student, and I deeply value my education. (Express Gratitude for Considering Your Request, e.g., “I am thankful for your consideration of my request and your understanding of my situation.”)
I kindly request your approval for (Explain What You Are Requesting, e.g., granting me leave for the mentioned dates / considering my request for fee concession). Your guidance and support are crucial to me in this matter.
I would like to express my sincere appreciation for your time, understanding, and patience in considering my request. Thank you for your dedication to the well-being of the students.
(Yours Obediently/Sincerely), (Your Name) (Class, Section, Roll No., and Any Other Details)
Thank you for your attention, and I look forward to your positive response.
Sincerely, (Your Name)
I hope this helps you understand the format better. Read more points below for How to Writing a Application To sir/Principal:
Choosing the Right Format
When writing an application, it’s important to choose the appropriate format. Use a formal letter format with your address, the date, the principal’s name and designation, and a subject line that briefly describes the purpose of the application.
Writing the Salutation
Begin with a respectful salutation addressing the principal by their proper title, such as “Dear Principal [Last Name].”
Clearly Stating the Purpose
In the opening paragraph, clearly state the purpose of your application. Whether you’re requesting leave, seeking permission, or addressing an issue, the principal should know what the application is about from the beginning.
Providing Necessary Details
In subsequent paragraphs, provide all the necessary details related to your request. Be specific and concise, including dates, reasons, and any supporting information required.
Being Polite and Respectful
Maintain a polite and respectful tone throughout the application. Use courteous language and avoid using slang or overly casual expressions.
Requesting Action
Clearly specify what action you are requesting from the principal. Whether it’s granting permission, addressing a concern, or approving leave, make sure your request is clear and direct.
Expressing Gratitude
Before closing the application, express your gratitude for the principal’s time and consideration. A simple sentence conveying your appreciation can leave a positive impression.
Proofreading and Editing
Always proofread your application for grammar and spelling errors. A well-written and error-free application reflects your attention to detail and professionalism.
Formatting and Presentation
Ensure that the application is neatly formatted and well-presented. Use a legible font and maintain consistent spacing and alignment.
Sample Applications to Principal
Here’s a sample application to give you a better understanding of how to put the above steps into practice:
[Your Address] [City, State, ZIP Code] [Date] Dear Principal [Last Name], Subject: Application for Leave I hope this letter finds you in good health. I am writing to request a leave of absence from [start date] to [end date] due to [reason for leave]. I assure you that my absence will not hinder the progress of my studies, as I am committed to making up for the missed classes during my absence. I kindly request your approval for this leave and will ensure that all my pending assignments are completed before I leave. Thank you for considering my request. Yours sincerely, [Your Name]
Dos and Don’ts
- Do: Be clear, concise, and polite.
- Do: Provide all necessary details.
- Do: Proofread for errors.
- Don’t: Use slang or casual language.
- Don’t: Forget to express gratitude.
- Don’t: Be vague or ambiguous.
Tips for a Strong Impression
- Craft a compelling subject line.
- Keep the application focused and to the point.
- Use a confident and respectful tone.
- Address the principal appropriately.
Common Mistakes to Avoid
- Ignoring proper formatting.
- Making grammatical or spelling mistakes.
- Being overly lengthy or repetitive.
- Failing to clearly state the purpose.
Writing an application to the principal doesn’t have to be daunting. By following the steps outlined in this guide, you can create a well-structured, respectful, and effective application that communicates your message clearly. Remember to proofread and edit before submitting your application for the best results.
1. Can I address the principal by their first name? It’s advisable to address the principal using their formal title and last name to maintain a respectful tone.
2. How do I format the date in the application? The date should be written in the format: [Month Day, Year], e.g., August 10, 2023.
3. Is it necessary to provide a subject line? Yes, a subject line briefly summarizing the purpose of the application helps the principal understand the content quickly.
4. Can I use bullet points in my application to list reasons? It’s better to use complete sentences to convey your reasons clearly. Bullet points can sometimes appear less formal.
5. Should I mention my contact details in the application? While your address is usually included at the top, you can provide an email or phone number for contact if necessary.
Must Read: How to Write Mam Parichay in Sanskrit
Leave a comment Cancel reply
Save my name, email, and website in this browser for the next time I comment.
How to Write an Application to the Principal – Learn Here with Format & Samples
Writing an application to the principal is an important part of the English curriculum in school. Schools teach application writing to familiarize students with the proper format and structure for a formal application. Submitting a properly formatted application will set you apart from the rest, be it for leave, fee concession or transfer to a different stream.
Creating an impressive formal application to a principal is easy. To master this skill, all you need to do is understand the format and structure of the application and maintain a respectful tone. This blog brings to you a detailed guide on writing an application for principal, its format and writing style as well as useful samples.
Check Out: Letter to the Editor
What is an Application to the Principal?
An application to the principal is a formal way to place a request in front of the school authorities. It can be written for different reasons such as:
- For Sick Leave
- For Full Fee Concession
- For Change of Section
- For Admission-related queries and concerns
- For Transfer Certificate
- For Change of Stream, etc.
While creating the application, you must specify the reason for writing it. Don’t forget to add any other related factors as well.
Things to Keep in Mind
Certain pointers can help you in drafting a well-written application. Mentioned below are some useful tips and tricks that can make your application to the principal more appropriate and better to read:
- the number of days for the leave
- amount of fee concession required
- medical certificate or any other proof (as required)
- Do not write a very long application. Keep it short and concise..
- Ensure that the grammar, syntax and structure of the application is correct.
- State your request clearly and respectfully in an official manner.
Format for Writing an Application to the Principal
The format of the application means the structure that is to be followed when drafting an application to the Principal. Below is the standard format for writing an application to the Principal:
Formal Letter Format, Types and Samples
Sample Applications to the Principal
Now that you are familiar with the format, let’s take a look at a sample application to the principal.
Application for Casual Leave
Write an application to the Principal asking for leave for three days because of a wedding you have to attend.
The Principal
Mary Public School Gurgaon, Haryana 122XXX 25th June, 20XX
Subject: Application for Leave from [Start Date] to [End Date]
Dear Sir/Madam I would like to bring to your kind attention that my name is Aman Sharma, a Student of Class XI of your school. Next week, I have to attend my cousin’s marriage in Jaipur and I would not be able to attend school from 1st July, 20XX to 3rd July, 20XX. I will rejoin from 4th July, 20XX. I would be highly obliged if you will grant me leave for three days. I shall be thankful to you.
Thanking you,
Yours Obediently,
Aman Sharma Class XI 011
Application for Sick/ Medical Leave
Write an application to the principal asking for medical leave.
Mary Public School Gurgaon, Haryana 122XXX 8th September, 20XX
Subject: Application for a Medical Leave
Dear Sir/Madam I would like to bring to your kind attention that my name is Nupur Sharma, a student of Class X of your school. I have been diagnosed with dengue and the doctor has advised me to rest for two weeks to recover from it. As a result, I would not be able to appear for the class tests that have been scheduled for next week. I shall be grateful if you exempt me from appearing for the exams or allow me to appear for them at a later date.
The medical certificate issued by the doctor is attached herewith. Thanking you,
Yours obediently,
Nupur Sharma Class X 07
Mary Public School Gurgaon, Haryana 122XXX 26th September, 20XX
Dear Sir/Madam I would like to bring to your kind attention that my name is Sayani Dutta, a student of Class XII of your school. I have been diagnosed with chickenpox and have been advised complete rest at home by my doctor for ten days. I would request you to kindly grant me leave for the mentioned number of days. The medical certificate issued by the doctor is attached herewith. Thanking you,
Yours obediently, Sayani Dutta Class XII 18
Subject: Application for a Sick Leave
Dear Sir/Madam I Sonal Rajput, am a student of Class X of your school. I have been diagnosed with jaundice and the doctor has advised me to rest for one week. Please grant me leave from (date) to (date). I have attached the medical certificate issued by a doctor for reference. I will resume my classes from (date) Thanking you,
Yours obediently, Sonal Rajput Class X 07
Application to the Principal for Sick Leave Written by Parents
Write an application to the principal asking for leave for your child as he/she is sick.
Subject: Application for a Sick Leave Dear Sir/Madam I would like to bring to your kind attention that my son/daughter (name), a student of Class X of your school will not be able to attend school for the next few days. She is hospitalized and diagnosed with jaundice. The medical certificate issued by the doctor is attached herewith for your reference. She/he will attend school from next week as advised by doctors. Thanking you,
(Name) (Signature of the parent)
Application for School Transfer
Write an application to the principal asking for a transfer certificate as you want to transfer to a different school.
Mary Public School Gurgaon, Haryana 122XXX 11th September, 20XX
Subject: Application for issuing a transfer certificate Dear Sir/Madam I am Ananya Rai, a student of Class IX of your school. With due respect, I want to inform you that my father has been transferred to a new city and therefore I would be unable to continue my studies at this school. I request you to kindly issue a transfer certificate at the earliest so that I can get admitted to a school at the new place of posting. Thanking you,
Yours obediently, Ananya Rai Class IX 14
Letter Writing
Message Writing
Application to Principal for Leave Due to Marriage in Family
There is a marriage in your family because of which you will not be able to attend school for 4 days. Write an application to your principal asking for leave for the same.
Subject: Application for a Marriage Leave
Dear Sir/Madam I am Pallavi Sehgal, a student of Class X of your school. I would like to bring to your kind attention that I will not be able to attend school for 4 days. There is a marriage in my family for which I have to leave town. I will not be able to attend school between (date) to (date). Please grant me leave for the same. Thanking you, Yours obediently,
Pallavi Sehgal Class X 07
Application to the Principal for One Day’s Leave
Write a letter to your principal asking for leave for one day.
Subject: Application for One Day Leave
Dear Sir/Madam My name is Shubhangi Sharma, a student of Class X of your school. Due to some personal emergency, I have to take one day’s leave and won’t be able to attend school tomorrow. Please grant me leave as I will not be able to come tomorrow. Thanking you,
Yours obediently, Shubhangi Sharma Class X 07
How do I start a letter to the school principal? Start your letter with the address and date, followed by the subject, salutation and then the body of the letter in which you explain the reason behind your letter.
Is it necessary to mention the dates on which I am taking leave? It is important to clearly mention the date on which you will be absent from school as it gives clarity and is also used for attendance management and documentation.
What kind of letter should I write to the principal? A letter to the school principal or any higher authority should always be in this format A formal letter because it deals with matters of personal and professional importance. The language used should also be formal.
What is the format for writing an application to the principal? The format for writing an application to the principal includes details of the sender (name, class, section), name and designation of the principal, date, a subject line, a salutation, the body of the letter (clearly stating the purpose or request) . , a closing, and the sender’s signature.
What should be the tone of the application to the principal? The tone of the application to the principal should be polite, formal and respectful.
We hope this blog has helped you understand the format and structure of writing an application to the principal. If you have any questions, feel free to leave them in the comment box below.
Automated page speed optimizations for fast site performance
English that goes straight to the heart
Application to Principal
An Application to Principal is a formal application letter of your absence for different reasons from your school, college, or any other educational space.
These letters can be recognized by their tone which is often a combination of politeness and formality and their short length.
Daily Test - Attempt Now
In this post, we have written some Tips, Formats, and the top examples of ‘Application to Principal.’
Application to Principal Tips
- Write the heading and reference number properly.
- Begin with the very formal Sir/Madam. If the writer and the recipient are of the same rank, use Dear Sir/Dear Madam. Never use My Dear Sir/My Dear Madam.
- Mention the subject in brief.
- The body of the letter should be concise and to the point.
- Use the subscription ‘Yours faithfully.’
- Use the full signature of the writer.
Application to Principal Format
Sender’s Address ……………….
Date: (DD/MM/YYYY)
Recipient’s Name,…………….. Designation & …………………. Address……………………………
Subject: (One short sentence stating the purpose of the letter.)
Salutation, (E.g.: Dear …,)
Introduction: (Begin by introducing yourself and the purpose of writing the letter.) …………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………..
Body Paragraph: (Explain the situation in detail listing factual information needed to validate your point.) ……………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………..
Conclusion: (End the letter by restating your request or an assurance, whichever is the case.) …………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………..
Thanking you. Complimentary Ending: (E.g.: Yours sincerely/faithfully,) Sender’s Signature Sender’s Name Sender’s Designation
Application to Principal Examples
Application to principal example #1.
To, The Principal Model High School Dum Dum, Kolkata
Subject: Application for leave
Honourable Sir,
With due respect, I beg to state that I am suffering from a fever since last night. My doctor has advised me to take a day’s rest. I am unable to attend school today.
In these circumstances, kindly grant me leave for one day. In case of required extra days of leave, I will let you know.
I would be obliged if you accept my leave application.
Yours sincerely,
Rajesh Gupta Class 10, Sec A 27th April 2022
Also, Read Permission Letter to Principal
Application to Principal Example #2
To, The Principal New Foundation High School Sinthi More, Kolkata
Sub: Medical leave application letter
With due respect, I wish to state that, I am suffering from a fever since last afternoon. I visited the hospital last night with my father for treatment. The doctor has prescribed a medicine course and the doctor has advised me complete bed rest for 2 days. I can not attend school from 27th April 2022. I will be mostly available after the 28th of April to resume school.
I have enclosed all the necessary documents including a letter of recommendation from my doctor.
Yours Obediently,
Rakhi Gupta Class 10, Sec A 27th April 2022
Application to Principal Example #3
To, The Principal Model Foundation High School Sinthi More, Kolkata
Sub: Requesting 2 days’ leave
Dear Madam,
With due respect, I am writing this request letter to apply for 2 days’ leave from 10/06/23 to 11/06/23. I am going out of the station to attend a marriage. For this reason, I need 2 days’ leave.
So, please give your approval to take 2 days of leave.
I would be thankful for your consideration.
Yours faithfully,
Tapas Sen Class 10, Sec A 27th April 2022
Also, Read Leave Application to Principal by Teacher
Application to Principal Example #4
Sub: leave application for going out of the station
With due respect, I beg to state that as I am going out of the station for vacation and I won’t be available for the next 5 days (from 27 April to 1 May).
So please allow me these 5 days’ leave. I will be grateful.
Tanisha Sen Class 10, Sec A 27th April 2022
Application to Principal Example #5
To, The Principal New Model High School Sinthi More, Kolkata
Sub: leave application
Respected Madam,
Most humbly I beg to say that, I am Tanisha Sen, a student of your class 10, (sec A) of your school. I want to say that my uncle’s marriage ceremony is going to be held in our village on 28th April. I want to join the Marriage and want to help in the ceremony. I need a leave for 1 week.
So, please give your approval to take one week’s leave.
Application to Principal Example #6
To, The Principal Lowada High School Lowada, Debra, Paschim Medinipur, WB
Subject – Sick Application Letter
With due respect, I wish to state that, I have been suffering from a fever for 1 day. Due to the high temperature, I am experiencing severe body discomfort. The doctor told me that I have Typhoid fever . The doctor suggests taking rest for at least 15 days. I am unable to attend school from Today (27th April).
In these circumstances, Kindly grant me leave for 15 days. In case of required extra leaves, I will inform you.
I will be highly obliged for your consideration.
Rajesh Sen Class 10, Sec B 27th April 2022
Also, Read Leave Application to the Principal
Application to Principal Example #7
Sub: leave application for fever
With due respect, I am writing this request letter to apply for a day of sick leave from 10/06/23 to 11/06/23. I have been suffering from high fever since last night. My father will take me to the doctor today for a checkup. For this reason, I need four days’ leave.
So, please give your approval to take four days of sick leave.
Application to Principal Example #8
Subject: Sick Leave Application
Respected Sir,
This is to bring to your notice that, I need a full day’s leave due to an emergency at home. I will attend school and even will try to arrive after the situation is soothed.
Sir, I require this leave due to the illness of my Grandfather (70 years old). He was suffering from high fever from last night. He has been admitted to AMRI international hospital. I need to stay with him in this situation as none of my ménage belongs to this city and we are living apart from our families.
Kindly grant me a leave for today. I shall be grateful to you.
Nisha Mondal Class 10, Sec A 27th April 2022
Application to Principal Example #9
To, The Principal Alipurduar High School Alipurduar, West Bengal
With due respect, I beg to state that I am feeling very unwell right now. Due to the high temperature, I am experiencing severe body discomfort. So I am quite unable to stay in the class any longer. I, therefore, pray to you for granting me a leave of absence for the remaining periods.
I remain, Yours obediently, Place: Alipurduar Pallabi Sarkar, Date: May 5, 2023 Class-X, Section-A, Roll No.-5
Application to Principal Example #10
To, The Principal Foundation High School Sinthi More, Kolkata
With due respect, I beg to state that my son, Sumit Bagchi of Class-IX of your institution, could not attend school on 11th May 2023 instant owing to a sudden attack of fever.
I, therefore, request you to kindly grant him a leave of absence for those days.
Tapan Kumar Bagchi Place: Sinthi More. Date: May 10, 2023
You Asked, We Listened – Get Free Access to All Writing Lists 😍😍
Top 10 Formal Letter Examples
Read More »
How to Write a letter to the Editor
Daily reading comprehension test - attempt now, discover more from english luv.
Subscribe now to keep reading and get access to the full archive.
Type your email…
Continue reading
- Scholarships
- Certificates
- Applications
- Communication
How to Write an Application to the Principal: Format and Samples
An application to principal is a formal written request submitted by a student to the head of the school. It is an important communication tool for students to convey various needs or issues faced in academic or administrative matters. Learning how to properly write an application to the principal is an essential skill for every student.
How To Write An Application To The Principal?
When drafting an application letter to your school principal, follow these key steps:
Use the Proper Format
An application letter has a set professional format that must be followed:
- Sender’s Details – Include your full name, class, section, roll no., and residential address.
- Date – Mention the date in the top right-hand corner.
- Principal’s Details – Address the letter to your Principal with the school name. Use “Respected Sir/Madam”.
- Subject – State the purpose/reason of application in 1 line here.
- Content – Write the content in clear paragraphs with all key details.
- Salutation – Use “Yours faithfully” and provide your signature with your name and class below it.
Maintain Appropriate Tone
The tone and language used should be:
- Polite and Humble – Use respectful language and avoid a casual tone.
- Truthful – Provide genuine details and explain the situation honestly.
- Grateful – Thank the Principal for your consideration.
Highlight Relevant Details
- Clearly state your specific request or issue in the application.
- Provide essential dates, duration, or timeline related to your request.
- Explain the purpose and reason behind the application with relevant details.
- For medical leave – attach the doctor’s prescription/medical certificate .
Proofread Before Submitting
Before submission, ensure to:
- Correct any spelling or grammar errors.
- Verify that all provided details are accurate.
- Take a printout, sign it, and submit it to the Principal.
Application Format To Principal
The standard application format to the principal is:
Date: 07/02/2023 To The Principal Army Public School Subject: _ (State purpose in one line) Respected Sir/Madam, (Content in paragraphs…) Thank you. Yours faithfully, Your name Class ___ (Signature)
Leave Application To Principal
Some sample leave applications to principal:
Sick Leave Application
Date: 09/03/2023 To The Principal Sunrise Public School Delhi Subject: Application for leave due to illness Respected Sir/Madam, I, Simran , a student of Class VIII B , wish to apply for three days sick leave from 11 March 2023 to 13 March 2023 as I am down with viral fever since Monday. I visited Dr. Verma at City Hospital who has advised me complete bed rest for 3 days to recover properly. I have attached the medical certificate given to me by the doctor. I request you to kindly grant me leave for three days. I will resume attending school from Wednesday, 15 March 2023. Thank you. Yours faithfully, Simran Class VII B (Signature)
Casual Leave Application
Date: 05/05/2023 To The Principal Kendriya Vidyalaya No. 3 Jaipur Subject: Application for casual leave Respected Sir/Madam, I, Mohit Sharma , a student of Class X , wish to apply for two days casual leave on 09 May 2023 and 10 May 2023 . My grandmother has fractured her wrist after a fall at home. Being the only grandchild living in the same city, I need to be with her at the hospital and take care of medications and dressings of the fractured hand. Kindly grant me casual leave on the abovementioned dates so that I can support my family in this situation. I will catch up on any schoolwork missed during this time. Thank you for your consideration. Yours faithfully, Mohit Sharma Class X (Signature)
Application From Parents To Principal
Date: 16/02/2023 To The Principal Delhi Public School Delhi Subject: Request for fee concession Respected Sir/Madam, We are the parents of Namita Sharma studying in Class 7 C in this esteemed school. Due to financial problems, we sincerely request you to provide 50% fee concession for this academic year. Kindly consider this appeal sympathetically. Thank you. Yours faithfully, Ramesh Sharma & Seema Sharma
Leave Application By Teacher To Principal
Date: 18/01/2023 To The Principal Kendriya Vidyalaya No.2 Chandigarh Subject: Application for casual leave Respected Sir/Madam I wish to apply for casual leave on January 21, 2023 on account of my niece’s wedding. Kindly grant me leave for the day. I will compensate by working an extra day. Thank you. Yours faithfully, Rakhi Sharma PGT – Physics
Application To Principal For Sick Leave
Date: 04/06/2023 To The Principal Army Public School Cuttack Subject: Application for 5 days sick leave Respected Sir/Madam This is to inform you that I have been diagnosed with dengue on June 3, 2023. I have attached my medical reports for your reference. Due to high fever and weakness, I will require 5 days leave from June 5, 2023 to June 9, 2023 as advised medically. Kindly approve the same. Thank you. Yours faithfully, Neha Gupta Class XII – Science
Application For Fever To Principal
Date: 11/11/2022 To The Principal St. Mark’s School Agra Subject: Leave application due to fever Respected Madam, I, Sita Garg from Class 8th, have been suffering from high fever and bodyache since yesterday. Due to this, I will not be able to attend school for the next 3 days from 11 Nov 2022 to 13 Nov 2022. I request you to kindly grant me leave during this time. I will submit a medical certificate upon joining back. Yours faithfully, Sita Garg Class VIII
Half Day Leave Application To Principal
Date: 09/12/2022 To The Principal Sri Aurobindo International School Indore Subject: Half day leave request Respected Madam, I, Raj Malhotra from Class 10, request your permission to avail half day leave today on 09 Dec 2022 from 1 pm onwards. I have a dental appointment that cannot be rescheduled. Kindly allow me to leave early for the day. I will cover up the missed classes. Thank you. Yours faithfully, Raj Malhotra Class X
Leave Application For Exam By Teacher To Principal
Date: 15/03/2023 To The Principal Kendriya Vidyalaya No. 1 Gurugram Subject: Leave application for exam duty Respected Sir, I, Seema Roy (Maths Teacher ), have been assigned CBSE Board exam supervision duty from 16 March 2023 to 21 April 2023. Kindly grant me leave during this period as I will be occupied with the official exam duty. I will carry out lesson plan and class arrangements to minimize academic loss for my students. Thank you. Regards, Seema Roy PGT – Mathematics
Leave Application For Exam To Principal
Date: 18/02/2023 To The Principal Army School Jodhpur Subject: Leave for exams Respected Ma’am, I, Aditi Singh from Class 12 Commerce, request you to grant me leave from 20 Feb 2023 to 28 Feb 2023 for my board exam preparation and actual exams. The Physics board exam is on 21 Feb and Accountancy exam is on 27 Feb 2023. The extra days will allow me to fully concentrate on revision. Kindly approve this leave. Yours faithfully, Aditi Singh Class 12 Commerce
Application For Marriage Leave To School Principal
Date: 30/11/2022 To The Principal Kendriya Vidyalaya No. 2 Meerut Subject: Leave application for sister’s wedding Respected Sir, I, Sanjay Gupta from Class 9th standard, wish to apply for 7 days leave from 1 Dec 2022 to 7 Dec 2022. My elder sister’s wedding is scheduled during this period in our hometown Nainital. Kindly grant me leave so that I can attend the marriage preparations and ceremonies. I will cover up the academic syllabus upon returning back. Yours faithfully, Sanjay Gupta Class IX
Leave Application For Cousin Marriage To Principal
Date: 24/01/2023 To The Principal Holy Child Senior Secondary School Varanasi Subject: Leave request for cousin’s wedding Respected Ma’am, I, Naina Dewan from Class 11 Science, wish to apply for a 3 day leave from 27 Jan 2023 to 29 Jan 2023. My cousin brother’s wedding is scheduled on 28 Jan in Lucknow. Being a close-knit family, my presence is required for wedding functions. Kindly grant this leave, I assure to complete all missed academic work. Yours faithfully, Naina Dewan Class XI Science
Leave Application By Teacher To Principal For Urgent Work
Date: 02/09/2022 To The Principal Delhi Public School Mysore Subject: Leave application for urgent personal work Respected Sir, I, Suman Lata (English Faculty), request you to please approve my leave application for 5th and 6th September 2022. Due to some unavoidable urgent personal work, I need these 2 days off. I will compensacte the classes by working extra hours in the following weeks. Your kind consent is requested. Regards, Suman Lata PGT – English
Application To Your Principal For Two Days Leave
Date: 11/10/2022 To The Principal Army School Shillong Subject: Application for 2 days leave Respected Ma’am, I, Ramdas, a student of Class 8 A, wish to apply for leave on 13th and 14th October 2022 due to health reasons. Recently, I am suffering from frequent migraines that is severely affecting my class attendance and academic performance. The doctor has asked me to take full rest for 2 days. Kindly grant me leave for the same. I will catch up on missed studies once I rejoin school. Yours faithfully, Ramdas Class VIII A
Application To Principal For 5 Days Leave
Date: 07/07/2023 To The Principal Holy Hearts Senior Secondary School Kochi Subject: Seeking leave for 5 days Respected Sir/Madam, I, Nina Nair from Class 10, wish to apply for leave for 5 days from 10 July 2023 to 14 July 2023 due to health issues. Recently, I got diagnosed with typhoid fever for which I need to take proper rest as advised by the doctor. Kindly grant me leave so I can fully recover and continue focusing on my academics thereafter. Your approval of this sick leave application will be highly appreciated. Yours faithfully, Nina Nair Class X
Medical Leave Application To Principal
Date: 29/11/2022 To The Principal Kendriya Vidyalaya No. 1 Lucknow Subject: Application for medical leave Respected Ma’am, I, Srishti Gupta from Class 5 B, wish to apply for a 4 day medical leave from 30 Nov 2022 to 3 Dec 2022. Recently I have been detected with acute bronchitis leading to breathlessness and chest congestion. The doctor has recommended complete rest for recovery. Kindly allow me this sick leave so that I may focus on my health and return soon. Yours faithfully, Srishti Gupta Class V B
Leave Application For School Teacher To Principal
Date: 21/09/2022 To The Principal Holy Hearts High School Panjim Subject: Sick leave application Respected Sir, This is to inform you that I have been suffering from cellulitis in my foot from the last two days leading to swelling, pain and fever. My orthopedic specialist has advised me 10 days rest from 21/09/2022 for medical treatment and recovery. I request you to kindly approve 10 days sick leave as I require complete rest per medical recommendations. Regards, Arunima Deb Chemistry Faculty
Application To Principal For Fee Concession
Date: 26/08/2022 To The Principal Don Bosco Higher Secondary School Guwahati Subject: Request for full fee concession Respected Father, I, Reena Sarma from Class 6th, wish to apply for full concession of my school fees for this session due to financial problems faced by my family since my father lost his job 6 months back. My mother is unable to pay my fees along with other expenses. Kindly permit me the fee concession so that I can continue my studies properly. I have a consistent academic record. Your kind consideration will be appreciated. Yours faithfully, Reena Sarma Class VI
Application To Principal For Leave Of Absence
To The Principal Kendriya Vidyalaya No. 3 Ambala Cantt Subject: Leave of absence on 03/03/2023 Respected Sir, I, Arun Kumar from Class 9th, was absent from school yesterday i.e. on 03/03/2023 due to health issues. I had high fever and upset stomach since Wednesday night, hence could not attend school the next day. Hereby, sending my leave application for your kind perusal. Such absenteeism will not repeat in the future. Please pardon me as the leave was due to medical circumstances. Yours faithfully, Arun Kumar Class IX Roll No. 15
Application To The Principal For TC (Transfer Certificate)
Date: 15/03/2023 To The Principal St. Joseph’s Convent School Nashik Subject: Application for school leaving certificate Respected Sister, I have been a student of this school since Nursery. Due to my father’s job transfer, I am shifting to Pune by the end of this month. I am no longer able to continue my education here. Kindly issue me a Transfer Certificate against this application to enable my admission formalities in the new town. It has been a privilege being a student here. I wish all the very best to you and the school. Yours faithfully, Tania D’Souza Class X, Division B
Application To Principal For Bonafide Certificate
Date: 25/01/2023 To The Principal Saraswati Vidyalaya Allahabad Subject: Request for bonafide certificate Respected Madam, I, Shivam Gupta from Class 8 A, kindly request you to provide me with a bonafide certificate. I am representing our school cricket team at the district level tournament next month. The certificate confirming my name, class and school details are mandatory. Kindly arrange to issue the certificate against this application. Regards, Shivam Gupta Class VIII A, Roll no. 12
Application To Principal For Character Certificate
Date: 03/12/2022 To The Principal Holy Hearts High School Bhopal Subject: Application for character certificate Respected Father, I, Riya Thakur from Class 12 Commerce, require a character certificate duly signed by you as I am applying for admission to St. Xavier’s College , Mumbai for further education. Kindly arrange to provide the certificate confirming my character during my study tenure at Holy Hearts for submission. Your assistance is highly appreciated. Yours sincerely, Riya Thakur Class XII Commerce
Subject Change Application To Principal
Date: 15/07/2022 To The Principal Army Public School Bengaluru Subject: Request for subject change Respected Sir, I, Raunak Seth, studying in Class 11 (PCM) wish to change from Physics to Biology from the coming academic session. After career counselling, I realized Medicine is a more suitable choice for which Biology is required. Kindly permit me to change my subject as I had earlier opted PCM in a hurry. Please make the necessary amendments. Yours faithfully, Raunak Seth Class XI/PCM
School Leaving Application To Principal
Date: 10/11/2022 The Principal SRV Public School Kottayam Subject: Application for school leaving certificate Respected Ma’am, This is to inform you that due to father’s transferrable job, I am shifting my residence to the USA next month. Hence, I will no longer study at this school. Kindly issue me a School Leaving Certificate against this application indicating my duration at this institution. It will assist me in enrolling into a new school in the USA. Yours faithfully, Rhea Krishnan Class VI Section B
Application For Picnic To Principal
Date: 22/12/2022 To The Principal Army Public School Barrackpore Subject: Application for Annual Picnic Respected Sir, On behalf of the students of Class 6th, I wish to take your permission for our Annual Picnic to Eco Park on 30th December 2022. Around 35 students and 2 teachers wish to go by hired bus arranged by the Parent Teacher Association. We request you to kindly grant us permission for the same. Yours faithfully, Prachi N. Class Leader Class VI B
Request Application To Principal
Date: 26/09/2022 To The Principal St Xavier’s College Mumbai Subject: Request for duplicate library card Respected Father, I am Jenny from SYJC Commerce class. Due to an oversight, I seem to have misplaced my library card. As per the rules, I cannot issue any more books without a valid library card. I request you to kindly arrange for issuance of a duplicate library card so that I do not face any disruption in issuing course books and reference guides. Your assistance will be highly appreciated. Yours obediently, Jenny DSouza SYJC Commerce
Apologies Application To Principal
Date: 17/06/2023 To The Principal St Karen’s Secondary School Hyderabad Subject: Apology for misconduct Respected Sister, Through this letter, I sincerely apologize for arguing with my class teacher Ms. Seema yesterday. My rude behavior in class was totally unacceptable. I should have expressed my doubts in a polite way instead of countering her in front of the whole class leading to disruption. After self-introspection, I truly regret my insensitive conduct. Kindly pardon me for this incident and provide me a chance to improve. I promise such misconduct will never ever repeat if I am allowed to continue my studies here. I conveyed my apology to the teacher as well. Assuring you of excellent conduct henceforth. Yours obediently Tanya Chowdhury Class VIII A
An application to the principal acts as an official means for students to communicate their needs or issues. Following the standard professional format and using polite language is key. Students must explain the purpose clearly, highlight relevant dates and details, attach any mandatory supporting documents and proofread the application before submission.
Learning how to proficiently write applications to principal for leaves, concessions, certificates and other requirements is an essential skill for all students. It will assist them greatly in their academic life.
Shobhit is the founder of Ishiksha, content writer and educator who has been creating educational content since 2021. His writing covers topics like science, technology, and the humanities. When he isn't writing, Shobhit enjoys reading nonfiction, watching documentaries, and going on nature walks.
Save my name, email, and website in this browser for the next time I comment.
Type above and press Enter to search. Press Esc to cancel.
Application to Principal for Admission (with Samples & PDFs)
I have listed sample templates to help you craft an effective and professional application to principal for admission.
Also, I would like to point out that you can also download a PDF containing all the samples at the end of this post.
Application for Enrollment in Your Esteemed Institution
First, find the sample template for application to principal for admission below.
To, The Principal, [School Name], [School Address].
Subject: Application for Admission
Respected Principal,
I, [Your Name], kindly request admission to your esteemed school in [Grade Level]. I am eager to become a part of the wonderful learning environment at your school.
I have always dreamed of studying at [School Name] because of its excellent reputation for academics and extracurricular activities. I am confident that the dedicated teachers and supportive staff will help me achieve my goals and excel in my studies.
I promise to abide by all the rules and regulations of the school and to participate actively in all school activities. I am committed to working hard and making the most of the opportunities provided to me at [School Name].
I hope you will consider my application favorably and grant me admission to your prestigious school.
Thank you for your time and consideration.
Yours sincerely,
[Your Name] [Your Class]
Below I have listed 5 different sample applications for “application to principal for admission” that you will certainly find useful for specific scenarios:
Application for Admission to Join the School Football Team
To, The Coach, [School Name] Football Team,
Subject: Application for Admission to Join the School Football Team
Respected Coach,
I, [Your Name], a student of [Grade] at [School Name], am writing to express my keen interest in joining the school football team. I have always been passionate about playing football and I believe that being a part of the school team will help me improve my skills and contribute positively to the team’s success.
I have been playing football for [Number of Years] and have participated in various local tournaments, where I have learned the value of teamwork, discipline, and sportsmanship. I am dedicated to practicing regularly and giving my best on the field.
I am aware of the commitment required to be a part of the school team and I am willing to put in the effort to represent our school with pride. I am excited about the opportunity to learn from the coaches and my fellow teammates, and I am confident that I can make a positive contribution to the team.
I kindly request you to consider my application for admission to the school football team. I am looking forward to the chance to showcase my skills and be a part of the team.
Thank you for considering my application.
[Your Name] [Grade] [Contact Number]
Application for Admission to Participate in the Science Fair
To: The Science Fair Committee,
I am [Student’s Name], a [Grade Level] student at [School Name]. I am excited to apply for admission to participate in the upcoming Science Fair. I have a keen interest in science and love conducting experiments to learn new things.
I believe that participating in the Science Fair will help me explore my curiosity and creativity. I look forward to showcasing my project and sharing my findings with others. This opportunity will allow me to learn from fellow participants and expand my knowledge in the field of science.
I promise to work diligently on my project and adhere to all the rules and guidelines set by the Science Fair Committee. I am enthusiastic about the chance to present my project and contribute to the scientific community.
Thank you for considering my application. I am eager to be a part of this wonderful learning experience.
Sincerely, [Student’s Name]
Application for Admission to Start a Gardening Club
To, The Principal, [School Name], [School Address], [City, State, Pin Code]
Subject: Application for Admission to Start a Gardening Club
I am [Your Name], a student of [Your Class and Section] at [Your School Name]. I am writing this letter to request permission to start a Gardening Club in our school.
Gardening is a wonderful hobby that can teach us about nature, plants, and the environment. With a Gardening Club, we can learn how to grow plants, take care of them, and make our school surroundings more beautiful.
By starting a Gardening Club, we can have fun working together, learn new skills, and contribute positively to our school community. We can grow flowers, vegetables, and herbs that will not only make our school look more colorful but also help us understand the importance of nature conservation.
I believe that a Gardening Club will not only benefit us students but also enhance the beauty of our school campus. It will be a great opportunity for us to connect with nature and learn valuable lessons about responsibility and teamwork.
I kindly request your approval and support in starting the Gardening Club at our school. I am willing to take the lead and organize activities that will engage my fellow classmates in this initiative.
Thank you for considering my proposal. I look forward to your positive response.
[Your Name] [Class and Section] [Contact Number]
Application for Admission to Form a Book Club
To, The Principal, [School Name], [School Address]
Subject: Application for Admission to Form a Book Club
I am writing to request permission to start a Book Club at our school. I believe that reading books is not only fun but also helps us learn new things and improve our language skills. The Book Club will be a great opportunity for students like me to share our favorite stories, discuss interesting books, and have a good time together.
I have spoken to my classmates and friends, and many of them are excited about the idea of joining the Book Club. We plan to meet once a week during lunch break or after school to talk about the books we are reading and maybe even organize some fun activities related to them.
I promise that we will take good care of the books and always return them on time. We will also make sure to follow all the rules set by the school and behave responsibly during our Book Club meetings.
I hope you will consider my request and give us the opportunity to form a Book Club at our school. Thank you for your time and consideration.
[Your Name] [Class and Section] [Roll Number]
Application for Admission to Organize a Charity Fundraiser
To: The Principal, ABC School
Subject: Application for Admission to Organize a Charity Fundraiser
I am writing to seek permission to organize a charity fundraiser at our school to help children in need. The fundraiser aims to collect donations to provide food, clothing, and education to underprivileged children in our community.
The event will include fun activities like games, a bake sale, and a talent show. We believe that every child deserves a chance to have a better life, and this fundraiser will help us make a positive impact in their lives.
We assure you that the event will be well-organized, supervised by teachers, and adhere to all school guidelines. We seek your approval and support to make this event a success and bring smiles to the faces of those in need.
Thank you for considering our request.
Sincerely, [Your Name] [Class/Grade]
How to Write Application to Principal for Admission
Some writing tips to help you craft a better application:
- Address the principal politely.
- State your name, class, and previous school.
- Explain why you want to join this school.
- Mention any achievements or skills you have.
- Explain how you can contribute to the school.
- Request admission in the upcoming academic session.
- Thank the principal for considering your application.
- Include your contact information for further communication.
Related Topics:
- Application for Admission Request
- Application for Science Stream Admission
- Application for School Admission without TC
View all topics →
I am sure you will get some insights from here on how to write “application to principal for admission”. And to help further, you can also download all the above application samples as PDFs by clicking here .
And if you have any related queries, kindly feel free to let me know in the comments below.
Leave a Reply Cancel reply
Your email address will not be published. Required fields are marked *
Save my name, email, and website in this browser for the next time I comment.
- Kerala PSC Exams
- Kerala PSC Notification
- Kerala PSC Exam Calender
- Kerala PSC Previous Question papers
- KAS Previous Year Question papers
- Kerala PSC VEO Notification
- Kerala Police SI
- Kerala PSC LDC Notification
- Kerala PSC LP/UP Assistant
- Kerala PSC Village Field Assistant Notification
- Kerala PSC LD Typist Notification
- Kerala PSC Food Safety Officer
- Kerala PSC Excise Inspector Notification
- Kerala PSC BDO Notification
- Kerala PSC CPO Notification
- Kerala PSC LGS Notification
- Karnataka PSC
- IBPS PO Notification
- IBPS Clerk Notification
- SBI PO Notification
- SBI Clerk Notification
- SBI SO Notification
- SBI Apprentice Notification
- Canara Bank PO Notification
- Indian Bank PO Notification
- RBI Assistant Notification
- RBI Office Attendant Notification
- IBPS RRB Notification
- IBPS RRB Office Assistant Notification
- Spoken English
- Stock Market
- Digital Marketing
- Accounting Course
- Quantity Survey
- Oil and Gas
- Yoga Teaching
- Data Science Malayalam
- Data Science Training in Kochi
- Data Science Training in Trivandrum
- Data Science Course in Calicut
- Data Science Training in Thrissur
- Full Stack Development Malayalam
- Full Stack Development Hindi
- Full Stack Development Tamil
- Full Stack Development Telugu
- Full Stack Development Kannada
- Stock Market Course in Malayalam
- Stock Market Course in Tamil
- Stock Market Course in Kannada
- Options Trading Course
- Spoken English Course in Malayalam
- Spoken English Course in Hindi
- Spoken English Course in Telugu
- Spoken English Course in Tamil
- Spoken English Course in Kannada
- Python Programming Course
- Software Testing Course
- Quantity Surveyor Course in Tamil
- Performance Marketing Course
- Accounting Course in Malayalam
- Accounting Course in Tamil
- Tally Course
- Taxation Course
- UAE Accounting
- Full Stack Developer Course in Kochi
- Full Stack Developer Course in Trivandrum
- Full Stack Developer Course in Calicut
- Full Stack Developer Course in Pune
- Full Stack Developer Course in Bangalore
- Full Stack Developer Course in Hyderabad
- Full Stack Developer Course in Chennai
- Full Stack Developer Course in Indore
- Full Stack Developer Course in Jaipur
- Full Stack Developer Course in Coimbatore
- Digital Marketing Course in Kochi
- Digital Marketing Course in Trivandrum
- Digital Marketing Course in Calicut
- Digital Marketing Course in Kollam
- Digital Marketing Course in Thrissur
- Digital Marketing Course in Kottayam
- Digital Marketing Course in Kannur
- SAP FICO Course in Tamil
- SAP MM Course
- Montessori Teacher Training in Calicut
- Montessori Teacher Training in Kochi, Ernakulam
- Montessori Teacher Training in Trivandrum
- Montessori Teacher Training in Kollam
- Montessori Teacher Training in Malayalam
- Montessori Teacher Training in Kannada
- German Language Course
- OET Coaching
- Nurses Recruitment Abroad
- ChatGPT Course
- Forex Trading Course
- Yoga Teacher Training Course
- Oil and Gas Course
- Karnataka TET
- Aptitude Questions
- KPSC Degree Level Exam Preparation
- Kerala PSC 12th Level Exam Preparation
- Kerala PSC 10th Level Exam Preparation
- KAS Coaching
- Kerala PSC LDC Coaching
- Kerala PSC Fireman Coaching
- KSFE Assistant Exam Preparation
- Kerala PSC SI Exam Coaching
- Khadi Board LDC Exam Preparation
- University LGS Exam Preparation
- University Assistant Exam Coaching
- KPSC Scientific Officer Exam Coaching
- KPSC Probation Officer Grade II
- KPSC Food Safety Officer Coaching
- KWA Sanitary Chemist Coaching
- KPSC Diary Farm Instructor Exam Coaching
- Kerala PSC KWA Lab Assistant Exam Coaching
- KTET Coaching
- SET Coaching
- LP/UP Assistant Exam Coaching
- HSST Exam Preparation
- HSA Exam Preparation
- Kerala PSC Lecturer in Diet Coaching
- Kerala PSC Industries Extension Officer Coaching
- KPSC LSGD AE Exam Coaching
- KPSC Civil Engineering Exam Coaching
- KPSC Mechanical Engineering Exam Coaching
- KPSC Electrical Engineering Exam Coaching
- KPSC Electronics Engineering Exam Coaching
- IELTS Training Online
- IBPS SO Online Coaching
- IBPSC PO Online Coaching
- IBPSC Clerk Online Coaching
- SBI PO Coaching
- SBI Clerk Online Coaching
- RBI Grade B Coaching
- RBI Assistant Coaching
- CSEB Exam Coaching
- Kerala Bank Clerk Exam Coaching
- Kerala Bank Office Attendant Exam Coaching
- Kerala Bank Assistant Manager Exam Coaching
- JCI Exam Coaching
- UPSC Online Coaching
- SSC JE Online Coaching
- SSC CGL Coaching
- SSC CGL AAO Coaching
- SSC CGL CBI Inspector Coaching
- SSC CHSL Coaching
- SSC MTS Coaching
- RRB RPF Exam Coaching
- RRB NTPC Exam Coaching
- RRB JE Online Coaching
- RRB ALP Exam Coaching
- RRB Technician Exam Coaching
- CAT Online Coaching
- GATE Online Coaching
- EMRS Coaching
- CTET Exam Online Coaching
- AAI ATC Jr Executive Coaching
- HTML Tutorial
- DSA Tutorials
- HTML Tutorial for Beginners in Hindi
- Python Tutorial for Beginners in Hindi
- GIT and GITHUB Tutorial for Beginners in Hindi
- JavaScript Tutorial in Tamil
- HTML Tutorial For Beginners in Telugu
- CSS Tutorial for Beginners in Telugu
- Bootstrap Tutorial for Beginner in Telugu
- HTML Tutorial For Beginners in Kannada
Write a Letter to the Principal – Format and Sample Letters
Table of Contents
You would undoubtedly have been required to write a letter to the principal in numerous instances as a student. You would need to write a letter to the principal in order to use it for anything from vacation due to illness or travel to permission to participate in sports and competitions. The guidelines and examples for students’ Letters to Principals are discussed in this article. As a result, it makes writing a letter to the principal easier for you.
Join our Spoken English program today and communicate with ease!
Guidelines for Writing a Formal Letter to the Principal
- Because it is written for specific purposes, a Letter to the Principal must follow a formal format. You need to make it a point to provide all of the crucial statistics directly. This includes the recipient’s name, the date, the reason for their departure, a salutation, an explanation of the letter’s purpose in the body, and your signature.
- Your left margin needs to be in line with these parts.
- When you write the letter, specify the exact dates on which you will be absent from high school. This serves as a record for keeping track of attendance, managing leave, and other forms of documentation.
- Since this is a formal letter, nothing casual should be said.
- Make sure the Subject is particular.
- Check the letter for any grammatical or spelling errors before submitting it.
How to Write a Letter to the Principal?
The Principal,
(Name of the School/organization)
(Address of the School/organization)
Date and day:
Respected/Dear Sir/Ma’am,
Body of the letter(briefly explained with main reason)
Thanking You,
Yours Sincerely
(Name of the student)
(Class and section)
Master pronunciation and fluency with our Spoken English classes.
Examples of Letters to the Principal
Review the examples provided below for your reference and comprehension.
Request Letter to Principal for Three-Day On-Duty Application, Sample 1
St. Jude Public School,
Anna Nagar,
Jaipur – 302029.
10 January 2023
Subject: Request for leave for three days
Respected Sir,
I’m Aneesha Raj, a Class X “T” student. I have been chosen to compete in the national badminton tournament that will be held at the Sawai Man Singh Stadium in Jaipur on January 20, 21, and 22. Therefore, in order for me to participate in the competition and represent the school, I require an approved on-duty application. Therefore, in order to prevent me from losing my attendance, I ask that you kindly provide me with a legitimate certificate and an on-duty application.
Thanking you,
Yours sincerely,
Aneesha Raj
Class X ‘T’
Letter to Principal for Permission to Attend Cousin’s Wedding, Sample 2
Jaipur – 302027
28th September 2022
Subject: Seeking Permission to Attend a Cousin’s wedding.
Respected Ma’am,
I, Nithina, a student in Class 9 “E,” am submitting this application to inform you that I am required to attend my cousin’s wedding in Kerala on October 30. I would therefore require three days off (from October 30 to November 1, 2022). I will ensure that I have completed all of the daily lessons when I return and obtained permission from my class teacher. I would greatly appreciate it if you granted me leave.
Roll No. 36
Start speaking English like a native with our comprehensive course.
FAQs on Letter Writing
- How do I begin a letter to the principal of the school?
Your letter should begin with your address and the date, then move on to the subject, salutation, and body, where you explain why you are writing it.
- How do I write a letter to the principal?
When it comes to matters of personal and professional significance, a letter to the school principal or any other higher authority should always be written in a formal manner. Formal language should also be used.
- Is it necessary to inform you of my upcoming leave dates?
Because it is used for attendance management and documentation, it is essential to clearly indicate the date on which you will be absent from school.
Aiswarya Sankar
I am a passionate Blog writer and a graduate in Civil Engineering, who provides aspirants with sufficient Government exam tips and the required information.
Related Posts
Top Companies Hiring SAP MM Consultants in India
How to Start Digital Marketing from Home (Experts Guide)
Top German B1 Speaking Topics ( Updated 2024 )
Advantages of Practising Mock Test Online for Government Exams 2023
More to Explore
- Basic Grammar Topics for Spoken English
- Basic English Grammar Rules of Preposition
- What are Determiners in English Grammar?
- What is a Verb? Types of Verbs
- Common Errors in English with Explanation
- Figures of Speech in English
- Tenses in English with Examples
- Direct and Indirect Speech in English
- Spoken English tricks for Fluency in Speech
Spoken English Training In Different Cities
- Spoken English Classes in Kochi
- Spoken English Classes in Trivandrum
- Spoken English Classes in Thrissur
- Spoken English Classes in Kottayam
- Spoken English Classes in Kollam
- Spoken English Classes Trichy
- Spoken English Classes in Jaipur
- Spoken English Classes in Madurai
- Spoken English Classes in Vijayawada
- Spoken English Classes in Bhopal
- Spoken English Classes in Pune
- Spoken English Classes in Bangalore
- Spoken English Classes in Ahmedabad
- Spoken English Classes in Hyderabad
- Spoken English Classes in Chennai
- Spoken English Classes in Delhi
- Spoken English Classes in Indore
Select your Spoken English Course
- Entri Eva AI Powered Spoken English Course
- Spoken English Course for School Going Students
- Spoken English Course for Job Seekers
- Spoken English Course for College Going Students
- Spoken English Course for Working Professionals
- Spoken English Course for Housewives
- OET Training Classes
- Professional English Course in Hindi
- Data Science Course
- Full Stack Developer Course
- Data Science Course in Malayalam
- Full Stack Developer Course in Malayalam
- Full Stack Developer Course in Hindi
- Full Stack Developer Course in Tamil
- Full Stack Developer Course in Telugu
- Full Stack Developer Course in Kannada
- Practical Accounting Course
- Quantity Surveying Course
- Stock Market Course
- Become a teacher
- Login to Entri Web
Spoken English Courses
- Spoken English Course
- Spoken English Course for School Students
- Spoken English Course for College Students
- AI Powered Spoken English Course
Quick Links
- Entri Daily Quiz Practice
- Current Affairs & GK
- News Capsule – eBook
- Preparation Tips
- Kerala PSC Gold
- Entri Skilling
Other Courses
- OET Coaching Classes
- Nurse Recruitment Abroad
- Montessori Teachers Training
- Oil and Gas Course Online
- Digital Marketing Course
- German Language A1 Course
- German Language A2 Course
- German Language B1 Course
- German Language B2 Course
Popular Exam
- Railway RRB Exam
- Tamil Nadu PSC
- Telangana PSC
- Andhra Pradesh PSC
- Staff Selection Commission Exam
© 2023 Entri.app - Privacy Policy | Terms of Service
- SAP FICO Course
- Kerala Bank Exam Coaching
- Learn English
- Universities
- Practice Tests
- Study Abroad
- Knowledge Centre
- Ask Experts
- Study Abroad Consultants
- Post Content
- General Topics
- Articles/Knowledge Sharing
- Sample Letters and Letter Formats
Sample letter format to the Principal to provide the marksheet to the Guardian
Are you looking for advice on how to write an application to the school or college principal to authorize your Guardian to collect a marksheet on your behalf? This article provides a formal request letter format that will help your Guardian to collect the marksheet of an exam from the school or college. Some useful tips are also provided.
Sample format of an authorization letter to collect a marksheet
When the guardian is collecting the college mark sheet, concluding tips.
- Do not include your name, "with regards" etc in the comment. Write detailed comment, relevant to the topic.
- No HTML formatting and links to other web sites are allowed.
- This is a strictly moderated site. Absolutely no spam allowed.
Top Contributors
- DR.N.V. Sriniva... (30)
- Neeru Bhatt (9)
- Umesh (183)
- DR.N.V. Sriniva... (179)
- Neeru Bhatt (132)
About IndiaStudyChannel.com
Being the most popular educational website in India, we believe in providing quality content to our readers. If you have any questions or concerns regarding any content published here, feel free to contact us using the Contact link below.
- Admissions Consulting
- Adsense Revenue
- Become an Editor
- Membership Levels
- Winners & Awards
- Guest Posting
- Help Topics
STUDY ABROAD
- Study in Foreign Universities
- Study in Germany
- Study in Italy
- Study in Ireland
- Study in France
- Study in Australia
- Study in New Zealand
- Indian Universities
- Nursing in Mangalapuram
- BDS in Mangalore
- MBA in Bangalore
- Nursing admissions in Mangalore
- Distance MBA
- B Pharm in Mangalore
- MBBS in Mangalore
- BBA in Mangalore
- MBA Digital Marketing
- Privacy Policy
- Terms of Use
Promoted by: SpiderWorks Technologies, Kochi - India. ©
- Job Application Letter For Principal
Crafting a compelling job application letter is essential when applying for the position of Principal. This leadership role requires a strong combination of experience, qualifications, and a passion for education. We have prepared four templates to assist you in creating impactful job application letters for the position of Principal. These templates cater to various scenarios, including applications from experienced candidates, entry-level candidates, those with a focus on leadership and vision, and those with a student-centered approach. Each template showcases the applicant's qualifications, experience, and dedication to fostering a positive educational environment. It is crucial to personalize these templates by incorporating specific details about the school, your relevant experiences, and your vision for the role. By utilizing these templates as a starting point, you can effectively convey your suitability for the position of Principal and demonstrate your commitment to academic excellence and student success. Remember to review and tailor each template to reflect your unique skills and experiences, ensuring that your application stands out to the hiring committee.
Template Application for Principal Position at ABC School
To, The Principal ABC School Lahore
Date: 27 June 2023
Subject: Application for Principal Position
Respected Sir/Madam,
I am writing to express my interest in the principal position at ABC School. I have over 10 years of experience in the education sector, including 5 years as a vice principal at XYZ School. I have a Master's degree in Educational Administration and a Bachelor's degree in English Literature.
I believe that I have the skills and qualifications to lead ABC School to academic excellence and holistic development. As a vice principal, I have successfully implemented various initiatives to improve the quality of education, such as introducing new teaching methods, conducting regular assessments, organizing workshops and seminars, and providing feedback and guidance to teachers. I have also fostered a positive and collaborative school culture by promoting values of respect, integrity, and diversity. I have maintained effective communication with students, parents, staff, and stakeholders, and resolved any issues or conflicts that arose.
I am passionate about providing a safe, supportive, and stimulating learning environment for all students. I am confident that I can handle the challenges and responsibilities of being a principal at ABC School. I would love to meet you in person to discuss my suitability for this position in more detail.
Thank you for your consideration.
Your Name Your Contact Details
Template Application for Principal Job at DEF School
To, The Principal DEF School Islamabad
Subject: Application for Principal Job
I am writing to apply for the principal job at DEF School. I have been working as a principal at GHI School for the past 3 years, where I have led the school to achieve outstanding results in academics, sports, and co-curricular activities. I have a Doctorate degree in Educational Leadership and a Master's degree in Curriculum Development.
I have a proven track record of enhancing the performance and reputation of the school by implementing innovative and effective strategies. Some of my achievements include:
- Increasing the pass percentage of students from 80% to 95% in board exams
- Securing the first position in the inter-school quiz competition
- Launching a digital learning platform to facilitate online education
- Establishing partnerships with local and international organizations to provide scholarships and exchange programs for students
- Developing and executing a comprehensive school improvement plan to address the areas of improvement identified by the accreditation team
I have also demonstrated strong leadership and management skills by leading a team of over 100 teachers and staff members. I have motivated them to work towards a common vision and mission, provided them with regular training and mentoring, and evaluated their performance and feedback. I have also ensured that the school complies with all the rules and regulations of the education department and maintains high standards of safety and discipline.
I am eager to join DEF School as I admire its vision of providing quality education to all students regardless of their background or ability. I believe that I can contribute to its growth and success by bringing my experience and expertise. I look forward to hearing from you soon.
Thank you for your attention.
Template Application for Principal Vacancy at JKL School
To, The Principal JKL School Karachi
Subject: Application for Principal Vacancy
I am writing to apply for the principal vacancy at JKL School. I have been working as an assistant principal at MNO School for the past 4 years, where I have assisted the principal in managing all aspects of the school operations. I have a Master's degree in Educational Psychology and a Bachelor's degree in Mathematics.
I have gained valuable experience and skills in planning, organizing, supervising, and evaluating various educational programs and activities. Some of my responsibilities include:
- Coordinating curriculum development and implementation across all grades and subjects
- Supervising student admission, attendance, discipline, and welfare
- Organizing staff recruitment, induction, appraisal, and development
- Liaising with parents, community members, and external agencies to build positive relationships and support student learning
- Preparing reports, budgets, proposals, and policies for the school administration
I have also shown initiative and creativity in initiating and leading several projects to enhance the school environment and culture. Some of these include:
- Creating a student council to involve students in decision making and leadership roles
- Introducing a peer tutoring program to help students with academic difficulties
- Organizing a cultural festival to celebrate the diversity and unity of the school
- Implementing a green campaign to raise awareness and action on environmental issues
I am passionate about education and committed to the vision and mission of JKL School. I have the ability and enthusiasm to lead the school to achieve its goals and objectives. I would appreciate the opportunity to meet you and discuss my application further.
Thank you for your time and consideration.
Template Application for Principal Role at PQR School
To, The Principal PQR School Rawalpindi
Subject: Application for Principal Role
I am writing to express my interest in the principal role at PQR School. I have over 15 years of experience in the education field, including 6 years as a principal at STU School. I have a Master's degree in Educational Management and a Bachelor's degree in History.
I have a strong vision and mission for education that aligns with the philosophy and values of PQR School. I believe that every student deserves a quality education that prepares them for life and career. As a principal, I have strived to create a culture of excellence, innovation, and collaboration in the school. Some of my accomplishments include:
- Improving the academic performance of students by 20% through data-driven instruction and assessment
- Introducing new programs and courses to cater to the diverse needs and interests of students, such as STEM, arts, languages, and vocational education
- Expanding the professional development opportunities for teachers and staff by providing coaching, mentoring, feedback, and recognition
- Enhancing the school facilities and infrastructure by securing funds and grants from various sources
- Increasing the parent and community involvement in the school by organizing events, meetings, newsletters, and surveys
I have also developed excellent communication, interpersonal, and problem-solving skills by working with various stakeholders, such as students, teachers, staff, parents, board members, government officials, and media. I have handled various challenges and issues with tact and diplomacy, such as staff turnover, student behavior, budget cuts, and public relations.
I am excited to join PQR School as I believe that it is one of the best schools in the region. I am confident that I can add value to its reputation and performance by applying my skills and experience. I would love to hear from you soon.
We are delighted to extend our professional proofreading and writing services to cater to all your business and professional requirements, absolutely free of charge at Englishtemplates.com . Should you need any email, letter, or application templates, please do not hesitate to reach out to us at englishtemplates.com. Kindly leave a comment stating your request, and we will ensure to provide the necessary template at the earliest.
Posts in this Series
- Essential Tips for Writing An Effective Cover Letter
- How to Email CV for Job
- Job Application for Fuel Attendant without Prior Experience
- Application For Babysitter Template
- Application For Bank Job Like A Assistant Manager
- Accountant Letter Confirming Proof Of Self Employment
- Cover Letter Templates for Jobs Reffered by a Friend
- Cover Letters for Sales Jobs
- Job Application For Computer Operator Post
- Job Application For Computer Teacher In School, College, Etc
- Job Application For Librarian Free Samples
- Job Application For Primary School Teacher
- Job Application For School Teacher In English
- Job Application For The Post Of Marketing Officer
- Job Application Letter For Female Secretary
- Cover Letter To Join A Club
- Application For The Post Of A Science Teacher
- Application Letter For Call Centre Agent Position
- Application Letter for Employment in Police Service
- Application Letter For Receptionist Position
- Application For A Job In A Supermarket
- CBSE Class 10th
- CBSE Class 12th
- UP Board 10th
- UP Board 12th
- Bihar Board 10th
- Bihar Board 12th
- Top Schools in India
- Top Schools in Delhi
- Top Schools in Mumbai
- Top Schools in Chennai
- Top Schools in Hyderabad
- Top Schools in Kolkata
- Top Schools in Pune
- Top Schools in Bangalore
Products & Resources
- JEE Main Knockout April
- Free Sample Papers
- Free Ebooks
- NCERT Notes
- NCERT Syllabus
- NCERT Books
- RD Sharma Solutions
- Navodaya Vidyalaya Admission 2024-25
- NCERT Solutions
- NCERT Solutions for Class 12
- NCERT Solutions for Class 11
- NCERT solutions for Class 10
- NCERT solutions for Class 9
- NCERT solutions for Class 8
- NCERT Solutions for Class 7
- JEE Main 2024
- MHT CET 2024
- JEE Advanced 2024
- BITSAT 2024
- View All Engineering Exams
- Colleges Accepting B.Tech Applications
- Top Engineering Colleges in India
- Engineering Colleges in India
- Engineering Colleges in Tamil Nadu
- Engineering Colleges Accepting JEE Main
- Top IITs in India
- Top NITs in India
- Top IIITs in India
- JEE Main College Predictor
- JEE Main Rank Predictor
- MHT CET College Predictor
- AP EAMCET College Predictor
- GATE College Predictor
- KCET College Predictor
- JEE Advanced College Predictor
- View All College Predictors
- JEE Main Question Paper
- JEE Main Cutoff
- JEE Main Advanced Admit Card
- JEE Advanced Admit Card 2024
- Download E-Books and Sample Papers
- Compare Colleges
- B.Tech College Applications
- KCET Result
- MAH MBA CET Exam
- View All Management Exams
Colleges & Courses
- MBA College Admissions
- MBA Colleges in India
- Top IIMs Colleges in India
- Top Online MBA Colleges in India
- MBA Colleges Accepting XAT Score
- BBA Colleges in India
- XAT College Predictor 2024
- SNAP College Predictor
- NMAT College Predictor
- MAT College Predictor 2024
- CMAT College Predictor 2024
- CAT Percentile Predictor 2023
- CAT 2023 College Predictor
- CMAT 2024 Admit Card
- TS ICET 2024 Hall Ticket
- CMAT Result 2024
- MAH MBA CET Cutoff 2024
- Download Helpful Ebooks
- List of Popular Branches
- QnA - Get answers to your doubts
- IIM Fees Structure
- AIIMS Nursing
- Top Medical Colleges in India
- Top Medical Colleges in India accepting NEET Score
- Medical Colleges accepting NEET
- List of Medical Colleges in India
- List of AIIMS Colleges In India
- Medical Colleges in Maharashtra
- Medical Colleges in India Accepting NEET PG
- NEET College Predictor
- NEET PG College Predictor
- NEET MDS College Predictor
- NEET Rank Predictor
- DNB PDCET College Predictor
- NEET Admit Card 2024
- NEET PG Application Form 2024
- NEET Cut off
- NEET Online Preparation
- Download Helpful E-books
- Colleges Accepting Admissions
- Top Law Colleges in India
- Law College Accepting CLAT Score
- List of Law Colleges in India
- Top Law Colleges in Delhi
- Top NLUs Colleges in India
- Top Law Colleges in Chandigarh
- Top Law Collages in Lucknow
Predictors & E-Books
- CLAT College Predictor
- MHCET Law ( 5 Year L.L.B) College Predictor
- AILET College Predictor
- Sample Papers
- Compare Law Collages
- Careers360 Youtube Channel
- CLAT Syllabus 2025
- CLAT Previous Year Question Paper
- NID DAT Exam
- Pearl Academy Exam
Predictors & Articles
- NIFT College Predictor
- UCEED College Predictor
- NID DAT College Predictor
- NID DAT Syllabus 2025
- NID DAT 2025
- Design Colleges in India
- Top NIFT Colleges in India
- Fashion Design Colleges in India
- Top Interior Design Colleges in India
- Top Graphic Designing Colleges in India
- Fashion Design Colleges in Delhi
- Fashion Design Colleges in Mumbai
- Top Interior Design Colleges in Bangalore
- NIFT Result 2024
- NIFT Fees Structure
- NIFT Syllabus 2025
- Free Design E-books
- List of Branches
- Careers360 Youtube channel
- IPU CET BJMC
- JMI Mass Communication Entrance Exam
- IIMC Entrance Exam
- Media & Journalism colleges in Delhi
- Media & Journalism colleges in Bangalore
- Media & Journalism colleges in Mumbai
- List of Media & Journalism Colleges in India
- CA Intermediate
- CA Foundation
- CS Executive
- CS Professional
- Difference between CA and CS
- Difference between CA and CMA
- CA Full form
- CMA Full form
- CS Full form
- CA Salary In India
Top Courses & Careers
- Bachelor of Commerce (B.Com)
- Master of Commerce (M.Com)
- Company Secretary
- Cost Accountant
- Charted Accountant
- Credit Manager
- Financial Advisor
- Top Commerce Colleges in India
- Top Government Commerce Colleges in India
- Top Private Commerce Colleges in India
- Top M.Com Colleges in Mumbai
- Top B.Com Colleges in India
- IT Colleges in Tamil Nadu
- IT Colleges in Uttar Pradesh
- MCA Colleges in India
- BCA Colleges in India
Quick Links
- Information Technology Courses
- Programming Courses
- Web Development Courses
- Data Analytics Courses
- Big Data Analytics Courses
- RUHS Pharmacy Admission Test
- Top Pharmacy Colleges in India
- Pharmacy Colleges in Pune
- Pharmacy Colleges in Mumbai
- Colleges Accepting GPAT Score
- Pharmacy Colleges in Lucknow
- List of Pharmacy Colleges in Nagpur
- GPAT Result
- GPAT 2024 Admit Card
- GPAT Question Papers
- NCHMCT JEE 2024
- Mah BHMCT CET
- Top Hotel Management Colleges in Delhi
- Top Hotel Management Colleges in Hyderabad
- Top Hotel Management Colleges in Mumbai
- Top Hotel Management Colleges in Tamil Nadu
- Top Hotel Management Colleges in Maharashtra
- B.Sc Hotel Management
- Hotel Management
- Diploma in Hotel Management and Catering Technology
Diploma Colleges
- Top Diploma Colleges in Maharashtra
- UPSC IAS 2024
- SSC CGL 2024
- IBPS RRB 2024
- Previous Year Sample Papers
- Free Competition E-books
- Sarkari Result
- QnA- Get your doubts answered
- UPSC Previous Year Sample Papers
- CTET Previous Year Sample Papers
- SBI Clerk Previous Year Sample Papers
- NDA Previous Year Sample Papers
Upcoming Events
- NDA Application Form 2024
- UPSC IAS Application Form 2024
- CDS Application Form 2024
- CTET Admit card 2024
- HP TET Result 2023
- SSC GD Constable Admit Card 2024
- UPTET Notification 2024
- SBI Clerk Result 2024
Other Exams
- SSC CHSL 2024
- UP PCS 2024
- UGC NET 2024
- RRB NTPC 2024
- IBPS PO 2024
- IBPS Clerk 2024
- IBPS SO 2024
- Top University in USA
- Top University in Canada
- Top University in Ireland
- Top Universities in UK
- Top Universities in Australia
- Best MBA Colleges in Abroad
- Business Management Studies Colleges
Top Countries
- Study in USA
- Study in UK
- Study in Canada
- Study in Australia
- Study in Ireland
- Study in Germany
- Study in China
- Study in Europe
Student Visas
- Student Visa Canada
- Student Visa UK
- Student Visa USA
- Student Visa Australia
- Student Visa Germany
- Student Visa New Zealand
- Student Visa Ireland
- CUET PG 2024
- IGNOU B.Ed Admission 2024
- DU Admission 2024
- UP B.Ed JEE 2024
- LPU NEST 2024
- IIT JAM 2024
- IGNOU Online Admission 2024
- Universities in India
- Top Universities in India 2024
- Top Colleges in India
- Top Universities in Uttar Pradesh 2024
- Top Universities in Bihar
- Top Universities in Madhya Pradesh 2024
- Top Universities in Tamil Nadu 2024
- Central Universities in India
- CUET Exam City Intimation Slip 2024
- IGNOU Date Sheet
- CUET Mock Test 2024
- CUET Admit card 2024
- CUET PG Syllabus 2024
- CUET Participating Universities 2024
- CUET Previous Year Question Paper
- CUET Syllabus 2024 for Science Students
- E-Books and Sample Papers
- CUET Exam Pattern 2024
- CUET Exam Date 2024
- CUET Cut Off 2024
- CUET Exam Analysis 2024
- IGNOU Exam Form 2024
- CUET 2024 Exam Live
- CUET Answer Key 2024
Engineering Preparation
- Knockout JEE Main 2024
- Test Series JEE Main 2024
- JEE Main 2024 Rank Booster
Medical Preparation
- Knockout NEET 2024
- Test Series NEET 2024
- Rank Booster NEET 2024
Online Courses
- JEE Main One Month Course
- NEET One Month Course
- IBSAT Free Mock Tests
- IIT JEE Foundation Course
- Knockout BITSAT 2024
- Career Guidance Tool
Top Streams
- IT & Software Certification Courses
- Engineering and Architecture Certification Courses
- Programming And Development Certification Courses
- Business and Management Certification Courses
- Marketing Certification Courses
- Health and Fitness Certification Courses
- Design Certification Courses
Specializations
- Digital Marketing Certification Courses
- Cyber Security Certification Courses
- Artificial Intelligence Certification Courses
- Business Analytics Certification Courses
- Data Science Certification Courses
- Cloud Computing Certification Courses
- Machine Learning Certification Courses
- View All Certification Courses
- UG Degree Courses
- PG Degree Courses
- Short Term Courses
- Free Courses
- Online Degrees and Diplomas
- Compare Courses
Top Providers
- Coursera Courses
- Udemy Courses
- Edx Courses
- Swayam Courses
- upGrad Courses
- Simplilearn Courses
- Great Learning Courses
How To Write A Letter To Principal
Writing a letter to a principal can be a great way to communicate important information, raise concerns or make requests. If you have concerns about something happening at the school or want to make suggestions, writing a letter to the principal can be an effective way to bring attention to the issue.
Format Letter Writing Format
Here are some of the main components of a formal letter that must be included while addressing a letter to the principal.
At the top of the letter, write ‘The Principal’ and the school's address followed by the date and subject of the letter. The subject line should not be more than 10-12 words and should convey the essence of the letter. Begin your letter with a salutation by addressing the principal respectfully using ‘Dear Mr./Mrs./Ms. Last Name’ or ‘Dear Ma’am/Sir’. The first paragraph should include your introduction and purpose of your letter.
In the following paragraphs, provide more details and explanations to support your request, concern, or information. Be specific and provide all the information.
In the final paragraph, thank the principal for their time and consideration. End with a closing such as "Sincerely," "Respectfully," or "Best regards," followed by your name.
Before sending the letter, proofread it for spelling and grammar errors. Make sure the tone of your letter is polite and respectful.
Sample Letters
Here are some sample letters that students can use for their reference.
Also Read | Letter to Principal for Leave
Letter To Principal Against Bullying
The Principal
Kendriya Vidyalaya School
Mahavir Marg
18 February 2023
Subject: Requesting awareness initiatives against bullying
I, Shourya Jain, studying in class 10, would like to bring to your attention a problem that I have noticed at school: bullying. I know that our school and teachers work hard to create a safe and inclusive learning environment, but I am concerned that some students are not following those guidelines.
Over the past few weeks, I have noticed that some students have been picking on others in the hallways, during lunchtime, and even in the classroom. This behaviour has created an uncomfortable and stressful environment for some of us, making it difficult to focus on our studies.
I am reaching out to you because I believe that everyone has the right to feel safe and comfortable while they are at school. It is important that we take action against bullying and make sure that all students know that it is not acceptable.
I would like to suggest that the school take some proactive measures, such as increasing the number of anti-bullying posters around the school, or implementing a peer mentoring program to help younger students feel more comfortable and supported. Additionally, I think that it would be beneficial to have a counsellor specifically designated as a point of contact for students to report any incidents of bullying.
I hope that you will take my concerns seriously and consider implementing some of these measures to address the issue. Thank you for your time and attention.
Shourya Jain
Also Read | How To Write A Permission Letter From Parents To School
Letter Requesting Principal For Re-Exam
Fairfields School
Subject: Seeking Permission for a Re-Examination
Dear Ma’am,
I, Pariddhi Kalra, studying in class 9, am writing to request permission to take a re-examination for the political science mid-term exam that I recently missed. I understand that the school's policy allows for students to request a re-examination under certain circumstances, and I believe that my situation meets these criteria.
I was unable to appear during the examination due to poor health, I was suffering from seasonal flu and did not feel well enough to take the exam. This has significantly impacted my final grade. I have since taken the time to recover and have studied the course material, and I am confident that I can perform well if given the opportunity to take a re-examination.
I understand that the school has certain policies and procedures in place for re-examinations, and I am willing to comply with any requirements that may be necessary to take the re-examination. I have also attached my medical certificate from the doctor for your reference.
I would appreciate the opportunity to retake the examination, as it would allow me to improve my academic performance.Thank you for your time and consideration of this request.
Pariddhi Kalra
Also Read | How To Write An Apology Letter To A Teacher
Applications for Admissions are open.
Aakash iACST Scholarship Test 2024
Get up to 90% scholarship on NEET, JEE & Foundation courses
ALLEN Digital Scholarship Admission Test (ADSAT)
Register FREE for ALLEN Digital Scholarship Admission Test (ADSAT)
JEE Main Important Physics formulas
As per latest 2024 syllabus. Physics formulas, equations, & laws of class 11 & 12th chapters
PW JEE Coaching
Enrol in PW Vidyapeeth center for JEE coaching
PW NEET Coaching
Enrol in PW Vidyapeeth center for NEET coaching
JEE Main Important Chemistry formulas
As per latest 2024 syllabus. Chemistry formulas, equations, & laws of class 11 & 12th chapters
Download Careers360 App's
Regular exam updates, QnA, Predictors, College Applications & E-books now on your Mobile
Certifications
We Appeared in
- Letter Writing
- Formal Letter Writing In English
- Application For Marksheet Correction
Application for Marksheet Correction | Format and Sample Letters
There might be various instances where you had to write letters to your class teacher or the principal for multiple reasons. One among them would have been applications for marksheet correction. At times, it so happens that the marks you have received in the exam and the marks printed on your marksheet do not match. In such scenarios, all you would be asked to do is to write a letter to the class teacher, the principal or the head of the department requesting for a marksheet correction. Read through the article to learn how to write a letter to get your marksheet corrected.
Table of Contents
How to write an application for marksheet correction, application for correction of marksheet in university, application for marksheet correction, frequently asked questions on application for marksheet correction.
If you find any information mentioned incorrectly in your mark sheet, you can write a letter to the head of your institution/university informing about the same and request them to make the necessary changes. The same can be followed even if your name is spelt incorrectly or your admission/roll number is incorrect.
You would have come across other letters like apology letter , permission letter , consent letter , order letter and so on. All these letters are various types of formal letters. Similarly, the application should also be written just like you write a formal letter . It has to include the details of the sender, the date, the receiver and the body of the letter including the information that has to be correct. Make sure you do not forget to mention the correct spelling/admission number/roll number/marks.
Sample Applications for Marksheet Correction
To help you understand the format easily, here are a few sample letters. Read through the samples before you write an application to update the incorrect information with the correct ones.
329, Saheed Nagar
Bhubaneswar
1st March, 2022
The Examination Department
Utkal University
Bhubaneswar – 751007
Sub: Request to update the incorrect marks in the final semester marksheet
Respected Sir,
I, Anisha Anindita, would like to bring to your kind notice that I have received the final semester marksheet but the marks mentioned for my 2nd semester Honors paper is incorrect. I was awarded 83 marks, but it is mentioned 63 in the marksheet. It seems to be a typographical error.
I am attaching a copy of my answer sheets along with this letter for your reference. I request you to kindly update the mark sheet at the earliest so that I can go ahead with my admission procedure. I shall be highly obliged to you for the same.
Yours sincerely,
(Signature)
ANISHA ANINDITA
BA English (2019-2022)
Reg. No. 0123
Attachments:
- Copy of answer sheets with the correct marks
- Final degree marksheet
448 Saheed Nagar
The Principal
BJEM School
Kalpana Square
Bhubaneswar – 751002
Sub: Request to rectify the spelling of my name in the marksheet
I would like to bring to your kind notice that my name is incorrectly spelt in the Class 10 mark sheet. My registration number is 33008 and my roll number is 10. I have mentioned the incorrect and correct spellings below for your reference.
Incorrect name – Srinivasan Ravindra
Correct name – Srinivaasan Ravindra
I have also attached a copy of my Aadhaar card along with the letter for verification. I request you to kindly change the spelling as mentioned above and issue the mark sheet so that it would not be a problem in the future.
SRINIVAASAN RAVINDRA
- Aadhaar Card
- Class 10 mark sheet
How to write an application for marksheet correction?
In order to request your university or college/school to rectify the data which is incorrectly mentioned in your marksheet, you will have to write an application to the head of the institution or the concerned authority informing them about it. You can write the application in a professional language, following the formal letter format.
If I want to change my name in my Class 10 marksheet, what are the documents needed?
If you have changed your name and you want the same to be reflected in your Class 10 marksheet, then you can provide the affidavit/legal document to your institution or the board to make the necessary changes.
Leave a Comment Cancel reply
Your Mobile number and Email id will not be published. Required fields are marked *
Request OTP on Voice Call
Post My Comment
- Share Share
Register with BYJU'S & Download Free PDFs
Register with byju's & watch live videos.
Training.gov.au is the national register of vocational education and training (VET)
Training.gov.au is changing .
The Department of Employment and Workplace Relations (DEWR) will soon be rolling out changes to enhance Training.gov.au (TGA). The new TGA is more intuitive and accessible, and will deliver:
- improved usability,
- a streamlined interface,
- more robust search features, and
- enhanced reporting functions.
The department has been engaging with the sector to help stakeholders prepare for the update and make the most of the enhanced TGA. The update is planned for a late 2024 release.
More information about the changes can be found here .
What is training.gov.au?
Training.gov.au is the national register of VET, as required by s 216 of the National Vocational Education and Training Regulator Act 2011 . Information held on the national register includes:
- Nationally recognised training (NRT) : training packages, qualifications, units of competency, skill sets and accredited courses.
- Registered training organisations (RTOs) that are approved to deliver nationally recognised training.
The national register is intended for VET sector professionals, including: RTOs, trainers and assessors, regulators, training package developers, researchers, and policy makers.
Looking for something else?
I am looking to choose a vet course and training provider., i want to be or hire an apprentice. , i want to explore career ideas and occupations., latest news, australian apprenticeship support services rft outcomes announced.
The Department of Employment and Workplace Relations has released outcomes from its Request for Tend...
Early changes to Standards for Registered Training Organisations (RTOs)
Early changes to the Standards for RTOs are now in effect. These changes are designed to alleviate p...
Consultation on the VET Workforce Blueprint
The Australian Government, in collaboration with states and territories, is developing a VET Workfor...
- Accredited course Reports
- Classification reports
- Qualification reports
- RTO reports
- Taxonomy reports
- Training package reports
- Australian Government Bodies
- Training Package Developers
- Regulatory Authorities
- State and Territory Government Training Departments
- National VET Websites
- Frequently Asked Questions
Using training.gov.au
- Terms of use
- Privacy policy
Acknowledgement of Country
- We acknowledge the traditional owners and custodians of country throughout Australia and acknowledge their continuing connection to land, water and community. We pay our respects to the people, the cultures and the elders past, present and emerging.
A .gov website belongs to an official government organization in the United States.
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.
- About Mild TBI and Concussion
- After a Mild TBI or Concussion
- Health Disparities in TBI
- Comparing Head Impacts
- Clinical Guidance
- Mild Traumatic Brain Injury Management Guideline
- Resources for Health Care Providers
Traumatic Brain Injury & Concussion
About Moderate and Severe TBI
Preventing TBI
Symptoms of Mild TBI and Concussion
Where to Get Help
Facts About TBI
For Medical Professionals
Clinical Guidance for Pediatric mTBI
Health Care Provider Resources
CDC Programs
HEADS UP Online Training Courses
National Concussion Surveillance System
Core State Injury Prevention Program (Core SIPP)
A traumatic brain injury, or TBI, is an injury that affects how the brain works. TBI is a major cause of death and disability in the United States.
For Everyone
Health care providers.
- Research Article
- Open access
- Published: 15 May 2024
The lack of Tex44 causes severe subfertility with flagellar abnormalities in male mice
- Sophie Dupuis ORCID: orcid.org/0009-0004-2932-9755 1 ,
- Marie-Sophie Girault ORCID: orcid.org/0009-0004-3175-3870 1 ,
- Morgane Le Beulze 1 ,
- Côme Ialy-Radio ORCID: orcid.org/0009-0003-5260-5343 1 ,
- Luis Bermúdez-Guzmán 2 ,
- Ahmed Ziyyat ORCID: orcid.org/0000-0001-9724-3831 1 , 3 na1 &
- Sandrine Barbaux ORCID: orcid.org/0000-0002-8204-1855 1 na1
Cellular & Molecular Biology Letters volume 29 , Article number: 74 ( 2024 ) Cite this article
317 Accesses
1 Altmetric
Metrics details
By analyzing a mouse Interspecific Recombinant Congenic Strain (IRCS), we previously identified a quantitative trait locus (QTL), called Mafq1 on mouse chromosome 1, that is associated with male hypofertility and ultrastructural sperm abnormalities. Within this locus, we identified a new candidate gene that could be implicated in a reproductive phenotype: Tex44 ( Testis-expressed protein 44 ). We thus performed a CRISPR/Cas9-mediated complete deletion of this gene in mice in order to study its function. Tex44 -KO males were severely hypofertile in vivo and in vitro due to a drastic reduction of sperm motility which itself resulted from important morphological sperm abnormalities. Namely, Tex44 -KO sperm showed a disorganized junction between the midpiece and the principal piece of the flagellum, leading to a 180° flagellar bending in this region. In addition, the loss of some axonemal microtubule doublets and outer dense fibers in the flagellum’s principal piece has been observed. Our results suggest that, in mice, TEX44 is implicated in the correct set-up of the sperm flagellum during spermiogenesis and its absence leads to flagellar abnormalities and consequently to severe male hypofertility.
Graphical Abstract
Human infertility is a major public health issue that concerns 10–20% of couples of reproductive age. In half of the cases, the cause is due to male infertility [ 1 , 2 ]. Amongst the different causes of male infertility, quantitative and/or qualitative sperm abnormalities can be involved such as low sperm count (oligozoospermia), reduced sperm motility (asthenozoospermia), and abnormal sperm morphology (teratozoospermia). Among the most severe forms of sperm flagellum defects responsible for male infertility, the Multiple Morphological Abnormalities of the Flagella (MMAF) syndrome, first described in 2014, characterizes patients presenting with a mosaic of anomalies including short, absent, coiled, bent, or irregular flagellum [ 3 , 4 ].
Male infertility can be caused by genetic defects that affect spermatogenesis, a complex process in which sperm cells are produced in the testis. Genetic factors appear to have a strong share of involvement in human male infertility cases, with more than 120 genes implicated in the literature [ 5 ]. Still, most of infertility cases have an unidentified genetic cause [ 6 ].
Mouse models are very useful for exploring the function of candidate genes predicted to be involved in infertility since this functional investigation is difficult in humans. Thanks to the analysis of a specific hypofertile Interspecific Recombinant Congenic Strain (IRCS) mouse line previously described, we were able to define the Mafq1 (male fertility chromosome 1) quantitative trait locus. The latter is an interval on mouse Chromosome 1 related to male hypofertility and sperm morphological abnormalities [ 7 ]. In this Mafq1 locus, we previously identified Spata3 as a candidate gene and we demonstrated that the deletion of this gene partially reproduced the phenotype of the hypofertile IRCS strain [ 8 ]. However, we recently found that a newly identified testis-specific gene, Testis expressed protein 44 ( Tex44 ), was reported in one of the latest versions of the mouse and human genomes and is present within the Mafq1 locus. The Spretus version of TEX44 accumulates some variations compared to the C57BL/6 reference one that could be suspected to affect its structure and/or function (Supplementary Table 1).
No data are available concerning the function of the TEX44 protein mainly because it lacks any predictable functional domain. Indeed, the TEX44 gene belongs to the TEX family only because of its expression pattern in the testis and not because of a specific function. To date, 69 TEX or Tex genes have been described in the human or mouse genomes [ 9 ]. In the mouse model, three genes have been related to subfertility ( Tex17, 18, 40 ), and eight genes have been associated with infertility ( Tex11, 12, 14, 15, 19, 19.1, 38, 101 ). Among them, three genes ( TEX11 , TEX14, and TEX15 ) have been linked to azoospermia and/or infertility in humans [ 5 , 9 ].
Here, we identified TEX44 as a sperm flagellar protein. We analyzed in silico its evolution, its expression, its structure, and its potential protein interactions. Then PHENOMIN-ICS produced a mouse line in which the Tex44 gene was deleted in order to understand the function of this gene. We observed that male mice lacking Tex44 expression are drastically hypofertile in vivo and in vitro and that Tex44 -KO sperm exhibit several ultrastructural anomalies.
Ethics statement
All animal experiments were performed in accordance with national guidelines for the care and use of laboratory animals. Authorizations were obtained from local (C2EA-34, Comité d’éthique en matière d’expérimentation animale Paris Descartes) and governmental ethical review committees via the APAFIS Application (Autorisation de projet utilisant des animaux à des fins scientifiques), Authorization APAFIS #14124–2017072510448522 v26, A. Ziyyat (2018–2023).
Generation and breeding of transgenic mice
Tex44 knock-out (KO) mice were established at the MCI/ICS (Mouse Clinical Institute—Institut Clinique de la Souris-, Illkirch, France; http://www.ics-mci.fr/en/ ) platform of the Institut de génétique et de la biologie moléculaire et cellulaire (IGBMC) in Illkirch-Graffenstaden, France. Two pairs of RNA guides, one targeting the 5’ UTR of Tex44 (gR86: TCCCAACCACCATAAGTAGC and gR85, CAACCACCATAAGTAGCAGG), the other the 3’ UTR (gR85, ACAGTTACCTAGTGCAGGGT and gR82, GGGGACAGTTACCTAGTGCA) were selected and produced by in vitro synthesis. Guides and WT Cas9 (IDT, Leuven, Belgium) were electroporated into fertilized oocytes. The genetic background of these embryos was C57BL/6N and was maintained as such during all further crosses, though C57BL/6 J oocytes could also be used only in IVF assays that did not produce offspring. Embryos were transferred at the 1-cell stage into the oviducts of B6/CBA pseudopregnant females. F0 founders of interest were characterized by Sanger sequencing of the PCR fragment overlapping the deletion and three of them were bred to obtain germ line transmission. Subsequent genotyping of CRISPR edited founders was performed by PCR amplification on DNA extracted from tail biopsies (NucleoSpin® Tissue, Macherey–Nagel, Düren, Germany) using the GoTaq Flexi polymerase (Promega, Madison, WI, USA) under standard PCR conditions. Primers obtained from Eurogentec, Liege, Belgium are listed in Supplementary Table 2.
A PCR product of 264 bp was observed with primers F2 -R6 when the expected deletion was observed and checked by sequencing (Eurofins Genomics, Les Ulis, France).
RNAs were extracted from adult testis using a Trizol (Life Technologies, Saint Aubin, France) protocol. Two micrograms of total RNA were treated with DNase I (Promega, Charbonnières les bains, France) at room temperature, then retrotranscribed using the MMLV enzyme (Life Technologies) in the presence of random hexamers. PCR amplification was performed using the Go Taq Flexi (Promega) using the manufacturer’s recommendations.
In vivo fertility and fertilization assay
Sexually mature (8 to 14 weeks) Tex44 -KO homozygous and wild-type littermates were mated with C57BL/6 J females of 7–8 weeks. The numbers of pups and litters were recorded after 3 weeks of gestation whose beginning was attested by the presence of a vaginal plug after the overnight mating.
Wild-type C57BL/6 J female mice of 5–8 weeks (Janvier Labs, Le Genest-Saint-Isle, France) were injected with 5 IU of pregnant mare serum gonadotropin (PMSG). After 48 h, they were superovulated with 5 IU human chorionic gonadotropin (hCG) (Intervet, Beaucouzé, France) and then mated overnight with sexually mature WT or Tex44 -KO males in order to evaluate their capacity to fertilize in vivo. The next day, females showing a vaginal plug were sacrificed by cervical dislocation and their oocytes retrieved. Oocytes were cleared of cumulus cells and directly mounted in Vectashield/DAPI (Vector laboratories, Burlingame, CA, USA) for observation under UV light (Nikon Eclipse E600 microscope) in a blinded manner. Oocytes showing at least one fluorescent decondensed sperm head within their cytoplasm were considered fertilized. According to this, the fertilization rate (FR) was evaluated.
Mouse oocyte and sperm preparation for In Vitro fertilization
Oocyte preparation Wild-type C57BL/6 J female mice of 5–8 weeks (Janvier Labs, Le Genest-Saint-Isle, France) were superovulated with 5 IU of pregnant mare serum gonadotropin (PMSG) and then 48 h later with 5 IU human chorionic gonadotropin (hCG) (Intervet, Beaucouzé, France). The next day, about 13 h after hCG injection, animals were sacrificed by cervical dislocation. Cumulus oocyte complexes were collected by tearing the ampulla wall of the oviduct, placed in FertiCult medium (FertiPro N.V, Belgium) supplemented with 3% BSA (Sigma–Aldrich), and maintained at 37 °C under 5% CO 2 in air under FertiCult Mineral Oil (FertiPro N.V, Belgium). When experiments were performed with zona-free oocytes, cumulus cells were first removed by a brief exposure to hyaluronidase IV-S (1 mg/ml, Sigma–Aldrich). Then, the zona pellucida was dissolved with acidic Tyrode’s solution (pH 2.5, Sigma–Aldrich) under visual monitoring. Zona-free eggs were rapidly washed in a FertiCult medium, BSA 3% and kept at 37 °C under 5% CO 2 atmosphere for 2 to 3 h to recover their fertilization ability.
Sperm preparation Mouse spermatozoa were obtained from the cauda epididymis of WT or Tex44 -KO male mice (8–14 weeks old) and capacitated at 37 °C under 5% CO 2 for 90 min in a 500 μl drop of FertiCult medium supplemented with 3% BSA, under FertiCult Mineral Oil.
In vitro fertilization
Cumulus-intact or zona-free eggs were inseminated with capacitated spermatozoa, at a final concentration of 10 6 /ml or 10 5 /ml respectively, for 3 h, in a 50 μl drop of FertiCult medium, 3% BSA kept at 37 °C, 5% CO 2 , under FertiCult Mineral Oil. At the end of incubation, oocytes were washed and directly mounted in Vectashield/DAPI (Vector laboratories, Burlingame, CA, USA) for a blinded observation under UV light (Nikon Eclipse E600 microscope). Oocytes showing at least one fluorescent decondensed sperm head within their cytoplasm were considered fertilized. According to this, the fertilization rate (FR) was evaluated. To assess the fertilization index (FI) in zona-free assay, the number of decondensed sperm heads per oocyte was recorded.
Mouse sperm parameter analysis
Sperm motility was assessed by Computer-Assisted Semen Analysis (CASA) using the CEROS II apparatus (Hamilton Thorne, Beverly, MA, USA). Mouse spermatozoa samples were obtained from the cauda epididymis of WT or Tex44 -KO mice (8 to 10 weeks old) and capacitated for 2 h in a 500 μL drop of FertiCult medium supplemented with 3% BSA, under mineral oil, at 37 °C under 5% CO 2 . The movements of at least 2000 sperm cells per sample were analyzed in 20 μm chambers (Leja Products B.V., NieuwVennep, Netherlands) with a Zeiss AX10 Lab. A1 microscope (10 × objective), using the HT CASAII software. The settings were as follows: acquisition rate, 60 Hz; number of frames, 45; minimum head brightness, 175; minimum tail brightness, 80; minimum head size, 10 μm2; minimum elongation gate, 1%; maximum elongation gate, 100%; objective magnification factor, 1.2. Though all sperm analyses were planned as blinded experiments to reduce potential biases, the structural anomalies of Tex44 -KO sperm were inevitably recognizable.
Histological analysis and mouse sperm preparation
Testes from adult WT and Tex44 -KO males were collected and fixed overnight in 4% paraformaldehyde in PBS. Samples were dehydrated, embedded in paraffin and cut in serial 5 μm thick sections on a microtome. Testis sections were rehydrated before Hematoxylin–eosin (H&E) staining.
For Papanicolaou staining, sperm were retrieved from cauda epididymes in FertiCult medium and spread onto a Superfrost Plus slide (ThermoFischer Scientific). Sperm cells were fixed by incubation with paraformaldehyde 4% in PBS for 10 min and stained, following the Papanicolaou protocol (Hematoxylin, OG6, EA50). Briefly, slides were washed in 95% ethanol and dipped in Harris hematoxylin for 3 min for nucleus counterstaining, and washed, stained with OG-6 dye (RAL diagnostics 05.12013, Martillac, France) and with EA-50 (RAL diagnostics 05.12019). Then slides were dehydrated (95% ethanol absolute ethanol and xylene) and mounted with a permanent mounting medium.
For the analysis of the sperm morphology, testes and the three parts of the epididymis (caput/corpus/cauda) were dissected and spermatozoa were retrieved in M2 medium at 37 °C. Sperm samples were washed in PBS 1X- BSA1%, centrifuged at 600 g for 5 min and immediately fixed in 4% Paraformaldehyde (Electron Microscopy Sciences, PA, USA) in PBS-1% BSA for 5 min. A drop of sperm suspension was smeared on a slide, air-dried and mounted with Vectashield-DAPI. Detection was performed using a Nikon Eclipse E600 microscope. Images were digitally acquired with a camera (Coolpix 4500, Nikon, Champigny sur Marne, France).
Mouse sperm immunofluorescence staining
Sperm suspensions were permeabilized during 10 min in PBS 1 × , triton 0.2%, and were then saturated for 1 h in PBS-BSA 1% with triton 0.02%, at RT. Then they were incubated for 1 h with a polyclonal anti-SEPTIN4 antibody (HPA021587, Sigma Aldrich) at 1:50 in PBS-BSA 1% with triton 0.02% at RT for 2 h and washed three times in PBS-BSA 1%. A secondary antibody (anti-Rabbit-Alexa Fluor 488 at 10 μg/ml, ThermoFischer Scientific) was used at RT during 1 h. After repeated washing with PBS-BSA 1%, a drop of sperm suspension was smeared on a slide, air-dried and mounted with the VECTASHIELD® PLUS Antifade Mounting Medium with DAPI medium (Eurobio Scientific, Les Ulis, France). Detection was performed using a Nikon Eclipse E600 microscope. Images were digitally acquired with a camera (Coolpix 4500, Nikon, Champigny sur Marne, France).
Mitochondrial staining
Mouse spermatozoa were obtained from the cauda epididymis of WT or Tex44 -KO male mice (8–14 weeks old) and capacitated at 37 °C under 5% CO 2 for 90 min in a 500 μl drop of FertiCult medium supplemented with 3% BSA, under FertiCult Mineral Oil. Then, MitoTracker™ Orange CMTMRos (M7510, Thermofisher) was added to the medium at a concentration of 500 nM for 30 min in the incubator at 37 °C under 5% CO 2 . Sperm cells were then spread onto a Superfrost Plus slide (ThermoFischer Scientific). After drying in the dark, sperm cells were fixed by incubation with paraformaldehyde 4% in PBS for 10 min. Since this Mitotracker ™ is a probe that passively diffuses across the plasma membrane and accumulates in active mitochondria, the intensity of fluorescence reflects the mitochondrial activity. Detection of fluorescence was performed using a Nikon Eclipse E600 microscope and images were digitally acquired with a camera (Coolpix 4500, Nikon, Champigny sur Marne, France). The intensity of fluorescence has been normalized with that of the background fluorescence of each image.
Human sperm immunostaining
Human sperm were donated by patients undergoing an assisted reproductive technology (ART) program for in vitro fertilization (IVF) in the assisted reproductive laboratory of Cochin’s Hospital (Paris, France). Spermatozoa were collected from excess fresh sperm derived from IVF attempts. The GERMETHEQUE Biobank site of PARIS-COCHIN (BB-0033-00081) provided 6 samples of sperm. GERMETHEQUE obtained consent from each patient to use their samples (CPP 2.15.27). The GERMETHEQUE pilotage committee approved the design of this study under the number 20220101. The Biobank has a declaration DC-2021-4820 and an authorization AC-2019-3487.
Classical and super-resolution STED immunofluorescence staining were made on these samples.
For the super-resolution STED immunofluorescence staining specifically, upon reception the human sperm samples were first washed in Ferticult medium supplemented with 3% BSA. Then they were incubated with MitoTracker™ DeepRed FM (M22426, Thermofisher) at a concentration of 500 nM for 30 min at 37 °C under 5% CO 2 . For classic and super-resolution STED fluorescence staining Samples were then fixed in 4% Paraformaldehyde (Electron Microscopy Sciences, PA, USA) in PBS 1X for 5 min followed by 3 washes with PBS-BSA 1%. Sperm suspensions were then permeabilized during 10 min in PBS 1 × , triton 0.2%, washed three times with PBS-BSA1% and then saturated for 30 min in PBS-BSA 3%.
Then for both classical and super-resolution STED immunofluorescence, sperm samples were incubated with a polyclonal anti-TEX44 antibody (HPA056433, Sigma Aldrich) at 1:40 (5 μg/ml) in PBS-BSA 1% or with an anti-Rabbit IgG isotype control (5 μg/ml) (Ref:02–6102, Invitrogen) overnight at 4 °C. The next day, samples were washed three times in PBS-BSA 1%. Secondary antibodies (anti-Rabbit-Alexa Fluor 488, ThermoFischer Scientific, at 10 μg/ml for the classical immunofluorescence and Abberior ® STAR 580 diluted at 1:1000 for the super-resolution STED immunofluorescence) were used at RT during 1 h. For the classic immunostaining, after repeated washing with PBS-BSA 1%, a drop of sperm suspension was smeared on a slide, air-dried and mounted with the VECTASHIELD ® PLUS Antifade Mounting Medium with DAPI medium (Eurobio Scientific, Les Ulis, France). Detection was performed using a Nikon Eclipse E600 microscope and images were digitally acquired with a camera (Coolpix 4500, Nikon, Champigny sur Marne, France).
For the super-resolution STED immunofluorescence, after repeated washing with PBS-BSA 1%, sperm samples were incubated with Hoechst (3 μg/ml) for 15 min then washed with PBS-BSA 1%. Then a drop of sperm suspension was smeared on a slide, air-dried and covered with the mounting medium Invitrogen™ ProLong™ Gold Antifade Mountant (Ref: P36934, Invitrogen). The slides were then sealed with the dental silicone Eco-sil speed (Ref: 476.410, Rotec). STED images have been acquired using an inverted SP8X STED WLL Leica confocal microscope (Leica Microsystems) at 100 × magnification (HC PL APO 1.4 oil), zoom factor 4x. We used a 775 nm pulsed laser to deplete both TEX44 and mitochondrial signals.
Western blot
COS-7 cells were grown in DMEM medium supplemented with antibiotics and fetal calf serum (Invitrogen). They were transfected by electroporation on a 4D-Nucleofector apparatus (Lonza, Visp, Switzerland) with a construct containing the human TEX44 open reading frame cloned upstream of the EGFP sequence in the pEGFP-N1 vector (Clontech). After 48 h, cells were pelleted and protein extracts were obtained from lysis in a Laemmli buffer. Sperm pellets were extracted using a 2% SDS, PBS 1X solution supplemented with protease inhibitors. After denaturation, proteins were run on a precast Mini-Protean TGX gel (Bio-Rad, Marnes la Coquette, France), transferred to a nitrocellulose membrane and probed with the anti-TEX44 antibody.
Electron microscopy
Mouse spermatozoa from males were prepared as described above (IVF) and fixed by incubation in PBS supplemented with 3% glutaraldehyde (Grade I, Sigma) for 2 h at room temperature. Samples were washed twice in PBS and post-fixed by incubation with 1% osmium tetroxide (Electron Microscopy Sciences). Then, they were dehydrated by immersion in a graded series of alcohol solutions and embedded in Epon resin (Polysciences Inc.,Warrington, PA, USA). Ultra-thin sections (90 nm) were cut with a Reichert Ultracut S ultramicrotome (Reichert-Jung AG, Wien, Austria) and then stained with uranyl acetate and lead citrate. Sections were analyzed with a JEOL 1011 microscope and digital images were acquired with a Gatan Erlangshen CCD camera and Digital Micrograph software. Characterization of the different phenotypes observed was performed through double blind analysis.
Statistical analysis and study design
Results are expressed as mean ± SEM of at least three independent experiments. For statistical analysis, t-Tests were performed using GraphPad Prism version 9.00 for Windows (GraphPad Software, La Jolla California USA). Differences were considered statistically significant when p-value < 0.05. When data were not normally distributed, a Welch’s correction was applied. The experimental groups and the calculation of sample size were obtained using the Experimental Design Assistant (EDA; https://eda.nc3rs.org.uk ).
TEX44 is only present in placental mammals and its expression is testis specific.
To explore the evolutionary history of TEX44 , we first used the Ensembl comparative genomics resources [ 10 ] ( https://www.ensembl.org/index.html ) to get the Gene Tree of TEX44 . Interestingly, we noticed that the gene was only present in mammals, exclusively in Eutherians (placental mammals). To validate these findings, we used the human protein sequence of TEX44 to BLAST against the NCBI dataset ( https://www.ncbi.nlm.nih.gov/ ) and we could not find homologous sequences in non-placental mammals and other vertebrates. Next, we analyzed the evolutionary pattern of gene gain/loss events, and we could find homologous sequences in the NCBI database for most of the placental mammals (Fig. 1 a). Notably, protein sequence similarity between humans and other mammals was very low (mouse: 45.76% and ~ 80% for some primates; Supplementary Table 1), suggesting that this gene is evolving particularly fast in humans. The synteny between the Mafq1 region on mouse chromosome 1 and the region on human chromosome 2 containing the TEX44 gene and the common expression profile validate the orthologous status of the genes.
Evolution of TEX44 . a The gene tree shows that Tex44 first appeared in placental mammals (blue dots). Grey dots within placental mammals show instances in which there has been a gene loss of TEX44 . b Single-cell RNA sequencing data confirmed the tissue-specific expression of Tex44 in early and mainly late spermatids
It has been reported that TEX44 mRNA and protein are specifically expressed in the testis in both mice [ 9 ] and humans [ 11 ]. We used The Human Protein Atlas to interrogate this and found that based on single-cell RNA sequencing, TEX44 is specifically expressed in early and mainly late spermatids (Tau specificity score = 0.98, where 1 means expression in a single cell/tissue type) (Fig. 1 b). This has been also reported in mice [ 12 , 13 ]. As Spata3 is also exclusively expressed in testis, we also analyzed the evolutionary history of this gene and discovered that it is also present exclusively in placental mammals (Supplementary Fig. 1a). We confirmed that it is also specifically expressed in early and mainly late spermatids (Supplementary Fig. 1b), showing that both candidate genes from Mafq1, Spata3 and Tex44, have a similar expression profile (Supplementary Fig. 1c).
Tex44 -KO male mice present drastic hypofertility in vivo and in vitro
Tex44 knock-out mice were generated using a CRISPR/Cas9 strategy at the Institut Clinique de la Souris (Celphedia, Phenomin, ICS, Illkirch). Guides located within both 5’ and 3’ UTR regions allowed the targeting and deletion of the complete open reading frame included in the unique exon of Tex44 . Animals presenting a deletion of Tex44 were validated by PCR amplification and sequencing of the locus as illustrated in Fig. 2 . Animals were crossed over at least 4 generations and obtained in mendelian proportions to finally obtain homozygous knock-out animals ( Tex44 -KO). Though no specific antibody to reveal the absence of the TEX44 protein was available, the lack of Tex44 mRNA could be validated in testis samples by RT-PCR (Fig. 2 b). This additional internal PCR also performed on genomic DNA confirmed the complete absence of the Tex44 gene.
CRISPR/Cas9 strategy for Tex44 mono-exonic gene deletion. a Map of the Tex44 locus. RNA guides are represented upstream and downstream of the Tex44 open reading frame as thunderbolts. The primers used for genotyping and cDNA amplification are represented by the F2, R2 and R6, and 1F, 1R arrows respectively. b Amplification of testis cDNA and genomic DNAs from WT, Tex44 -KO and Spata3 -KO samples for the Tex44 , Spata3 genes and Prm1 as an expression control. MWM: molecular weight marker. c Sequence of the PCR product of the deleted allele, primers F2 and R6 are in orange
In order to test in vivo fertility, Wild-Type (WT) and Tex44 -KO littermate males were mated with C57BL/6 J WT females. The average litter size was significantly different ( p < 0.0001) when pups were born from WT males (7.1 ± 0.38; n = 14) compared to those born from Tex44 -KO males (2.9 ± 0.75; n = 15) (Fig. 3 a). When females showed a vaginal plug after mating but not followed by births, the number of pups per litter was recorded as null. Offspring of Tex44 -KO males, though rare, were viable and normal. Homozygous females could breed normally.
Evaluation of Tex44 -KO male fertility in vivo ( a , b ) and in vitro ( c, d ). a WT females were mated with WT or KO males and litter size (mean ± SEM) was counted after 3 weeks of gestation whose beginning was attested by the presence of a vaginal plug after the overnight mating. b Superovulated WT females were mated with WT or KO males to evaluate their capacity to fertilize in vivo. The day following the overnight mating, only females showing a vaginal plug attesting that a mating had occurred were used for the experiments. The fertilization rate (FR) (mean ± SEM) was assessed by the in vivo fertilization assay. Tex44 -KO males’ in vivo fertility was significantly decreased. c The fertilization rate (FR) (mean ± SEM) was assessed by cumulus-intact In Vitro Fertilization (IVF) assay at 10 6 (WT and KO) sperm per ml. No fertilization was obtained with Tex44 -KO sperm. d The fertilization index (FI) (mean ± SEM) was assessed by zona-free IVF assay at 10 5 (WT or KO) or 10 6 KO sperm per ml (10 times more concentrated). FI was significantly decreased when oocytes were inseminated with KO sperm compared to WT sperm. The FI was restored to WT values when the concentration of KO sperm was increased by 10 times. All experiments were repeated at least three times. **** p < 0.0001. Numbers between brackets indicate the number of oocytes
In vivo fertilization assays were performed with superovulated C57BL/6 J WT females that were mated overnight with WT or Tex44 -KO males. The next day, females showing a vaginal plug were sacrificed and cumulus-intact oocytes were retrieved to evaluate the in vivo fertilization rate (FR: the average number of fertilized oocytes among the total number of oocytes). The FR was significantly different: 96.1 ± 0.02% ( n = 129) for the control condition (WT) and 19.6 ± 0.04% ( n = 92) for the KO condition ( p < 0.0001) (Fig. 3 b).
For in vitro fertilization assays, cumulus-intact and zona-free oocytes from WT females were incubated with sperm from WT or KO males. For the cumulus-intact IVF assays, the FR was 44.4 ± 0.04% ( n = 151) for the control condition (WT) and 0.8 ± 0.01% ( n = 124) for the KO condition ( p < 0.0001) (Fig. 3 c). For the zona-free assays, the fertilization index (FI: the average number of fused sperm per oocyte) was 1.06 ± 0.09 ( n = 72) for the control condition and 0.15 ± 0.04 ( n = 78) for the KO condition ( p < 0.0001). Interestingly, we were able to bring back the FI to control values in the KO condition by inseminating the oocytes with 10 times more sperm (FI = 1 ± 0.07, n = 91) (Fig. 3 d).
These observations suggested that the deletion of Tex44 drastically affects the successful process of fertilization both in vivo and in vitro.
Tex44 -KO male mice present sperm morphological abnormalities
In order to better understand why Tex44 -KO males are highly hypofertile in vivo and in vitro, we further characterized their testis and sperm cells. Histology of the Tex44 -KO male's testes showed no obvious abnormalities (Fig. 4 a) and the sperm counts from the epididymal cauda were not statistically different between WT and Tex44 -KO males (55.7 ± 3.9 × 10 6 sperm/ml for the WT males (n = 8) vs. 48.3 ± 5.8 × 10 6 sperm/ml ( n = 9) for the Tex44 -KO males) (Fig. 4 b). However, the Computer Aided Sperm Analysis (CASA) system revealed a drastic difference in sperm motility between WT sperm (63.2 ± 0.02% of motility) and Tex44 -KO sperm (8.7 ± 0.01% of motility) (Fig. 4 c).
Histology of testes, sperm counts and motility analysis of WT and Tex44 -KO males. a No obvious abnormalities of testes histology were observed between WT and Tex44 -KO. b No significant difference was observed between WT and Tex44 -KO cauda epididymal sperm counts. c Analysis of sperm motility by Computer Assisted Semen Analysis (CASA). CASA analyses showed a drastic reduction of motility of the Tex44 -KO sperm compared to the WT sperm. Data are represented as the mean ± SEM of at least three sperm samples of each group of males (WT and KO). **** p < 0.0001
Observation of sperm morphology under light microscopy showed obvious defects on the Tex44 -KO sperm retrieved from the cauda of the epididymis (Fig. 5 ). These KO sperm showed disjunction (Fig. 5 d,f) and severe hairpin bending (Fig. 5 d,e) between the midpiece and the principal piece (MP-PP) compared to WT (Fig. 5 a,b).
Characterization of the sperm morphology by light ( a , b , d - f ) and electron microscopy ( c , g , h ). Papanicolaou staining of WT and Tex44 -KO sperm, retrieved from the cauda epididymis ( a , d ), with the associated enlargement of the framed areas respectively ( b ) for the WT and ( e ) and ( f ) for the Tex44 -KO sperm. Example of a severe bending of the flagellum between the midpiece (MP) and the principal piece (PP), observed in Tex44 -KO sperm in light microscopy ( e ) and electron microscopy ( h ) in comparison with WT sperm ( b ) and ( c ), respectively). Example of a MP-PP disjunction of the flagellum observed in Tex44 -KO sperm in light microscopy ( f ) and electron microscopy ( g ). The arrows ( e , f , g , h ) show the two kinds of abnormalities observed on the sperm flagellum
In order to stage these abnormalities observed on the flagellum, we isolated sperm from the testis and the three main regions of the epididymis (caput/corpus/cauda). The proportion of severe hairpin bending in the Tex44 -KO sperm increased along the progression through the three regions of the epididymis. The frequency of this anomaly went from 12% in the caput to 58% in the corpus and finally 80% in the cauda (Fig. 6 ). No severe bending was observed in the testis sperm but 65% of these testicular Tex44 -KO sperm showed a thinning between the midpiece and the principal piece.
Comparison of the sperm flagellum abnormalities of WT and Tex44 -KO sperm from the testis and from caput, corpus and cauda epididymis. While progressing through the different stages of maturation in the epididymis, the Tex44-KO sperm morphological phenotype gets worse, evolving from a majority of midpiece-principal piece (MP-PP) disjunction to a majority of severe bending of the flagellum. Numbers between brackets indicate the number of individual sperm observed
Tex44 -KO male mice present other sperm ultrastructural abnormalities
Sperm samples were then analyzed by electron microscopy to confirm the ultrastructural defects observed previously and to reveal those that could not be visible through light microscopy. In addition to the sperm flagellar MP-PP disjunction and hairpin bending shown in Fig. 5 g, h, transversal sections of the principal piece (PP) often showed the lack of some microtubule doublets and their associated outer dense fibers (4.2 ± 0.01% of PP abnormalities for the WT sperm vs 63.6 ± 0.06% for the Tex44 -KO sperm). (Fig. 7 a, b).
Electron microscopy analysis of cross-sections of WT and Tex44 -KO sperm’s flagellum. a Examples of the lack of some microtubule doublets and their associated outer dense fibers in the principal piece of the Tex44 -KO sperm’s flagellum. b Counting of sperm displaying the phenotype showed in panel ( a ), in WT and Tex44 -KO cross-sections of the sperm’s flagellum. Numbers between brackets indicate the number of sperm flagellum’s cross-sections analyzed. **** p < 0.0001
Presence of the annulus in Tex44 -KO male mice sperm
Given that Tex44 -KO sperm exhibit flagellar disjunction and a hairpin bending at the junction between the MP and PP, we also interrogated the integrity of the annulus, a septin-based fibrous ring-like structure located between the MP and the PP of the flagellum. We thus performed immunofluorescence on cauda epididymal sperm with an anti-SEPT4 antibody to detect this conserved annulus protein [ 14 ]. A specific ring staining was observed between the MP and the PP of the flagellum in the WT and Tex44 -KO sperm despite their abnormal structure in this latter (Fig. 8 ). This result suggests that the annulus structure does not seem to be impacted by the absence of TEX44 in the sperm.
Presence of the annulus on the Tex44 -KO flagellum. Immunostaining of WT ( a ) and of Tex44 -KO ( b , c ) cauda epididymal sperm with an anti-SEPT4 antibody showed both a specific ring staining between the midpiece and the principal piece of the flagellum, despite the abnormal flagellum structure in the KO. Nuclei are counterstained in blue by DAPI
Lower mitochondrial activity of the Tex44 -KO sperm
Given the major defect in sperm motility, we used Mitotracker ™ CMTMRos, a probe that passively diffuses across the plasma membrane and accumulates in active mitochondria, to characterize the mitochondrial activity of WT and Tex44 -KO sperm (Fig. 9 ). As presented in the violin plot (Fig. 9 b), we noticed that Tex44 -KO sperm statistically showed a lower fluorescence intensity compared to the WT sperm which are more uniformly distributed between low and high relative fluorescence intensities (Fig. 9 a). These results suggest that Tex44 -KO sperm show a significantly lower mitochondrial activity than the WT sperm. In some cases, abnormal mitochondrial structures can be observed in electron microscopy (Fig. 9 c). Even if this phenotype was never observed in WT, it remained rare in KOs preventing any statistical comparison.
Characterization of the sperm mitochondrial activity by Mitotracker™ CMTMRos staining ( a , b ) and examples of mitochondrial abnormalities observed in the Tex44 -KO sperm ( c ). a Mitotracker CMTMRos representative stainings on WT and Tex44 -KO sperm and analysis of the relative fluorescence intensity ( b ). Tex44 -KO sperm show a lower mitochondrial activity. Numbers between brackets indicate the number of sperm analyzed. **** p < 0.0001. ( c Electron microscopy analysis of longitudinal sections of Tex44 -KO flagellum sperm. Example of abnormal size of mitochondria is shown between brackets and supernumerary mitochondria shown by an arrow
Expression and localization of TEX44 on the human sperm
Unfortunately, no specific antibodies against the mouse TEX44 protein are commercially available preventing us from seeking its localization. We nevertheless could study the expression and localization of TEX44 in human sperm. A polyclonal anti-TEX44 has been validated by Western blot (Fig. 10 a). Briefly, this antibody recognized the human form of TEX44 coupled with GFP in transfected COS-7 cells with an expected ~ 69 kDa band (42 kDa for human TEX44 + 27 kDa for the GFP). We then used it on human sperm extracts and detected the expression of TEX44 with an expected ~ 42 kDa band (Fig. 10 a). It should be noted that, at least, a double band has been detected in both conditions suggesting a cleavage or post-translational modification of the protein since TEX44 is a mono-exonic gene. The same antibody validated in Western blot was used to localize TEX44 in human sperm by immunofluorescence (Fig. 10 b) and by super-resolution STED fluorescence (Fig. 10 c). Following both approaches, we observed specific staining on the midpiece of the flagellum accompanied or not by post-acrosomal staining of the sperm head. The staining appears as a network surrounding mitochondrial helixes.
Expression of TEX44 in human sperm. a Western blot with extracts of COS-7 cells transfected or not with human TEX44-GFP and of human sperm, revealed by a polyclonal anti-TEX44 antibody. The Ponceau Red staining is provided as a loading control. Classical green immunofluorescence ( b ) and super-resolution STED green fluorescence ( c ) showing the main localization of TEX44 on the midpiece of human sperm flagellum (shown by a curly bracket) and on the post-acrosomal part of the sperm head (shown by an arrowhead) at the same time as the labeling of mitochondria by a Mitotracker ™ probe (red fluorescence)
Bioinformatics analysis on TEX44 structure and function.
Given the potential colocalization between TEX44 and mitochondria, we used some bioinformatic tools to further characterize the structure and function of this protein. We used InterPro ( https://www.ebi.ac.uk/interpro/ ) to predict its potential domains, but the prediction did not show any result other than “Domain of unknown significance” (DUF4678 ) . As there is no crystal structure for TEX44, we used the Alphafold database ( https://alphafold.ebi.ac.uk/ ) to retrieve the prediction for this protein structure (AF-Q53QW1-F1). The confidence scores for most amino acids are very low, with most regions being predicted as disordered (Supplementary Fig. 2a). This was further validated using the IUPred3 tool [ 15 ] ( https://iupred.elte.hu/plot ) and the PDBSum tool ( https://www.ebi.ac.uk/thornton-srv/databases/pdbsum/ ) (Supplementary Fig. 2b). Since we noticed the presence of several alpha helices, we used the DeepTMHMM tool ( https://dtu.biolib.com/DeepTMHMM ) to interrogate whether TEX44 could be a membrane protein. The prediction suggested that there is no membrane domain (Supplementary Fig. 2c). We also used the STRING database [ 16 ] ( https://string-db.org/ ) to explore potential protein interactors of TEX44 (Supplementary Fig. 2d). The figure shows the network with an interaction score of 0.150 (low confidence), however, 3 out of 4 interactors experimentally determined (CPT1B, TIMM17B, and MICOS13) are still present if we use a higher interaction score (0.40; medium confidence). Notably, these proteins are involved in mitochondrial function.
Among the list of candidate genes within the Mafq1 QTL interval, responsible for the hypofertility phenotype observed in the Rc3 IRCS strain [ 7 ], the Spata3 gene appeared to be a strong candidate gene. Its deletion partially reproduced the phenotype of the hypofertile IRCS strain. Namely, it induced morphological alterations in sperm, including a defective anchoring of the acrosome to the nucleus and the persistence of residual bodies in the sperm midpiece, as well as hypofertility only observed in vitro [ 8 ]. However, in one of the latest versions of the mouse and human genomes, a new gene, Tex44 , has been described in this interval of interest on mouse chromosome 1 and its syntenic region on human chromosome 2. Its function is unknown, but Tex44 is the only other candidate gene that is specifically expressed in the testis (at the spermatid stage) and shows genetic polymorphisms in the hypofertile IRCS mouse line, predicted to affect protein function as listed in Supplementary Table 1. Tex44 presents with a longer list of missense SNPs than Spata3 but analysis software predicts that the ones in Tex44 have lower impacts on protein function. Interestingly, we found that both Spata3 and Tex44 are exclusively present in placental mammals, as already observed for genes expressed at the latest spermatogenic stages [ 17 ] and correlated to the rapid evolution of genes responsible for male reproductive fitness.
In order to study the role of the TEX44 protein in male fertility particularly in spermatogenesis, we generated Tex44 -KO mice. In vivo crossings with KO males showed a reduced average litter size. Though some WT females were positive for a vaginal plug after mating with KO males, no birth could be detected after 3 weeks. In order to understand if this in vivo hypofertility was either due to an embryonic development defect or to a fertilization defect, we achieved in vivo fertilization assays with WT superovulated females that were mated overnight with WT or Tex44 -KO males. The next day, oocytes of females showing a vaginal plug were retrieved and the in vivo fertilization rate appeared to be drastically reduced in the KO group, confirming a fertilization defect of the Tex44 -KO sperm. In a similar way, Tex44 -KO sperm almost completely failed to fertilize WT oocytes both in cumulus-intact IVF and in zona-free IVF assays. Interestingly, increasing the sperm concentration of Tex44 -KO by tenfold during zona-free IVF allowed the restoration of the fertilization index to the same level as the control. The deletion of Tex44 thus shows a more drastic phenotype of hypofertility than the original Rc3 line.
Even though Tex44 -KO males showed no abnormalities in their testicular histology and their epididymal sperm count, evoking normal spermatogenesis, their sperm showed a drastic reduction of motility and important ultrastructural anomalies. In fact, the progression of the Tex44 -KO sperm through the different stages of maturation in the epididymis was correlated to a progressive deterioration of the morphological phenotype. This latter evolved from a majority of midpiece-principal piece (MP-PP) disjunctions in the caput epididymis to a majority of severe bending of the flagellum in the cauda epididymis. This could be explained by the fact that during their transit through the epididymis, sperm gradually acquire their motility [ 18 , 19 , 20 ]. Since Tex44 -KO sperm present a weakness at the MP-PP junction, the initial acquisition of their mobility leads to a break at this specific region (severe hairpin bending).
The drastic reduction of Tex44- KO sperm motility is a direct consequence of important morphological sperm abnormalities. Interestingly, the low percentage (< 10%) of sperm that do not present morphological abnormalities is nearly the same as the one of motile sperm. These few “normal” sperm could explain the fact that the Tex44 -KO males are severely hypofertile but could still rarely sire in vivo and in vitro. This hypothesis has been validated by the restoration of the fertilization index in vitro to a control value when the Tex44 -KO sperm concentration was increased tenfold.
Most of the abnormalities observed on the Tex44 -KO sperm have already been described previously in the literature and can potentially help us in the comprehension of TEX44's function in mice. They can define the phenotype as terato-asthenozoospermia and are reminiscent of one of the anomalies observed in the MMAF (multiple morphological anomalies of the flagellum) syndrome, a mosaic of defects in sperm flagellum morphology leading to reduced sperm motility [ 21 ].
For example, the absence of SEPTIN4 [ 14 ] or TAT1 [ 22 ], which are critical components of the sperm annulus, leads to males that are infertile in knock-out mouse models. These KO mice show a complete lack of sperm motility and structurally defective sperm with MP-PP disjunction and hairpin bending of the tail, disruption of the axial structures, absence of annulus, and abnormal mitochondrial sheath structure. The mouse knockout of Cabs1, a gene coding for a spermatid-specific calcium-binding protein, leads to male subfertility with a disorganization of the MP-PP junction and an abnormal annulus.
The absence of SEPP1, a crucial component of the selenium dietary micronutrient delivery pathway in male germ cells development, shows the same defective phenotype as in the absence of SEPTIN4 and TAT1, but with the maintenance of an annulus [ 23 ].
Recently, the protein LRRC46, a member of the Leucine-rich repeat protein (LRRC) family, has been described to play a role in the mouse sperm flagellum biogenesis. Its location is restricted to the midpiece, like TEX44. However, the knockout of Lrrc46 showed typical MMAF phenotypes including coiled, short, and irregular flagella [ 24 ]. The Tex44 -KO doesn’t seem to affect deeply the annulus as SEPTIN4 is normally detected at the right position and, in electron microscopy images, the expected triangular dense structure of the annulus is visible between the midpiece and principal piece, in spite of surrounding abnormalities.
Damage in the integrity of microtubule doublet structure has been shown to be associated with sperm motility defects and male infertility, as seen for the deletion of Ccdc176 [ 25 ], Tmem232 [ 26 ], Cfap97d1 [ 27 ], Dnah17 [ 28 ], Trll9 [ 29 ], Pla2g3 [ 30 ] and Vdac3 [ 31 ] in mice. Missing microtubule doublets have also frequently been observed in the principal piece of Tex44 -KO sperm. The intra-flagellar traffic is apparently affected. It is not clear whether this anomaly is a primary result of the absence of TEX44 expression or if it is a secondary consequence of the disjunction and break taking place between the midpiece and the principal piece, preventing any protein movement downstream of the annulus.
In the literature, RABL2, a member of the RAS GTPase superfamily, has been described to play a role in the mouse sperm intra-flagellar transport and the tail assembly [ 32 ]. Its location is restricted to the midpiece, like TEX44. However, a mutation in a critical protein–protein interaction domain in a mouse line model resulted in male sterility with decreased sperm output and severe motility defects but with normal sperm morphology.
Knowing that no specific antibodies against TEX44 are available in mice we however had a look at the human protein expression and localization. After validating an antibody in Western blot in COS-7 transfected cells, we could confirm TEX44 expression in human sperm extracts. In order to localize the protein, we performed some immunofluorescence assays by classical and super-resolution (STED) approaches. TEX44 appeared to be localized on the post-acrosomal region of the sperm head and the midpiece of the sperm flagellum. In fact, TEX44 seems to encompass the mitochondrial sheath of the midpiece in a spiral-like conformation. Interestingly, looking at the STRING database ( https://string-db.org/ ), TEX44 is described as interacting with human TIMM17B, CPT1B [ 33 , 34 ], and MICOS13 proteins (Detected by validated two-hybrid assay). These three proteins are respectively expressed in the inner, the outer, and the cristae mitochondrial membrane. However, it is not clear if TEX44 is a mitochondrial protein (and in which section of the organite) or if it is surrounding. Imaging by super-resolution rather suggested a structural role around the midpiece mitochondrial sheath. The decrease of mitochondrial activity observed in the Tex44 -KO and detected by the MitoTracker probe could rather be an indirect consequence of an abnormal setup of the mitochondrial network. It is interesting to notice that the CABS1 protein mentioned above has been detected in the mitochondrial inner membrane in rat sperm [ 35 ]. The KO of the Gk2 and Gykl1 genes, coding for mitochondrial proteins specifically expressed in spermatids, show some similarities of phenotype: flagellum bending and some disorganization of the mitochondrial sheath [ 36 ]. The mitochondrial disorganization that we observed could be due to the absence of TEX44 if this protein is necessary to structure the mitochondrial sheath. It could also be a consequence of the perturbations that affect trans-flagellar traffic and that compromise mitochondrial maintenance. Mitochondrial dysfunction could worsen sperm mobility already jeopardized by flagellum breaking.
Though our interest in the Tex44 gene was motivated by its location within the Mafq1 interval, we consider that Tex44-KO males share few phenotypic traits with the original Rc3 IRCS line as summarized in Supplementary Table 4. Flagellar defects would have been observed in Rc3 males if TEX44 function was affected. Both Spata3 and Tex44 genes seem to have independent functions as the defects observed in both KO target different subcellular compartments and also independent regulations as both genes are above 400 kb distant and as Spata3 is correctly expressed in Tex44 -KO testis and reciprocally (Fig. 2 b). Nevertheless, this study allowed us to reveal a new gene important for sperm structure and function.
Even though the knockout of Tex44 does not really reproduce the phenotype observed in the Rc3 IRCS males (moderate hypofertility, abnormal anchoring of the acrosome to the nucleus, and persistence of residual bodies at the sperm midpiece) [ 7 ], it exhibits other alterations (flagellum defects, abnormal mitochondria). Here, we described a new gene, Tex44 , that is implicated in a reproductive phenotype in mice. Taken together, our results show that Tex44 in mice is implicated in the correct set-up of the sperm flagellum during spermatogenesis and more precisely during spermiogenesis. The precise function of the TEX44 protein, its interaction with other sperm proteins, as well as its involvement in humans remain to be investigated.
Availability of data and materials
Not applicable.
Abbreviations
Interspecific Recombinant Congenic Strain
Quantitative Trait Locus
Clustered Regularly Interspaced Short Palindromic Repeats
Testis-expressed protein 44
Multiple Morphological Abnormalities of the Flagella
Stimulated emission depletion
Fertilization Rate: Average number of fertilized oocytes among the total number of oocytes
Fertilization Index: Average number of fused sperm per oocyte
Principal piece
WHO TEAM : sexual and reproductive health and research. Infertility prevalence estimates, 1990–2021. 2023.
Agarwal A, Mulgund A, Hamada A, Chyatte MR. A unique view on male infertility around the globe. Reprod Biol Endocrinol. 2015;13:37.
Article PubMed PubMed Central Google Scholar
Ben Khelifa M, Coutton C, Zouari R, Karaouzène T, Rendu J, Bidart M, et al. Mutations in DNAH1, which encodes an inner arm heavy chain dynein, lead to male infertility from multiple morphological abnormalities of the sperm flagella. Am J Hum Genet. 2014;94(1):95–104.
Article CAS PubMed PubMed Central Google Scholar
Touré A, Martinez G, Kherraf ZE, Cazin C, Beurois J, Arnoult C, et al. The genetic architecture of morphological abnormalities of the sperm tail. Hum Genet. 2021;140(1):21–42.
Article PubMed Google Scholar
Houston BJ, Riera-Escamilla A, Wyrwoll MJ, Salas-Huetos A, Xavier MJ, Nagirnaja L, et al. A systematic review of the validated monogenic causes of human male infertility: 2020 update and a discussion of emerging gene-disease relationships. Hum Reprod Update. 2021;28(1):15–29.
Krausz C, Riera-Escamilla A. Genetics of male infertility. Nat Rev Urol. 2018;15(6):369–84.
Article CAS PubMed Google Scholar
Vatin M, Girault MS, Firlej V, Marchiol C, Ialy-Radio C, Montagutelli X, et al. Identification of a New QTL Region on Mouse Chromosome 1 Responsible for Male Hypofertility: Phenotype Characterization and Candidate Genes. Int J Mol Sci. 2020;21(22):8506.
Girault MS, Dupuis S, Ialy-Radio C, Stouvenel L, Viollet C, Pierre R, et al. Deletion of the Spata3 Gene Induces Sperm Alterations and In Vitro Hypofertility in Mice. Int J Mol Sci. 2021;22(4):1959.
Bellil H, Ghieh F, Hermel E, Mandon-Pepin B, Vialard F. Human testis-expressed (TEX) genes: a review focused on spermatogenesis and male fertility. Basic Clin Androl. 2021;31(1):9.
Herrero J, Muffato M, Beal K, Fitzgerald S, Gordon L, Pignatelli M, et al. Ensembl comparative genomics resources. Database. 2016;2016:bav096.
Jumeau F, Com E, Lane L, Duek P, Lagarrigue M, Lavigne R, et al. Human spermatozoa as a model for detecting missing proteins in the context of the chromosome-centric human proteome project. J Proteome Res. 2015;14(9):3606–20.
Gan H, Wen L, Liao S, Lin X, Ma T, Liu J, et al. Dynamics of 5-hydroxymethylcytosine during mouse spermatogenesis. Nat Commun. 2013;4:1995.
Moretti C, Vaiman D, Tores F, Cocquet J. Expression and epigenomic landscape of the sex chromosomes in mouse post-meiotic male germ cells. Epigenet Chromatin. 2016;9:47.
Article Google Scholar
Kissel H, Georgescu MM, Larisch S, Manova K, Hunnicutt GR, Steller H. The Sept4 septin locus is required for sperm terminal differentiation in mice. Dev Cell. 2005;8(3):353–64.
Erdős G, Pajkos M, Dosztányi Z. IUPred3: prediction of protein disorder enhanced with unambiguous experimental annotation and visualization of evolutionary conservation. Nucleic Acids Res. 2021;49(W1):W297-303.
Szklarczyk D, Kirsch R, Koutrouli M, Nastou K, Mehryary F, Hachilif R, et al. The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res. 2023;51(D1):D638–46.
Murat F, Mbengue N, Winge SB, Trefzer T, Leushkin E, Sepp M, et al. The molecular evolution of spermatogenesis across mammals. Nature. 2023;613(7943):308–16.
Freitas MJ, Vijayaraghavan S, Fardilha M. Signaling mechanisms in mammalian sperm motility. Biol Reprod. 2017;96(1):2–12.
PubMed Google Scholar
Gervasi MG, Visconti PE. Molecular changes and signaling events occurring in spermatozoa during epididymal maturation. Andrology. 2017;5(2):204–18.
Cornwall GA. New insights into epididymal biology and function. Hum Reprod Update. 2009;15(2):213–27.
Coutton C, Escoffier J, Martinez G, Arnoult C, Ray PF. Teratozoospermia: spotlight on the main genetic actors in the human. Hum Reprod Update. 2015;21(4):455–85.
Touré A, Lhuillier P, Gossen JA, Kuil CW, Lhôte D, Jégou B, et al. The testis anion transporter 1 (Slc26a8) is required for sperm terminal differentiation and male fertility in the mouse. Hum Mol Genet. 2007;16(15):1783–93.
Olson GE, Winfrey VP, NagDas SK, Hill KE, Burk RF. Selenoprotein P is required for mouse sperm development1. Biol Reprod. 2005;73(1):201–11.
Yin Y, Mu W, Yu X, Wang Z, Xu K, Wu X, et al. LRRC46 accumulates at the midpiece of sperm flagella and is essential for spermiogenesis and male fertility in mouse. Int J Mol Sci. 2022;23(15):8525.
Liu C, Wang Q, Gu L, Wang X, Yin Y, Huang T, et al. CCDC176 stabilizes microtubule doublets 1 and 9 to ensure proper sperm movement. Curr Biol. 2023;33(16):3371-3388.e7.
He X, Mu W, Wang Z, Xu K, Yin Y, Lu G, et al. Deficiency of the Tmem232 gene causes male infertility with morphological abnormalities of the sperm flagellum in mice. Cells. 2023;12(12):1614.
Oura S, Kazi S, Savolainen A, Nozawa K, Castañeda J, Yu Z, et al. Cfap97d1 is important for flagellar axoneme maintenance and male mouse fertility. PLoS Genet août. 2020;16(8): e1008954.
Article CAS Google Scholar
Zhang B, Ma H, Khan T, Ma A, Li T, Zhang H, et al. A DNAH17 missense variant causes flagella destabilization and asthenozoospermia. J Exp Med. 2020;217(2):e20182365.
Konno A, Ikegami K, Konishi Y, Yang HJ, Abe M, Yamazaki M, et al. Ttll9-/- mice sperm flagella show shortening of doublet 7, reduction of doublet 5 polyglutamylation and a stall in beating. J Cell Sci. 2016;129(14):2757–66.
CAS PubMed Google Scholar
Sato H, Taketomi Y, Isogai Y, Miki Y, Yamamoto K, Masuda S, et al. Group III secreted phospholipase A2 regulates epididymal sperm maturation and fertility in mice. J Clin Invest. 2010;120(5):1400–14.
Sampson MJ, Decker WK, Beaudet AL, Ruitenbeek W, Armstrong D, Hicks MJ, et al. Immotile sperm and infertility in mice lacking mitochondrial voltage-dependent anion channel type 3. J Biol Chem. 2001;276(42):39206–12.
Lo JCY, Jamsai D, O’Connor AE, Borg C, Clark BJ, Whisstock JC, et al. RAB-like 2 has an essential role in male fertility, sperm intra-flagellar transport, and tail assembly. PLoS Genet. 2012;8(10): e1002969.
Luck K, Kim DK, Lambourne L, Spirohn K, Begg BE, Bian W, et al. A reference map of the human binary protein interactome. Nature. 2020;580(7803):402–8.
Rolland T, Taşan M, Charloteaux B, Pevzner SJ, Zhong Q, Sahni N, et al. A proteome-scale map of the human interactome network. Cell. 2014;159(5):1212–26.
Calvel P, Kervarrec C, Lavigne R, Vallet-Erdtmann V, Guerrois M, Rolland AD, et al. CLPH, a novel casein kinase 2-phosphorylated disordered protein, is specifically associated with postmeiotic germ cells in rat spermatogenesis. J Proteome Res. 2009;8(6):2953–65.
Chen Y, Liang P, Huang Y, Li M, Zhang X, Ding C, et al. Glycerol kinase-like proteins cooperate with Pld6 in regulating sperm mitochondrial sheath formation and male fertility. Cell Discov. 2017;3:17030.
Download references
Acknowledgements
The authors would like to thank A. Schmitt from the Electron Microscopy Facility (Institut Cochin, Paris), R. Onifarasoaniaina from the HISTIM core facility (Institut Cochin, Paris), J. Lesieur and T. Guilbert from the IMAG’IC core facility (Institut Cochin, Paris). The authors thank P. Lorès, A.Touré and M. Whitfield for providing scientific advice.
The authors would like to thank PHENOMIN—Institut Clinique de la Souris ( http://www.phenomin.fr ) for financing (French state funds through the Agence Nationale de la Recherche under the frame program Investissements d'Avenir ANR-10-IDEX-0002-02, ANR-10-INBS-07 PHENOMIN) and generating the mouse model. SD and M-SG are recipients of fellowships from the Ecole Doctorale BioSPC Université Paris Cité. This study was supported by the EUR G.E.N.E. (reference #ANR-17-EURE-0013) and is part of the Université Paris Cité IdEx #ANR-18-IDEX-0001 funded by the French government through its “Investments for the future” program.
Author information
Ahmed Ziyyat and Sandrine Barbaux have contributed equally to this work.
Authors and Affiliations
Université de Paris, Institut Cochin, INSERM, CNRS, 75014, Paris, France
Sophie Dupuis, Marie-Sophie Girault, Morgane Le Beulze, Côme Ialy-Radio, Ahmed Ziyyat & Sandrine Barbaux
Cancer Research UK Cambridge Institute, University of Cambridge, Cambridge, UK
Luis Bermúdez-Guzmán
Service d’Histologie, d’Embryologie, Biologie de La Reproduction, AP-HP, Hôpital Cochin, 75014, Paris, France
Ahmed Ziyyat
You can also search for this author in PubMed Google Scholar
Contributions
SB and AZ designed the project. Material preparation, data collection and analysis were performed by all authors. The first draft of the manuscript was written by SD and all authors commented on previous versions of the manuscript. LB-G explored the evolutionary history of TEX44 and did the bioinformatics analysis on structure and function. All authors read and approved the final manuscript.
Corresponding author
Correspondence to Sandrine Barbaux .
Ethics declarations
Ethics approval and consent to participate.
Authorizations for animal experimentation were obtained from local and governmental ethical review committees: Authorization APAFIS #14124–2017072510448522 v26, A. Ziyyat (2018–2023). Local (C2EA-34, Comité d’éthique en matière d’expérimentation animale Paris Descartes) and governmental (Apafis) Ethics Committees act on the Basel Declaration.
Human samples were obtained after informed consents of the patients. The GERMETHEQUE pilotage committee approved the design of this study under the number 20220101. The Biobank has a declaration DC-2021-4820 and an authorization AC-2019-3487 at the national level. These Ethics Committees act on the Helsinki Declaration.
Consent for publication
Competing interests.
The authors have no financial interests to disclose.
Additional information
Publisher's note.
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
11658_2024_587_moesm1_esm.pptx.
Supplementary Material 1: Figure 1. Evolutionary history and expression of Spata3 compared to Tex44 . (a). The ensemble Gene tree for Spata3 shows that the gene first appeared in placental mammals. (b). Single-cell RNA sequencing data confirmed the tissue-specific expression of Spata3 in early and mainly late spermatids, just like Tex44 . (c). Data from The Huma Protein Atlas shows that the expression of Tex44 and Spata3 is similar in different male germ cell types.
11658_2024_587_MOESM2_ESM.pptx
Supplementary Material 2: Figure 2. Bioinformatics analysis on TEX44 structure and function. (a). The Alphafold prediction for TEX44 shows a disordered protein with very low confidence scores. (b). The IUPred3 and PDBSum tools confirm an overall disordered protein with some scarce alpha helices. (c). DeepTMHMM prediction suggests that TEX44 is not a membrane protein. (d). The STRING network for TEX44 displays four main clusters of interactors, with four experimentally determined interactors involved in mitochondrial function.
11658_2024_587_MOESM3_ESM.xlsx
Supplementary Material 3: Table 1. List of SNPs observed in the Tex44 and Spata3 genes of the Spretus species compared to the C57BL/6 reference genome and their potential impact according to the Polyphen-2 and SIFT softwares.
Supplementary Material 4: Table 2. List of primers used, their sequence, position, expected amplicon size (bp) and use.
Supplementary material 5: table 3. list of placental mammals not reported by ensemble., 11658_2024_587_moesm6_esm.xlsx.
Supplementary Material 6: Table 4. Comparison of the phenotypes of the Rc3 IRCS line, the Tex44 -KO and the Spata3 -KO lines.
Supplementary Material 7: Table 5. Raw data corresponding to Figures 3b,c,d, 4b and 7b.
Rights and permissions.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ .
Reprints and permissions
About this article
Cite this article.
Dupuis, S., Girault, MS., Le Beulze, M. et al. The lack of Tex44 causes severe subfertility with flagellar abnormalities in male mice. Cell Mol Biol Lett 29 , 74 (2024). https://doi.org/10.1186/s11658-024-00587-5
Download citation
Received : 03 January 2024
Accepted : 29 April 2024
Published : 15 May 2024
DOI : https://doi.org/10.1186/s11658-024-00587-5
Share this article
Anyone you share the following link with will be able to read this content:
Sorry, a shareable link is not currently available for this article.
Provided by the Springer Nature SharedIt content-sharing initiative
- Spermatogenesis
- Male infertility
- Flagellar bending
- Mouse model
Cellular & Molecular Biology Letters
ISSN: 1689-1392
- Submission enquiries: Access here and click Contact Us
- General enquiries: [email protected]
IMAGES
VIDEO
COMMENTS
When drafting an application letter for a missing result, clarity and politeness are crucial. Start with a respectful salutation and clearly state your name, department/year, and university roll number. Mention the date the results were declared and explain the issue with your result. Request the authorities to investigate and address the matter.
The application should state the connection between the child and the sender of the letter. Application To Principal Samples. Addressing an application to principal the proper way for asking leave from school classes for a few days. Taking a vacation without applying for it is an inappropriate way. It gives a bad impression and also taking ...
The format of the application means the structure that is to be followed when drafting an application to the Principal. Below is the standard format for writing an application to the Principal: Receiver's Address. [Mention the person being addressed, i.e. 'The Principal' and then the school's address.] Date.
Step-by-step Guide on How to Write the Application - Format to Follow. Opening Statement and Introduction. Start the application by addressing the principal respectfully and introducing yourself (mandatory in case of a leave letter to principal). For example, "Respected Principal, I am writing this application to request a leave.".
Here's a common format to use: Receiver's Address [Write down who you're addressing, like 'The Principal', and then the school's address.] Date [Put the date when you're writing the application. This makes it official.] Subject [A short sentence that tells why you're writing this application.] Salutation [This is where you say ...
The format of the application means the structure that is to be followed when drafting an application to the Principal. Below is the standard format for writing an application to the Principal: Receiver's Address. [Mention the person being addressed, i.e. 'The Principal' and then the school's address.] Date.
Letter Writing Format. Start your application by addressing the principal in a formal manner, such as "Dear Principal [Name]". If you don't know the principal's name, you can use "Dear Sir/Madam" instead. Introduce yourself: In the opening paragraph, introduce yourself and state your purpose for writing the application.
Application to Principal Tips. Write the heading and reference number properly. Begin with the very formal Sir/Madam. If the writer and the recipient are of the same rank, use Dear Sir/Dear Madam. Never use My Dear Sir/My Dear Madam. Mention the subject in brief. The body of the letter should be concise and to the point.
Request Letter to Principal for an On Duty Application of Two Days. The Principal. National Model Public School. Anna Nagar. Chennai - 600054. 10/06/2021. Subject: Request for On-Duty application for two days. Respected Sir, I am Mithuna M, a student of Class X C.
Date - Mention the date in the top right-hand corner. Principal's Details - Address the letter to your Principal with the school name. Use "Respected Sir/Madam". Subject - State the purpose/reason of application in 1 line here. Content - Write the content in clear paragraphs with all key details. Salutation - Use "Yours ...
First, find the sample template for application to principal for admission below. To, The Principal, [School Name], [School Address]. Subject: Application for Admission. Respected Principal, I, [Your Name], kindly request admission to your esteemed school in [Grade Level]. I am eager to become a part of the wonderful learning environment at ...
The Principal, St. Jude Public School, Anna Nagar, Jaipur - 302029. 10 January 2023. Subject: Request for leave for three days. Respected Sir, I'm Aneesha Raj, a Class X "T" student. I have been chosen to compete in the national badminton tournament that will be held at the Sawai Man Singh Stadium in Jaipur on January 20, 21, and 22.
When the Guardian is collecting the college mark sheet. You can use the same sample format in the case of collecting a marksheet from the college office. In that case, you can write it as-. To: The Principal. [College name] [College address] Subject: Request to permit my Guardian to collect my marksheet on my behalf.
Receiving address: You have to write the receiving address like "To the principal, to the headmaster, to the headmistress". Subject: The subject of the letter is very important because it gives an idea about the topic in a moment. Salutation: You can use "Respected sir/ madam, Sir/Madam," in the salutation.
Template Application for Principal Position at ABC School. To, The Principal ABC School Lahore. Date: 27 June 2023. Subject: Application for Principal Position. Respected Sir/Madam, I am writing to express my interest in the principal position at ABC School. I have over 10 years of experience in the education sector, including 5 years as a vice ...
New Delhi. 20 February 2023. Subject-Request for Transfer Certificate. Dear Sir, I, Anmol Malik, studying in class 9, am writing to request a Transfer Certificate (TC) for myself as my family is relocating to a new city. Due to this, I will have to continue my studies in a different school, and therefore, I need the TC from your school.
At the top of the letter, write 'The Principal' and the school's address followed by the date and subject of the letter. The subject line should not be more than 10-12 words and should convey the essence of the letter. Begin your letter with a salutation by addressing the principal respectfully using 'Dear Mr./Mrs./Ms.
KCET Result Link 2024 (soon) Students may download KEA KCET Result 2024 by the following steps: Visit the official website of KEA KCET, kea.kar.nic.in. Select KCET result 2024 tab on the dashboard. Input your application number and first four letters of your name in the provided space. Click Submit.
In such scenarios, all you would be asked to do is to write a letter to the class teacher, the principal or the head of the department requesting for a marksheet correction. Read through the article to learn how to write a letter to get your marksheet corrected. Table of Contents. How to Write an Application for Marksheet Correction?
VDOM DHTML e>Document Moved. Object Moved. This document may be found here.
Nov. 6, 2023. Mild Traumatic Brain Injury Management Guideline. View clinical recommendations for diagnosis and management of adults with mild TBI. Apr. 29, 2024. Health Care Provider Resources. View resources to manage and prevent concussions. Apr. 15, 2024.
Human infertility is a major public health issue that concerns 10-20% of couples of reproductive age. In half of the cases, the cause is due to male infertility [1, 2].Amongst the different causes of male infertility, quantitative and/or qualitative sperm abnormalities can be involved such as low sperm count (oligozoospermia), reduced sperm motility (asthenozoospermia), and abnormal sperm ...